Method for increasing L-histidine fermentation yield by strengthening Escherichia coli C1 metabolic pathway

Abstract

The present invention belongs to the field of biochemical engineering technology and provides a method for increasing the L-histidine fermentation yield by strengthening the C1 metabolic pathway of Escherichia coli. Methylobacterium extorquens )、Autotrophic ethanologenic Clostridium ( Clostridium autoethanogenum ), Vibrio natriuresis ( Vibrio natriegens ) Source fhs The expression of the gene increases the content of the cofactor fTHF in the cell, thereby significantly increasing the production and yield of L-histidine. The present invention provides a new strategy for increasing the fermentation level of L-histidine.

Description

Technical Field

[0001] The invention belongs to the technical field of biochemical engineering, and in particular relates to a method for increasing the L-histidine fermentation yield by strengthening the metabolic pathway of Escherichia coli C1. Background Art

[0002] L-histidine is an essential protein amino acid for the human body. It is very important for the growth of infants and animals. It is an amino acid variety urgently needed in the Chinese market. L-histidine has multiple physiological functions such as protein composition, conversion into antibodies, hormones, creatine, nucleic acids and other amino-containing substances. Therefore, L-histidine is widely used in various fields such as food and medicine. The main methods for producing L-histidine are protein hydrolysis, chemical synthesis and microbial fermentation. Compared with the first two preparation methods, microbial fermentation has the advantages of short fermentation cycle, mild reaction conditions and easy process control. It is the preferred method for industrial production of L-histidine. Summary of the invention

[0003] The object of the present invention is to provide a method for increasing the fermentation yield of L-histidine by strengthening the metabolic pathway of Escherichia coli C1.

[0004] The present invention is conceived as follows: In E. coli, glucose as a raw material needs to be converted into L-histidine through a ten-step enzyme-catalyzed reaction. Adenosine triphosphate (ATP) is one of the precursors for the synthesis of L-histidine, and its sufficient supply is crucial to the synthesis of histidine. The purine biosynthesis pathway requires the participation of two molecules of 10-formyltetrahydrofolate (fTHF, mainly synthesized by the C1 pathway) to synthesize one molecule of ATP, so C1 supply is an important target for L-histidine production. In E. coli, serine hydroxymethyltransferase (SHMT, synthesized by glyA The bifunctional formyltetrahydrofolate dehydrogenase / methylenetetrahydrofolate cyclohydrolase (FolD, encoded by folD encoding) catalyzes 5,10-methylenetetrahydrofolate (mTHF) to produce fTHF, so it is usually optimized by selecting glyA and folD The expression of the gene can enhance the supply of fTHF, but this strategy has the problem of too many targets for transformation and the adaptability of the expression intensity of multiple targets, which can easily affect the growth of the strain. Methylobacterium extorquens ), there is a formate-tetrahydrofolate ligase (FtfL, fhs Encoding) can directly convert tetrahydrofolate (THF) into fTHF in one step. Therefore, the introduction of FtfL from other strains is expected to increase the supply of cofactor fTHF, thereby further improving the production and yield of L-histidine.

[0005] In order to achieve the purpose of the present invention, in a first aspect, the present invention provides a method for increasing the fermentation yield of L-histidine by strengthening the metabolic pathway of Escherichia coli C1. The method for strengthening the metabolic pathway of Escherichia coli C1 is as follows: Methylobacterium extorquens )、Autotrophic ethanologenic Clostridium ( Clostridium autoethanogenum ) or Vibrio natriuresis ( Vibrio natriegens )of fhs The gene is introduced into E. coli via a plasmid or integrated into the E. coli genome through genetic engineering.

[0006] In the present invention, the methylotrophic bacteria, the autotrophic ethanologenic Clostridium or the natrium-requiring Vibrio fhs The amino acid sequences of the proteins encoded by the gene sequences are shown in SEQ ID NOs: 4-6, and the accession numbers in NCBI are WP_012779260.1, AGY75839.1, and ALR18378.1, respectively.

[0007] In a second aspect, the present invention provides an engineered Escherichia coli with high L-histidine production, wherein the engineered bacterium is obtained by genetic engineering and the methylotrophic bacterium, the autotrophic ethanologenic Clostridium or the natrium-requiring Vibrio is added to the engineered bacterium. fhs The gene is constructed by introducing a plasmid into Escherichia coli or integrating it into the Escherichia coli genome through genetic engineering.

[0008] The Escherichia coli is an Escherichia coli capable of producing histidine, and expresses the gene fragment shown in SEQ ID NO: 7 hisGDCBHAFI ( hisGDCBHAFI Is hisG , hisD , hisC , hisB , hisH , hisA , hisF , hisI A gene cluster consisting of eight genes) or expression hisG , hisD , hisC , hisB , hisH , hisA , hisF , hisI That is, the histidine-producing bacteria have an upregulated his operon. hisG , hisD , hisC , hisB , hisH , hisA , hisF , hisI The Gene IDs are 946549, 946531, 946551, 946552, 946544, 946521, 946516, and 946515 respectively.

[0009] In a specific embodiment of the present invention, the method for constructing the engineered bacteria comprises the following steps:

[0010] (1) Artificially synthesized Ptrc Promoter control of methylotrophic bacteria, autotrophic ethanologenic Clostridium, and natriuretic Vibrio fhs Gene, obtain gene fragment Ptrc-fhs Mex ,Ptrc-fhs Cau ,Ptrc-fhs Vna , the sequences are shown in SEQ ID NO: 1-3 respectively;

[0011] (2) Using the genome of Escherichia coli MG1655 as a template, PCR was performed with primers fhs-UF (5′-atcggttactggtggaaactga-3′) and fhs-UR (5′-gagccggatgattaattgtcaaaattgagagtgctcctgagtatgggt-3′) to obtain the gene fragment fhs-UP (500 bp) and PCR product purification was performed; using the genome of Escherichia coli MG1655 as a template, PCR was performed with primers fhs-DF (5′-tccgtaagacgttggggagactaag-3′) and fhs-DR (5′-gtggatgggacagtcagtaaaggggtgg-3′) to obtain the gene fragment fhs-DOWN (500 bp) and PCR product purification was performed;

[0012] (3) Gene fragment Ptrc-fhs Mex ,Ptrc-fhs Cau ,Ptrc-fhs Vna Overlap extension PCR was performed with fhs-UP and fhs-DOWN to obtain the target fragments fhsUP-Ptrc-fhs Mex -fhsDOWN,fhsUP-Ptrc-fhs Cau -fhsDOWN,fhsUP-Ptrc-fhs Vna -fhsDOWN (2768 bp, 2771 bp, and 2843 bp, respectively) and PCR product purification was performed;

[0013] (4) Using plasmid pTarget as template (Jiang, Y., Chen, B., Duan, CL, Sun, BB, Yang, JJ, and Yang, S. (2015). Multigene editing in the Escherichia coligenome via the CRISPR-Cas9 system. Applied and Environmental Microbiology, 81: 2506–2514, purchased from Addgene), PCR amplification was performed with primers fhs-N20-F (5′-gggtcacccgccatataacggttttagagctagaaatagcaagttaaaat-3′) and fhs-N20-R (5′-cgttatatggcgggtgacccactagtattatacctaggactgagctag-3′) to obtain pTarget-fhs linear vector, which was then transformed into Escherichia coli DH5α and extracted to obtain plasmid pTarget-fhs;

[0014] (5) Separately target the fragments fhsUP-Ptrc-fhs Mex -fhsDOWN,fhsUP-Ptrc-fhs Cau -fhsDOWN,fhsUP-Ptrc-fhs Vna -fhsDOWN and plasmid pTarget-fhs and plasmid pCas9 (Jiang, Y., Chen, B., Duan, CL, Sun, BB, Yang, JJ, and Yang, S. (2015). Multigene editing inthe Escherichia coli genome via the CRISPR-Cas9 system. Applied andEnvironmental Microbiology, 81: 2506–2514, purchased from Addgene) were co-transformed into Escherichia coli MG1655, and the recombinant bacteria were named E.coil-Ptrc-fhs Mex 、E.coil-Ptrc-fhs Cau 、E.coil-Ptrc-fhs Vna ;

[0015] (6) In Escherichia coli, the operon hisGDCBHAFI gene encodes a series of key enzymes in the histidine biosynthesis pathway. The production of histidine can be increased by enhancing the expression of the hisGDCBHAFI gene. Using the genome of Escherichia coli MG1655 as a template and hisG-F and hisI-R as primers, PCR was performed to obtain the gene fragment hisGDCBHAFI (SEQ ID NO: 7), which was ligated to the vector pTrc99a (Budiardjo, SJ, Stevens, JJ, Calkins, AL, Ikujuni, AP, Wimalasena, VK, Firlar, E., Case, DA, Biteen, JS, Kaelber, JT, & Slusky, JSG (2022). Colicin E1 opens its hinge to plugTolC. eLife, 11, e73297, purchased from Addgene), and the obtained recombinant plasmid was named pTrc99a-hisGDCBHAFI;

[0016] (7) Transform the strain E.coil-Ptrc-fhs with the recombinant plasmid pTrc99a-hisGDCBHAFI Mex 、E.coil-Ptrc-fhs Cau 、E.coil-Ptrc-fhs Vna The obtained recombinant bacteria were named E.coil-ptsG::Ptrc-fhs Mex / pTrc99a-hisGDCBHAFI, E.coil-ptsG::Ptrc-fhs Cau / pTrc99a-hisGDCBHAFI, E.coil-ptsG::Ptrc-fhs Vna / pTrc99a-hisGDCBHAFI, an engineered Escherichia coli bacterium with high L-histidine production.

[0017] In another specific embodiment of the present invention, the method for constructing the engineered bacteria comprises the following steps:

[0018] (1) Artificial synthesis of methylotrophic bacteria, autotrophic ethanologenic Clostridium, and Vibrio natriuresis fhs Gene, the sequences are shown in SEQ ID NO: 1-3 respectively; the fragment was connected to the vector pBbA1K (Lee, TS, Krupa, RA, Zhang, F., Hajimorad, M., Holtz, WJ, Prasad, N., Lee, SK, & Keasling, JD (2011). BglBrick vectors and datasheets: A synthetic biology platform forgene expression. Journal of Biological Engineering, 5, 12, purchased from Addgene), and the obtained recombinant plasmids were named pBbA1K-fhs Mex 、pBbA1K-fhs Cau 、pBbA1K-fhs Vna ;

[0019] (2) Using the genome of Escherichia coli MG1655 as a template and primers hisG-F (5′-atgttgaaaatcgctgtcccaaacaaaggctcg-3′) and hisI-R (5′-tcactgatgccgtttacgcaggttctcaattaccgtcgtt-3′) as primers, PCR was performed to obtain the gene fragment hisGDCBHAFI, which was then ligated to the vector pTrc99a. The resulting recombinant plasmid was named pTrc99a-hisGDCBHAFI.

[0020] (3) Respectively transfer the recombinant plasmid pBbA1K-fhs Mex 、pBbA1K-fhs Cau 、pBbA1K-fhs Vna co-transformed with pTrc99a-hisGDCBHAFI into Escherichia coli MG1655, and the obtained recombinant bacteria were named MG1655 / pTrc99a-hisGDCBHAFIH pBbA1K-fhs Mex , MG1655 / pTrc99a-hisGDCBHAFIH pBbA1K-fhs Cau , MG1655 / pTrc99a-hisGDCBHAFIH pBbA1K-fhs Vna , that is, an engineered Escherichia coli that produces high L-histidine.

[0021] Preferably, the method for transforming E. coli is electroporation.

[0022] More preferably, the electric shock conditions are voltage 2.5 KV, resistance 200Ω, and capacitance 25 μF (the width of the electric shock cup is 2 mm).

[0023] In a third aspect, the present invention provides the use of the engineered bacteria in fermentation production of L-histidine or in increasing the fermentation yield of L-histidine.

[0024] By means of the above technical solution, the present invention has at least the following advantages and beneficial effects:

[0025] The present invention provides a method for increasing the C1 supply in Escherichia coli by additionally introducing Methylotrophic Bacillus ( Methylobacterium extorquens ), Vibrio natriuresis ( Vibrio natriegens )、Autotrophic ethanologenic Clostridium ( Clostridium autoethanogenum ) fhs The expression of the gene increases the fTHF content in the cells, and ultimately increases the production of L-histidine by 50-167%. DETAILED DESCRIPTION

[0026] The present invention provides a method for increasing the C1 supply in Escherichia coli by introducing exogenous methylotrophic bacteria ( Methylobacterium extorquens )、Autotrophic ethanologenic Clostridium ( Clostridium autoethanogenum ), Vibrio natriuresis ( Vibrio natriegens ) Source fhs The expression of the gene increases the intracellular cofactor fTHF content (increases fTHF supply), thereby significantly improving the production and yield of L-histidine. This includes: (1) exogenously introducing methylotrophic bacteria, autotrophic ethanologenic Clostridium, and natriuretic Vibrio into Escherichia coli. fhs The gene sequences are shown in SEQ ID NOs: 1-3 respectively, to obtain recombinant Escherichia coli; (2) using the recombinant Escherichia coli to ferment and produce L-histidine.

[0027] The present invention adopts the following technical solution:

[0028] 1. In the Escherichia coli genome, the methylotrophic bacteria, the autotrophic ethanologenic Clostridium, and the natriuretic Vibrio fhs Genes (sequences are shown in SEQ ID NOs: 1-3, respectively) are overexpressed.

[0029] 2. In Escherichia coli, the methylotrophic bacteria, autotrophic ethanologenic Clostridium, and natriuretic Vibrio were introduced into the cells through plasmids. fhs Genes (sequences are shown in SEQ ID NOs: 1-3, respectively) are overexpressed.

[0030] 3. The above strains were fermented and cultured to detect bacterial growth and L-histidine production.

[0031] The following examples are used to illustrate the present invention, but are not intended to limit the scope of the present invention. Unless otherwise specified, the technical means used in the examples are conventional means well known to those skilled in the art, and the raw materials used are all commercially available products.

[0032] Example 1: Methylotrophic Bacillus, autotrophic ethanologenic Clostridium, and Vibrio natrii fhs Gene overexpression in the E. coli genome

[0033] Synthetic Ptrc Promoter control of methylotrophic bacteria, autotrophic ethanologenic Clostridium, and natriuretic Vibrio fhs Gene, the sequence is shown in SEQ ID NO: 1-3. Using the genome of Escherichia coli MG1655 as a template, PCR was performed with primers fhs-UF (atcggttactggtggaaactga) and fhs-UR (gagccggatgattaattgtcaaaattgagagtgctcctgagtatgggt) to obtain the gene fragment fhs-UP (500bp) and PCR product purification was performed. Using the genome of Escherichia coli MG1655 as a template, PCR was performed with primers fhs-DF (tccgtaagacgttggggagactaag) and fhs-DR (gtggatgggacagtcagtaaaggggtgg) to obtain the gene fragment fhs-DOWN (500bp) and PCR product purification was performed. The fragment Ptrc-fhs Mex ,Ptrc-fhs Cau ,Ptrc-fhs Vna Overlap extension PCR was performed with fhs-UP and fhs-DOWN to obtain the target fragment fhsUP-Ptrc-fhs Mex -fhsDOWN,fhsUP-Ptrc-fhs Cau -fhsDOWN,fhsUP-Ptrc-fhs Vna -fhsDOWN (2768bp, 2771bp, 2843bp, respectively) and PCR products were purified. Plasmid pTarget was used as a template and primers fhs-N20-F (gggtcacccgccatataacggttttagagctagaaatagcaagttaaaat) and fhs-N20-R (cgttatatggcgggtgacccactagtattatacctaggactgagctag) were used for amplification to obtain pTarget-fhs. The targeting fragments fhsUP-Ptrc-fhs were respectively electroporated using an electroporator (Bio-Rad). Mex-fhsDOWN,fhsUP-Ptrc-fhs Cau -fhsDOWN,fhsUP-Ptrc-fhs Vna -fhsDOWN, plasmid pTarget-fhs and plasmid pCas9 were transformed into Escherichia coli MG1655 by electroporation. The electroporation conditions were 2.5KV, 200Ω, and 25μF (the width of the electroporation cup was 2mm). The recombinant bacteria were screened and named E.coil-Ptrc-fhs. Mex 、E.coil-Ptrc-fhs Cau 、E.coil-Ptrc-fhs Vna The key feature of this recombinant bacterium is ptsG Position introduction fhs The gene expression sequences are shown in SeqID1-3.

[0034] As a control, this example also constructed a direct knockout ptsG The control strain of the gene (Gene ID: 945651). The genome of Escherichia coli MG1655 was used as a template, and primers ptsG-UP-F (atcggttactggtggaaactga) and ptsG-UP-R (caacgtcttacggaaattgagagtgctcctgagtatg) were used as primers for PCR to obtain a gene fragment of about 500 bp of ptsG-UP and PCR products were purified. The genome of Escherichia coli MG1655 was used as a template, and primers ptsG-DOWN-F (cactctcaatttccgtaagacgttggggaga) and ptsG-DOWN-R (gtggatgggacagtcagtaaaggggtgg) were used as primers for PCR to obtain a gene fragment of about 500 bp of ptsG-DOWN and PCR products were purified. The fragments ptsG-UP and ptsG-DOWN were overlapped by PCR to obtain the target fragment. The targeting fragment, plasmid pTarget-fhs and plasmid pCas9 were electroporated into Escherichia coli MG1655 using an electroporator (Bio-Rad). The electroporation conditions were 2.5 KV, 200 Ω, and 25 μF (the width of the electroporation cup was 2 mm). The recombinant bacteria were screened and named E.coil -△ptsG.

[0035] Using the genome of E. coli MG1655 as a template, PCR was performed with primers hisG-F (atgttgaaaatcgctgtcccaaacaaaggctcg) and hisI-R (tcactgatgccgtttacgcaggttctcaattaccgtcgtt) to obtain the gene fragment hisGDCBHAFI, which was ligated to the vector pTrc99a. The obtained recombinant plasmid was named pTrc99a-hisGDCBHAFI. The recombinant plasmid pTrc99a-hisGDCBHAFI was transformed into the strain E. coli MG1655 by electroporation (conditions as above). Mex 、E.coil-Ptrc-fhs Cau 、E.coil-Ptrc-fhs Vna , E.coil -△ptsG, the obtained recombinant strain was named E.coil-ptsG::Ptrc-fhs Mex / pTrc99a-hisGDCBHAFI, E.coil-ptsG::Ptrc-fhs Cau / pTrc99a-hisGDCBHAFI, E.coil-ptsG::Ptrc-fhs Vna / pTrc99a-hisGDCBHAFI and E.coil -ΔptsG / pTrc99a-hisGDCBHAFI.

[0036] Example 2: Plasmid fhs Mex , fhs Cau and fhs Vna Gene overexpression

[0037] Artificial synthesis from M. extorquens , C. autoethanogenum and V. natriegens The fhs gene, whose sequences are shown in SEQ ID NO: 1-3, was connected to the vector pBbA1K, and the obtained recombinant plasmid was named pBbA1K-fhs Mex 、pBbA1K-fhs Cau 、pBbA1K-fhs VnaUsing the genome of Escherichia coli MG1655 as a template, PCR was performed with primers hisG-F (atgttgaaaatcgctgtcccaaacaaaggctcg) and hisI-R (tcactgatgccgtttacgcaggttctcaattaccgtcgtt) to obtain the gene fragment hisGDCBHAFI, which was then connected to the vector pTrc99a. The resulting recombinant plasmid was named pTrc99a-hisGDCBHAFI. The recombinant plasmid pBbA1K-fhs Mex 、pBbA1K-fhs Cau 、pBbA1K-fhs Vna pTrc99a-hisGDCBHAFI was electrotransformed into MG1655 (conditions as in Example 1) and the obtained recombinant strain was named MG1655 / pTrc99a-hisGDCBHAFIH pBbA1K-fhs Mex , MG1655 / pTrc99a-hisGDCBHAFIH pBbA1K-fhs Cau and MG1655 / pTrc99a-hisGDCBHAFIHpBbA1K-fhs Vna .

[0038] Example 3 Production of L-histidine by fermentation of recombinant Escherichia coli

[0039] The recombinant strains E.coil-ptsG::Ptrc-fhsMex / pTrc99a-hisGDCBHAFI, E.coil-ptsG::Ptrc-fhsCau / pTrc99a- hisGDCBHAFI, E.coil-ptsG::Ptrc-fhsVna / pTrc99a-hisGDCBHAFI, MG1655 / pTrc99a-hisGDCBHAFIH pBbA1K-fhs Mex , MG1655 / pTrc99a-hisGDCBHAFIH pBbA1K-fhs Cau and MG1655 / pTrc99a-hisGDCBHAFIH pBbA1K-fhs Vna Culture overnight on LB plates. Pick a single colony from the fresh plate and inoculate it into a test tube containing 5 ml LB medium and culture at 37°C, 200 rpm for 12 hours.

[0040] Inoculate 5% of the inoculum into a 500 ml baffled shake flask containing 50 ml of fermentation medium and culture at 37°C and 200 rpm until OD 600was 0.6, 0.1 mM IPTG was added and cultured for 48 h.

[0041] The fermentation medium formula includes: glucose 20g / L, magnesium sulfate heptahydrate 0.8g / L, diammonium hydrogen phosphate 4g / L, potassium dihydrogen phosphate 6.67g / L, potassium citrate 1.35g / L, 3-morpholinepropanesulfonic acid 20.9g / L, yeast powder 2.5g / L, ferrous sulfate heptahydrate 50mg / L, calcium chloride dihydrate 10mg / L, zinc sulfate heptahydrate 11mg / L, manganese sulfate tetrahydrate 2.5mg / L, copper sulfate pentahydrate 5mg / L, ammonium molybdate 0.5mg / L, sodium borate decahydrate 0.1mg / L ( fhs For gene expression strains, sodium formate at a final concentration of 3 g / L must be added to the culture medium.

[0042] During the fermentation process, the product concentration and the growth of the strain were detected by liquid chromatography, and the results are shown in Tables 1 and 2. As can be seen from Tables 1 and 2, after the introduction of Ptrc-fhs Mex ,Ptrc-fhs Cau ,Ptrc-fhs Vna Afterwards, strains, E.coil-ptsG::Ptrc-fhs Mex / pTrc99a-hisGDCBHAFI, E.coil-ptsG::Ptrc-fhs Cau / pTrc99a-hisGDCBHAFI, E.coil-ptsG::Ptrc-fhs Vna / pTrc99a-hisGDCBHAFI, MG1655 / pTrc99a-hisGDCBHAFIH pBbA1K-fhs Mex , MG1655 / pTrc99a-hisGDCBHAFIH pBbA1K-fhs Cau and MG1655 / pTrc99a-hisGDCBHAFIH pBbA1K-fhs Vna Compared with the control strains MG1655 / pTrc99a-hisGDCBHAFI and E. coli-ΔptsG / pTrc99a-hisGDCBHAFI, the yield and production efficiency of L-histidine were greatly improved without affecting the growth of bacteria. The yield of L-histidine increased by 50-167%, indicating that the introduction of fhs The gene has a significant promoting effect on histidine synthesis.

[0043] Table 1 Growth of different strains (OD 600 )

[0044]

[0045] Table 2 L-histidine production of different strains (g / L)

[0046]

[0047] Although the present invention has been described in detail above with general descriptions and specific embodiments, it is obvious to those skilled in the art that some modifications or improvements can be made based on the present invention. Therefore, these modifications or improvements made without departing from the spirit of the present invention all fall within the scope of protection claimed by the present invention.

Claims

1. A method for increasing the fermentation yield of L-histidine by strengthening the C1 metabolic pathway of Escherichia coli, characterized in that: The method for strengthening the metabolic pathway of Escherichia coli C1 is to introduce the Methylobacterium extorquens )、Autotrophic ethanologenic Clostridium ( Clostridium autoethanogenum ) or Vibrio natriuresis ( Vibrio natriegens )of fhs The gene is introduced into E. coli via a plasmid or integrated into the E. coli genome by genetic engineering; The Escherichia coli is an Escherichia coli capable of producing histidine, which overexpresses the gene fragment shown in SEQ ID NO:

7. hisGDCBHAFI ; Among them, those from Methylotrophic Bacillus, Autotrophic Ethanogenic Clostridium or Sodium Vibrio fhs The amino acid sequences of the proteins encoded by the gene sequences are shown in SEQ ID NOs: 4-6, respectively.

2. An engineered Escherichia coli strain that produces high L-histidine, characterized in that: The engineered bacteria are obtained by genetic engineering from methylotrophic bacteria, autotrophic ethanologenic Clostridium or natriuretic vibrio. fhs The gene is constructed by introducing it into E. coli through a plasmid or integrating it into the E. coli genome through genetic engineering; The Escherichia coli is an Escherichia coli capable of producing histidine, which overexpresses the gene fragment shown in SEQ ID NO:

7. hisGDCBHAFI ; from Methylotrophic Bacillus, Ethanologenic Clostridium, or Sodium Vibrio fhs The amino acid sequences of the proteins encoded by the gene sequences are shown in SEQ ID NOs: 4-6, respectively.

3. Use of the engineered bacteria according to claim 2 in the fermentation production of L-histidine.

Images