Receptor-like kinase OsERL gene for regulating and controlling development of rice female gametophyte
By studying the function of OsERL gene in rice, the problem of unclear development regulation mechanism of rice female gametophytes was solved, and the impact on rice fruiting rate and yield was achieved, which had important breeding application value.
Patent Information
- Application Number
- CN202411534514.5
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2024-10-31
- Publication Date
- 2025-02-11
AI Technical Summary
The developmental regulation mechanism of female gametophytes in rice is unclear, which leads to challenges in breeding work, especially in the creation of sterile genetic materials for female rice.
A receptor-like kinase OsERL gene that regulates the development of female gametophytes in rice was discovered and studied. By constructing OsERL gene deletion mutants and backfilling vectors, it studied its role in rice reproductive development.
By regulating the development of female gametophytes, the OsERL gene affects the fruiting rate of rice, thereby affecting yield, providing important research findings and breeding application value.
Smart Images
Figure BDA0005111231540000031 
Figure BDA0005111231540000041 
Figure HDA0005111231550000011
Abstract
Description
[0001] manual Technical Field
[0002] The invention relates to a receptor-like kinase OsERL gene for regulating the development of rice female gametophyte and its participation in regulating the development of rice female gametophyte, belonging to the field of plant biotechnology. Background Art
[0003] The female gametophyte of angiosperms is crucial for the alternation of generations in plants, including the process of fertilization of the egg cell and the central cell to form the embryo and endosperm of the seed respectively. The development of the female gametophyte of plants takes place in the ovule, which develops from the finger-like protrusions formed in the placenta tissue of the pistil. There are many modes of female gametophyte development in higher plants, but most (70%) flowering plants, such as Arabidopsis, rice, soybean, corn, cotton, tomato, etc., are classified as the Polygonum female gametophyte mode. In this mode, the development of the female gametophyte of plants is divided into two stages: megasporogenesis and female gametophyteogenesis.
[0004] The female gametophyte is the core site for double fertilization in angiosperms, and its normal development is the prerequisite for plants to complete sexual reproduction and form seeds. With the development of high-throughput sequencing and the emergence of single-cell technology, research on key genes involved in the development of plant female gametophytes has made great progress, but there are still few studies in important crops such as rice. Since a rice spikelet contains only one ovule, and an ovule has only one female gametophyte, and the female gametophyte is deeply buried in the sporophytic ovule, it is difficult to separate it from the surrounding tissues, so the research is difficult. At present, many regulatory mechanisms in the development of plant female gametophytes are still unclear, such as what are the key regulatory genes for the fate transition from somatic cells to reproductive cells (archosporium cells, AC)? What signals regulate the specialization of megaspore mother cells (MMC)? What is the information exchange between female germ line cells and surrounding somatic cells? These scientific issues urgently need to be studied in depth. Summary of the invention
[0005] The present invention mainly provides a gene OsERL involved in regulating the development of rice female gametophytes. The function of the gene has important application value for the research of rice reproductive development and the creation of rice female sterility genetic materials.
[0006] The contents of the present invention are:
[0007] The invention discloses a receptor-like kinase OsERL gene for regulating the development of rice female gametophyte. The nucleotide sequence of the OsERL gene is shown as SEQ ID NO.1.
[0008] The method for constructing the above-mentioned OsERL gene deletion mutant specifically comprises the following steps:
[0009] (1) Construction of OsERL gene editing expression vector;
[0010] (2) Introduce the expression vector into rice plants to obtain gene-deficient plants.
[0011] The expression vector in step (1) utilizes a binary system to integrate the Cas9 protein expression cassette into the binary vector, and loads a multiple cloning site Bsa I of multiple sgRNA expression cassettes at a position close to the binary vector RB. The sgRNA expression cassette elements are installed on an intermediate plasmid vector, which can be spliced together by enzyme cutting, ligation and PCR methods, and then assembled into the binary vector using the Golden Gate or Gibson Assembly cloning method, thereby ultimately achieving gene editing of the OsERL gene.
[0012] The gene-deficient plant in step (2) includes the addition or deletion of the nucleotide base sequence of the target gene OsERL.
[0013] The addition is the addition of 1 bp base, and the deletion is the deletion of 2 bp base.
[0014] The gene-deficient plants include oserl-1, oserl-2 and oserl-3, and their nucleotide sequences are: SEQ ID NO.2, SEQ ID NO.3 and SEQ ID NO.4 respectively.
[0015] Furthermore, the present invention also discloses a complementation vector for a rice female gametophyte development receptor-like kinase OsERL gene deletion mutant, wherein the complementation vector skeleton is pGWB504, and the complementation vector comprises a promoter 2500 bp upstream of the start codon ATG of the OsERL gene and a complete CDS sequence of the OsERL gene.
[0016] The significant advantage of the present invention is that the newly discovered rice OsERL gene affects the rice fruit setting rate and ultimately the yield by regulating the development of female gametophytes, which is of great significance to the research on the regulation of female reproductive development of rice and has certain application value in rice breeding. BRIEF DESCRIPTION OF THE DRAWINGS
[0017] Figure 1 These are the structure and gene editing identification results of the OsERL gene that regulates rice female gametophyte development.
[0018] Figure 2The present invention is an observation and statistics of the seed setting rate of the OsERL gene function loss mutant and complementation line regulating the female gametophyte of rice. Figure A shows the inflorescence morphology and seed setting of the wild-type Zhonghua 11 (ZH11), oserl-1, oserl-2, oserl-3 mutants and complementation line (Com#) at maturity; Figure B shows the seed setting rate of ZH11, oserl-1 mutant and Com#.
[0019] Figure 3 The present invention is to observe the embryo sac fertility of the OsERL gene function loss mutant and complemented strain that regulates the female gametophyte of rice. DETAILED DESCRIPTION
[0020] Example 1 Construction of vector
[0021] 1. Construction of CRISPR / Cas 9 vector:
[0022] The gene editing system used in this study is the CRISPR / Cas9 system modified by Liu Yaoguang's research group at South China Agricultural University in 2015. This system uses a binary system to integrate the Cas9 protein expression cassette into the binary vector, and loads the multiple cloning site Bsa I of multiple sgRNA expression cassettes near the binary vector RB. The sgRNA expression cassette elements are installed on an intermediate plasmid vector, which can be spliced together by enzyme cutting, ligation and PCR methods, and then assembled into the binary vector using the Golden Gate or Gibson Assembly cloning method, ultimately achieving gene editing of the OsERL gene. (Xie X, Ma X, Zhu Q, Zeng D, Li G, Liu YG. 2017. CRISPR-GE: A Convenient Software Toolkit for CRISPR-Based Genome Editing. Mol. Plant 10(9): 1246-1249.), (Liu W., Xie X., Ma X., Li J., Chen J., and Liu Y.-G. 2015. DSDecode: A Web-based Tool for Decoding of Sequencing Chromatograms for Genotyping of Targeted Mutations. Mol. Plant 8(9): 1431-1433.). The vector backbone is the pCAMBIA1300 plant expression vector, and the inserted target site sequence is:
[0023] ERL-UT1-F:TTGGCCGCGTTCCCGAAACGTTTTAGAGCTATGCTG;
[0024] ERL-UT1-R:GTTTCGGGAACGCGGCCAATGCCACGGATCATCTGC;
[0025] ERL-UT2-F:CTCCAAGCTCAAGCAGCTTGGTTTTAGAGCTATGCTG;
[0026] ERL-UT2-R:CAAGCTGCTTGAGCTTGGAGTGCCACGGATCATCTGC.
[0027] Figure 1 The structure and gene editing identification results of the OsERL gene that regulates the development of rice female gametophytes. As shown in the figure, three homozygous mutants with different editing methods are shown, named oserl-1, oserl-2, and oserl-3. The subsequent results are mainly shown with oserl-1.
[0028] 2. Construction of vectors for complementation lines
[0029] (1) Using wild-type ZH11 genomic DNA as a template, the promoter 2500 bp upstream of the start codon ATG of the OsERL gene was amplified by PCR using the primers in Table 1;
[0030] (2) Using the cDNA of mature spikelet tissue as a template, the complete CDS sequence of the OsERL gene was amplified using the primers in Table 1;
[0031] (3) The two PCR fragments in (1) and (2) were connected to pENTR by Infusion enzyme. TM / D-TOPO vector (Invitrogen) and verified by sequencing, then recombined into the destination vector pGWB504 through LR reaction, and transformed into the oserl-1 mutant through Agrobacterium tumefaciens transformation method to obtain the complemented strain (Com#).
[0032] Table 1 Primer list
[0033]
[0034]
[0035] Example 2 Phenotypic Observation and Statistics
[0036] 1. Observation and statistics of fruit setting rate:
[0037] The wild-type ZH11, oserl-1 mutant and complemented lines (Com#) were planted in an artificial intelligence greenhouse, and the conditions were set as follows: temperature 26℃~28℃, air humidity 50%, light 14h, dark 10h. When the rice grew to maturity, the ears were cut off for fruiting rate statistics. At least 30 rice plants were counted for each line, and only 1 to 2 ears on the main stem of each plant were counted.
[0038] Figure 2 The present invention is an observation and statistics of the seed setting rate of the mutants and complemented strains of the OsERL gene that regulates the female gametophyte of rice. Figure A shows the inflorescence morphology and seed setting of the wild-type Zhonghua 11 (ZH11), oserl-1, oserl-2, oserl-3 mutants and the complemented strain (Com#) at maturity; Figure B shows the seed setting rate of ZH11, oserl-1 mutant and Com#. The above results show that after the loss of OsERL function, the seed setting rate of rice decreases, while the seed setting rate of the complemented strain is not significantly different from that of the wild type, suggesting that OsERL plays an important role in the reproductive development of rice, especially in fertility.
[0039] 2. Observation of rice embryo sac development
[0040] This study used rice ZH11 as the material and aimed to establish the connection between rice spikelet development and female gametophyte development through laser confocal observation during embryo sac development. The specific steps are as follows:
[0041] (1) Sampling: Sampling was carried out when the rice leaf age residue was 0.5, and the different developmental stages of rice ovules were defined according to the length of the spikelets. The spikelet length of 1.5-2 mm was the archosporium cell (AC) stage; the spikelet length of 2-3 mm was the megaspore mother cell (MMC) stage; the spikelet length of 3-4 mm was the meiosis stage; the spikelet length of 4-5 mm was the megaspore tetrad stage; the spikelet length of 5-6 mm was the FM stage; the spikelet length of 6-7 mm was the mitosis stage; the spikelet length of 7-8 mm was the mature embryo sac (MO) stage;
[0042] (2) Fixation: Fix with FAA fixative for 24 h (50% EtOH:HAc:HCHO=89:6:5), rinse twice with 50% ethanol, transfer to 70% ethanol, and separate the ovary under a dissecting microscope;
[0043] (3) Staining: rehydrate with 50%, 30% ethanol gradient and distilled water, mordanted with 2% KAl(SO4)2 for 20 minutes, stained with 10 mg / L eosin for 10-12 hours, separated with 2% KAl(SO4)2 for 20 minutes, and washed with water 2-3 times;
[0044] (4) Dehydration: Dehydration with ethanol gradient 30%, 50%, 70%, 80%, 90% and anhydrous ethanol in sequence, and anhydrous ethanol was repeated three times;
[0045] (5) Transparency: Use a mixture of anhydrous ethanol and methyl salicylate in equal volume ratios, leave it in transition for 1-2 hours, and finally use 100% methyl salicylate to make it transparent for more than 1 hour.
[0046] Observation: After the ovary becomes transparent, place it on a glass slide with methyl salicylate for sealing. Perform layered scanning observation of the mature embryo sac as a whole under a laser confocal microscope and obtain images.
[0047] Figure 3 The present invention is to observe the embryo sac fertility of the OsERL gene loss-of-function mutant and complemented strains that regulate the female gametophyte of rice. In the early stage of ovule development, archesporial cell (AC) and megaspore mother cell (MMC) stages, two types of ovules were observed. One type of ovule was one in which more than one AC-like cell or MMC-like cell appeared in the ovule, and the other type of ovule was one in which no reproductive cells were formed in the nucellar tissue, indicating that the specialization and fate transformation of female reproductive cells during megaspore development were defective in oserl-1 ovules. At maturity, the abnormal female gametophytes in oserl-1 have three phenotypes, namely: 1) two groups of female gametophytes in one ovule, 2) no female gametophyte, and 3) embryo sac abortion ( Figure 3 A). After pOsERL::ERL was complemented into the mutant, the female gametophyte in the mature ovule developed normally ( Figure 3 B). Figure 3 C is the ratio of wild-type and oserl-1 abnormal female gametophytes at the mature stage.
[0048] The results showed that the OsERL gene function-deficient mutant that regulates the development of rice female gametophytes had obvious defects in the development of female germ cells compared with the wild type ZH11, which led to a decrease in the seed setting rate of rice plants; after pERL::ERL was complemented to the mutant, the female gametophytes in the ovules developed normally, and the seed setting rate was restored to normal. This study proves that OsERL affects the seed setting rate of rice by regulating the development of rice female gametophytes. This discovery is of great significance to the study of the fate determination of rice female germ cells, which has certain application value in rice breeding.
[0049] The above description is only a preferred embodiment of the present invention. All equivalent changes and modifications made according to the scope of the patent application of the present invention should fall within the scope of the present invention.
Claims
1. A receptor-like kinase OsERL gene that regulates the development of rice female gametophytes, characterized in that: The nucleotide sequence of the OsERL gene is shown in SEQ ID NO.
1.
2. The method for constructing an OsERL gene deletion mutant according to claim 1, characterized in that: The specific steps include: (1) Construction of OsERL gene editing expression vector; (2) Introduce the expression vector into rice plants to obtain gene-deficient plants.
3. The method according to claim 2, characterized in that The expression vector in step (1) utilizes a binary system to integrate the Cas9 protein expression cassette into the binary vector, and loads a multiple cloning site Bsa I of multiple sgRNA expression cassettes at a position close to the binary vector RB. The sgRNA expression cassette elements are installed on an intermediate plasmid vector, which can be spliced together by enzyme cutting, ligation and PCR methods, and then assembled into the binary vector using the Golden Gate or Gibson Assembly cloning method, thereby ultimately achieving gene editing of the OsERL gene.
4. The method according to claim 2, characterized in that: The gene-deficient plant in step (2) includes the addition or deletion of the nucleotide base sequence of the target gene OsERL.
5. The method according to claim 4, characterized in that The addition is the addition of 1 bp base, and the deletion is the deletion of 2 bp base.
6. The method according to claim 4, characterized in that The gene-deficient plants include oserl-1, oserl-2 and oserl-3, and their nucleotide sequences are: SEQ ID NO.2, SEQ ID NO.3 and SEQ ID NO.4 respectively.
7. The complementation vector for the rice female gametophyte development receptor-like kinase OsERL gene deletion mutant according to claim 1, characterized in that: The complementing vector skeleton is pGWB504, and the complementing vector includes a promoter 2500 bp upstream of the start codon ATG of the OsERL gene and a complete CDS sequence of the OsERL gene.