Plasma exosome miR-101-3p and application thereof in preparation of vascular atherosclerosis monitoring product

Abstract

The invention discloses a plasma exosome miR-101-3p and an application of the plasma exosome miR-101-3p in preparation of a vascular atherosclerosis monitoring product. The nucleotide sequence of the gene is as shown in SEQ ID NO: 1. The relationship between the expression quantity of the miR-101-3p from the atherosclerosis plasma exosome and the atherosclerosis is found, meanwhile, the kit can detect the expression quantity of the miR-101-3p, whether a patient suffers from the atherosclerosis or not is judged in an assisted mode through the miR-101-3p level of the plasma exosome, and guiding significance is provided for early diagnosis of the atherosclerosis.

Description

Technical Field

[0001] The present invention relates to the field of medical biotechnology, and in particular to plasma exosome miR-101-3p and application thereof in the preparation of a vascular atherosclerosis monitoring product. Background Art

[0002] Atherosclerosis is an inflammatory disease of the endothelial space driven by low-density lipoprotein. Its pathological process involves endothelial damage, lipid deposition, inflammatory cell infiltration, foam cell production, and atherosclerotic plaque formation, which can affect arteries throughout the body, including coronary arteries, cerebral arteries, peripheral arteries, and aorta. Atherosclerosis has an insidious onset, but it is a risk factor for serious cardiovascular and cerebrovascular events such as myocardial infarction and ischemic stroke. Therefore, there is an urgent need for an optimized, sensitive, and clinically operable biomarker to detect and intervene in atherosclerosis early and prevent subsequent adverse events.

[0003] Exosomes are small, lipid-covered microvesicles with a diameter of 40-150nm and a phospholipid bilayer membrane structure. They are secreted by a variety of cells and widely exist in the extracellular matrix and body fluids. Current studies have shown that EVs carry various proteins, lipids, metabolites, nucleic acids and other substances to transmit signals, induce physiological changes in recipient cells, and are important media for parent cells to communicate with other cells. Exosomes contain a variety of RNA molecules, among which microRNA (miRNA) with coding information is an endogenous small RNA. Its expression level varies greatly between normal and pathological states, so it has the potential to be used as a biomarker for disease diagnosis.

[0004] At present, there are related reports and patents suggesting that exosomes can be used as a means of diagnosis and treatment of atherosclerosis. The Chinese invention patent with publication number CN116173060A discloses the use of exosomes secreted by mesenchymal stem cells in the treatment of coronary atherosclerosis. However, there is still a lack of reports on the early diagnosis of atherosclerosis by exosome-derived miRNA.

[0005] Therefore, there is an urgent need to develop an exosome-derived miRNA based on peripheral blood as a biomarker for early warning and diagnosis of atherosclerosis. Summary of the invention

[0006] The purpose of the present invention is to overcome the deficiencies of the prior art and provide a plasma exosome miR-101-3p (full name: microRNA-101-3p). At the same time, the present invention has found that the use of exosome miR-101-3p as a biomarker in the preparation of products for monitoring vascular atherosclerosis provides technical support for vascular atherosclerosis monitoring, which has great clinical significance. To achieve the above purpose, the technical solution designed by the present invention is as follows:

[0007] The present invention provides a plasma exosome miR-101-3p, whose nucleotide sequence is shown in SEQ ID NO: 1: UACAGUACUGUGAUAACUGAA.

[0008] The present invention also provides a primer sequence for reverse transcription of the plasma exosome miR-101-3p, the nucleotide sequence of which is shown in SEQ ID NO: 2:

[0009] GTCGTATCGACTGCAGGGTCCGAGGTATTCGCAGTCGATA CGACTTCAGT.

[0010] The present invention also provides a use of the above-mentioned plasma exosome miR-101-3p as a biomarker in the preparation of a product for monitoring vascular atherosclerosis, wherein the product is a reagent or a kit.

[0011] The present invention also provides a primer pair for detecting exosomal microRNA 101-3p, wherein the primer pair miR-101-3p-H / M is a primer miR-101-3p-H / MF and a primer miR-101-3p-H / MR; specifically, as follows:

[0012] Primer miR-101-3p-H / MF: CGGCGGCTACAGTACTGTGATA,

[0013] Primer miR-101-3p-H / MR: ACTGCAGGGTCCGAGGTATT.

[0014] The present invention also provides a use of the above-mentioned plasma exosome miR-101-3p as a biomarker in the preparation of a product for evaluating lipid deposition in vascular atherosclerotic plaques, wherein the product is a reagent or a kit.

[0015] The present invention also provides a kit, which comprises the above-mentioned primer pair.

[0016] Furthermore, the kit also includes 5× PrimeScript RT Master Mix, enzyme-free water, the above-mentioned primer sequence for reverse transcription of miR-101-3p and Yeasen qPCR SYBR Green Master Mix;

[0017] The present invention also provides an application of the above kit in detecting, analyzing or predicting atherosclerosis.

[0018] Beneficial effects of the present invention:

[0019] The nucleotide sequence of miR-101-3p of the present invention is

[0020] The present invention finds the relationship between the expression of miR-101-3p derived from plasma exosomes of atherosclerosis and atherosclerosis. At the same time, the kit of the present invention can detect the expression of miR-101-3p, and the plasma exosome miR-101-3p level is used to assist in determining whether a patient suffers from atherosclerosis, and provide guidance for the early diagnosis of atherosclerosis. BRIEF DESCRIPTION OF THE DRAWINGS

[0021] Figure 1 The volcano plot shows the differential expression of microRNA in plasma exosomes between patients with atherosclerosis and those without atherosclerosis.

[0022] Figure 2 The expression level of plasma exosomal miR-101-3p in 6 patients with atherosclerosis and 6 patients without atherosclerosis;

[0023] Figure 3 The expression of plasma exosomal miR-101-3p in 50 patients with atherosclerosis and 31 patients without atherosclerosis;

[0024] Figure 4 ROC curve for distinguishing atherosclerosis and non-atherosclerosis patients using plasma exosomal miR-101-3p;

[0025] Figure 5 This is the base sequence diagram of human miR-101-3p and the corresponding mouse microRNA;

[0026] Figure 6 The figure shows the expression of miR-101-3p in blood vessels and plasma of mice with atherosclerosis;

[0027] Figure 7 This is a correlation analysis of miR-101-3p expression in blood vessels and plasma exosomes in atherosclerotic mice;

[0028] Figure 8 This is a correlation analysis chart between the expression level of miR-101-3p in atherosclerotic plaques and the expression level of miR-101-3p in plasma exosomes.

[0029] Fig. 9 This is a correlation analysis chart between the expression level of miR-101-3p in atherosclerotic plaques and the density of foam cells in the plaques. DETAILED DESCRIPTION

[0030] The present invention is further described in detail below in conjunction with specific embodiments so that those skilled in the art can understand.

[0031] Example 1 Discovery and sequence analysis of plasma exosome miR-101-3p

[0032] The subjects in this example include 6 patients with atherosclerotic plaque formation (AS) and 6 age- and sex-matched non-atherosclerotic control patients (Control).

[0033] After collecting venous blood from patients, the classic exosome extraction method, differential-ultracentrifugation, was used to extract total plasma exosomes, and second-generation microRNA high-throughput sequencing was performed. The microRNA sequence obtained by sequencing was exosomal miR-101-3p, and its nucleotide sequence was shown in SEQ ID NO: 1: UACAGUACUGUGAUAACUGAA. At the same time, the differential expression matrix was obtained based on the above high-throughput sequencing and differential expression analysis was performed.

[0034] Subsequently, the miRNAs with the most significant increase in expression levels were quantitatively detected in the total plasma exosomes extracted from AS and control patients. The results showed that patients with atherosclerosis had a group of significantly upregulated miRNAs compared with non-atherosclerotic control patients, among which miR-101-3p was the most significantly upregulated ( Figure 1 ), and the expression level of miR-101-3p in plasma exosomes of patients with atherosclerosis was significantly higher than that of non-atherosclerotic control patients ( Figure 2 ).

[0035] Example 2 Primer sequences for detecting miR-101-3p

[0036] (1) The primer sequence for reverse transcription of miR-101-3p is:

[0037] 5'-GTCGTATCGACTGCAGGGTCCGAGGTATTCGCAGTCGA TACGACTTCAGT-3', as shown in SEQ ID NO:2.

[0038] (2) Primer pair sequence for detecting miR-101-3p

[0039] The primer pair miR-101-3p-H / M is primer miR-101-3p-H / MF and primer miR-101-3p-H / MR; wherein, they are:

[0040] Primer miR-101-3p-H / MF: CGGCGGCTACAGTACTGTGATA, as shown in SEQ ID NO: 3

[0041] Primer miR-101-3p-H / MR: ACTGCAGGGTCCGAGGTATT, as shown in SEQ ID NO:4.

[0042] Example 3 Preparation of a kit for detecting miR-101-3p

[0043] The kit for detecting miR-101-3p includes the above-mentioned primer pair, 5× PrimeScript RT Master Mix, enzyme-free water, the above-mentioned reverse transcription miR-101-3p primer sequence and Yeasen qPCR SYBR Green Master Mix.

[0044] Example 4 Plasma exosomal miR-101-3p has good potential for identifying AS. The subjects in this example included 50 patients with atherosclerotic plaque formation (AS) and 31 age- and gender-matched non-atherosclerotic control patients (Control).

[0045] After collecting the patient's venous blood, the classic exosome extraction method, differential-ultracentrifugation, was used to extract total plasma exosomes, and the miR-101-3p expression level was quantitatively detected using a miR-101-3p detection kit.

[0046] The results showed that the expression level of plasma exosome miR-101-3p in patients with atherosclerosis was significantly higher than that in the control group of non-atherosclerotic subjects, suggesting that miR-101-3p can be used as a good biomarker for atherosclerosis with good reliability and stability ( Figure 3 ).

[0047] The receiver operating characteristic curve (ROC curve) was further used to evaluate the diagnostic efficacy of miR-101-3p for atherosclerosis.

[0048] The results showed that the area under the ROC curve for the comparison between the AS group and the Control group was 0.739, and the 95% confidence interval was 0.623-0.856 ( Figure 4 ). The expression level of plasma exosomal miR-101-3p has a good diagnostic efficacy for atherosclerosis and has good potential for distinguishing vascular atherosclerosis.

[0049] Example 5 Plasma exosomal miR-101-3p is significantly increased in AS vessels

[0050] A classic method was used to construct an atherosclerosis mouse (AS) model and its control group (Con), that is, ApoE knockout mice were fed with a high-fat diet and a normal diet for 14 weeks, respectively.

[0051] The differential centrifugation method was used to extract vascular and plasma exosomes from AS mice, and the miR-101-3p expression level was quantitatively detected using a miR-101-3p detection kit and correlation analysis was performed.

[0052] The results showed that the exosome miR-101-3p in the blood vessels and plasma of atherosclerotic mice increased significantly ( Figure 5 ) and the two are correlated.

[0053] Furthermore, human-derived miR-101-3p and its corresponding mouse-derived miR-101-3p were searched in the miRBase public database for base sequence comparison.

[0054] The results showed that the base sequence of mouse miR-101-3p was completely consistent with that of human miR-101-3p, so plasma exosomal miR-101-3p was highly expressed across species in atherosclerotic diseases ( Figure 7 ).

[0055] Example 6 miR-101-3p is highly expressed in carotid artery plaques

[0056] Immunofluorescence staining of miR-101-3p was performed on frozen sections of atherosclerotic plaque tissues of patients undergoing carotid endarterectomy. Specifically, the expression of miR-101-3p in plaques was quantitatively analyzed by fluorescent in situ hybridization probes, the difference in the expression levels of miR-101-3p in the above-mentioned different types of atherosclerotic plaques was analyzed, and the correlation analysis was performed with the plasma miR-101-3p expression levels of the same patients.

[0057] The results showed that there was obvious cell infiltration and lipid deposition in atherosclerotic plaques. The expression of miR-101-3p was high in the plaque tissue of patients with atherosclerosis, and was positively correlated with the expression level of miR-101-3p in plasma, indicating that miR-101-3p is a good biomarker for AS ( Figure 8 In addition, the expression of plasma exosomal miR-101-3p was positively correlated with the density of foam cells in plaques ( Fig. 9 ), which indicates that miR-101-3p, as an exosome-related biomarker that can be stably detected in plasma, has a certain predictive significance for the progression of lipid deposition in plaques of patients with atherosclerosis. miR-101-3p, as an exosome-related biomarker that can be stably detected in plasma, has a certain predictive significance for the stability of plaques in patients with atherosclerosis.

[0058] Although the above embodiments have been described in detail, they are only a part of the embodiments of the present invention, not all of them. People can also obtain other embodiments based on this embodiment without creativity, and these embodiments all belong to the protection scope of the present invention.

Claims

1. A plasma exosomal miR-101-3p, whose nucleotide sequence is shown in SEQ ID NO: 1: UACAGUACUGUGAUAACUGAA.

2. A primer sequence for reverse transcription of the plasma exosome miR-101-3p according to claim 1, wherein the nucleotide sequence is shown in SEQ ID NO: 2: GTCGTATCGACTGCAGGGTCCGAGGTATTCGCAGTCGATA CGACTTCAGT.

3. A use of the plasma exosome miR-101-3p as a biomarker in the preparation of a product for monitoring vascular atherosclerosis according to claim 1, wherein: The product is a reagent or a kit.

4. A use of the plasma exosome miR-101-3p as a biomarker in the preparation of a product for evaluating lipid deposition in vascular atherosclerotic plaques according to claim 1, wherein: The product is a reagent or a kit.

5. A primer pair for detecting plasma exosome miR-101-3p, characterized in that: The primer pair miR-101-3p-H / M is primer miR-101-3p-H / MF and primer miR-101-3p-H / MR; specifically as follows: Primer miR-101-3p-H / MF: CGGCGGCTACAGTACTGTGATA, Primer miR-101-3p-H / MR: ACTGCAGGGTCCGAGGTATT.

6. A kit, characterized in that: The kit comprises the primer pair according to claim 4.

7. The kit according to claim 6, characterized in that: The kit further comprises 5× PrimeScript RT Master Mix, enzyme-free water, the primer sequence for reverse transcription of miR-101-3p according to claim 2, and Yeasen qPCR SYBRGreen Master Mix.

8. Use of the kit according to claim 6 in detecting, analyzing or predicting atherosclerosis.

Images