Protein ta vrs3 and its encoding gene and application

Abstract

The application discloses a protein TaVrs3 and an encoding gene and application thereof. The protein TaVrs3 or a biological material related to the protein TaVrs3 provided by the application has the application in any one of the following: E1) regulating a plant ear type; E2) regulating a plant spikelet number; E3) regulating a plant grain number per ear; E4) regulating a plant grain weight; E5) regulating a plant floret number; and E6) regulating a plant yield. Experiments of the application prove that, in a wild type wheat Fielder, simultaneously editing protein genes TaVrs-B3 and TaVrs-D3 can significantly increase the spikelet number per ear, the floret number and the grain number per ear. Therefore, the protein TaVrs3 has important application value in regulating a wheat ear type character and has a wide prospect in cultivating a wheat variety.

Description

Technical Field

[0001] This invention belongs to the field of biotechnology, specifically relating to the protein TaVrs3 and its encoding gene and applications. Background Technology

[0002] Wheat is one of the world's major food crops. Currently, with limited arable land, breeding varieties with longer ears and slightly more spikelets (e.g., 1-3 more spikelets per ear) to promote coordinated improvement of traits such as grain number and grain weight is one of the effective ways to conduct high-yield wheat breeding. Therefore, the wheat ear, the inflorescence organ, has always been an important trait of concern to wheat breeders.

[0003] Wheat has a compound spike inflorescence with several nodes on the rachis. Typically, each node bears a spikelet at its base, and each spikelet produces 3-10 florets. If each node bears one or more spikelets (a multi-spikelet trait), it is hoped that the number of florets per spike can be increased, thereby increasing the yield per plant. For example, some researchers have reported using gene-editing technology to edit [certain florets] in wheat. DUO1 Genes, discovering this gene-editing mutant duo1 The lower and middle parts of the spikelet exhibit a multi-spikelet phenotype, with 2-3 spikelets at the base of each rachis. Field yield plot experiments showed... duo1 Compared to the wild type, it significantly increases the number of grains per spike, thereby increasing wheat yield per unit area. Therefore, creating new advantageous gene variants with a "multiple spikelets" phenotype in wheat through gene editing may increase wheat yield. Summary of the Invention

[0004] The technical problem to be solved by this invention is how to use gene editing to achieve [the following]: TaVrs3 Gene knockout regulates wheat spike type traits.

[0005] To solve the above-mentioned technical problems, the first aspect of the present invention provides the use of any one of the following substances A1)-A3) in any one of the following E1-E6:

[0006] E1) Regulates plant spike type;

[0007] E2) Regulates the number of spikelets in plants;

[0008] E3) Regulates the number of grains per spike in plants;

[0009] E4) Regulates plant grain weight;

[0010] E5) Regulates the number of florets in plants;

[0011] E6) Regulates plant yield;

[0012] A1) Protein TaVRS3;

[0013] A2) Nucleic acid molecules encoding the protein TaVRS3;

[0014] A3) Recombinant vectors, expression cassettes, or recombinant bacteria containing nucleic acid molecules encoding the protein TaVRS3;

[0015] The protein TaVRS3 is either B1, B2, or B3 as follows:

[0016] B1) A protein consisting of an amino acid sequence including the sequence shown in sequence 2, 4, or 6 of the sequence listing;

[0017] B2) Proteins derived from B1) with the same function, obtained by substituting and / or deleting and / or adding one or more amino acid residues of the amino acid sequence shown in sequence 2, 4 or 6 of the sequence listing.

[0018] B3) is a fusion protein obtained by attaching a protein tag to the N-terminus and / or C-terminus of B1) or B2).

[0019] The protein tags mentioned above can be the tags shown in Table 1.

[0020] Table 1 shows the sequence of labels.

[0021]

[0022] The substitution and / or deletion and / or addition of one or more amino acid residues described above refers to the substitution and / or deletion and / or addition of no more than 10 amino acid residues.

[0023] In the above-described application, the nucleic acid molecule encoding the protein TAVRS3 is any one of the following C1)-C3);

[0024] C1) The coding region includes the nucleic acid molecule shown in sequence 1, sequence 3, or sequence 5 in the sequence listing;

[0025] C2) Nucleic acid molecules that hybridize with the DNA sequence defined by C1) under strict conditions and encode proteins with the same function;

[0026] The DNA sequences defined by C3 and C1) have at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% homology (identity) and encode nucleic acid molecules that have the same function.

[0027] The nucleic acid molecules mentioned above are DNA, cDNA, or CDS.

[0028] The term "identity" refers to sequence similarity to a natural nucleic acid sequence. Identity can be evaluated visually or using computer software. Using computer software, the identity between two or more sequences can be expressed as a percentage (%), which can be used to evaluate the identity between related sequences.

[0029] In a second aspect, the present invention provides substances that inhibit or reduce the activity or content of the protein TaVRS3 described in the first aspect, or substances that inhibit the expression of nucleic acid molecules encoding the protein TaVRS3 described in the first aspect, in any of the following applications:

[0030] F1) causes plant spikelets to form compound spikelets;

[0031] F2) Increases the number of spikelets in plants;

[0032] F3) Increases the number of grains per spike;

[0033] F4) Increases the number of small flowers in plants;

[0034] F5) Increase plant yield.

[0035] In the above text, the inhibition or reduction of gene expression can be achieved by gene knockout or gene silencing.

[0036] Gene knockout refers to the phenomenon of inactivating a specific target gene through homologous recombination. Gene knockout inactivates a specific target gene by altering its DNA sequence.

[0037] Gene silencing refers to the phenomenon of preventing or reducing gene expression without damaging the original DNA. Gene silencing presupposes no change in the DNA sequence, resulting in the absence or reduction of gene expression. Gene silencing can occur at two levels: transcriptional silencing due to DNA methylation, heterochromatinization, and position effects; and post-transcriptional gene silencing, which inactivates the gene at the post-transcriptional level through specific inhibition of target RNA. This includes antisense RNA, co-suppression, quelling, RNA interference (RNAi), and microRNA (miRNA)-mediated translational repression.

[0038] In the applications described above, the substance can regulate the expression of the protein-coding gene or regulate the content of the protein in at least one of the following six aspects: 1) regulation at the transcriptional level of the coding gene; 2) post-transcriptional regulation of the coding gene (i.e., regulation of splicing or processing of the primary transcript of the coding gene); 3) regulation of RNA transport of the coding gene (i.e., regulation of mRNA transport of the coding gene from the nucleus to the cytoplasm); 4) regulation of translation of the coding gene; 5) regulation of mRNA degradation of the coding gene; and 6) post-translational regulation of the gene (i.e., regulation of the activity of the protein translated from the coding gene).

[0039] The substance may be a gene knockout agent, such as a gene knockout agent via homologous recombination or a gene knockout agent via CRISPR / Cas9. The agent that inhibits or reduces gene expression may contain a polynucleotide targeting the gene, such as siRNA, shRNA, sgRNA, miRNA, or antisense RNA.

[0040] Furthermore, the substance is a CRISPR / Cas9 system that inhibits the expression of nucleic acid molecules encoding the protein TaVRS3;

[0041] The CRISPR / Cas9 system includes an sgRNA that targets TaVRS3.

[0042] The target site of the sgRNA is positions 1301-1319 of sequence 1 in the sequence listing.

[0043] The CRISPR / Cas9 system includes a CRISPR / Cas9 expression vector, which in this embodiment is specifically pLGY-E003-Tavrs3. - sgRNA is a plasmid obtained by inserting a fragment (sequence 7) between the BsaI restriction site of the pLGY-E003 plasmid (containing the Cas9 encoding gene). This plasmid expresses Tavrs3. - sgRNA.

[0044] Thirdly, the present invention provides a method for regulating plant agronomic traits, as shown in D1) or D2).

[0045] The method described in D1) includes the following steps: reducing or inhibiting the content and / or activity of protein TaVRS3 in the target plant to regulate plant agronomic traits;

[0046] The method described in D2) includes the following steps: reducing or inhibiting the expression of nucleic acid molecules encoding the protein TaVRS3 in the target plant to regulate plant agronomic traits;

[0047] The plant agronomic traits are spike type, number of spikelets, number of grains per spike, grain weight, number of florets and / or yield;

[0048] The target plant contains nucleic acid encoding the protein TaVRS3;

[0049] The protein TaVRS3 is either B1, B2, or B3 as follows:

[0050] B1) A protein consisting of an amino acid sequence including the sequence shown in sequence 2, 4, or 6 of the sequence listing;

[0051] B2) Proteins derived from B1) with the same function, obtained by substituting and / or deleting and / or adding one or more amino acid residues of the amino acid sequence shown in sequence 2, 4 or 6 of the sequence listing.

[0052] B3) is a fusion protein obtained by attaching a protein tag to the N-terminus and / or C-terminus of B1) or B2).

[0053] Fourthly, the present invention provides a method for cultivating transgenic plants with compound spikelets, as follows: D1) or D2).

[0054] D1) The method includes the following steps: reducing or inhibiting the content and / or activity of protein TaVRS3 in the target plant to obtain a transgenic plant;

[0055] The method described in D2) includes the following steps: reducing or inhibiting the expression of nucleic acid molecules encoding the protein TaVRS3 in the target plant to obtain transgenic plants;

[0056] The transgenic plant is a plant with compound spikelets;

[0057] The protein TaVRS3 is either B1, B2, or B3:

[0058] B1) A protein consisting of an amino acid sequence including the sequence shown in sequence 2, 4, or 6 of the sequence listing;

[0059] B2) Proteins derived from B1) with the same function, formed by substitution and / or deletion and / or addition of one or more amino acid residues of the amino acid sequence shown in sequence 2, 4 or 6 of the sequence listing.

[0060] B3) is a fusion protein obtained by attaching a protein tag to the N-terminus and / or C-terminus of B1) or B2).

[0061] The compound spikelet is a segment of the rachis that can produce two fertile spikelets.

[0062] Fifthly, the present invention provides a method for cultivating transgenic plants with increased spikelet number, as follows: D1) or D2):

[0063] D1) The method includes the following steps: reducing or inhibiting the content and / or activity of protein TaVRS3 in the target plant to obtain a transgenic plant;

[0064] The method described in D2) includes the following steps: reducing or inhibiting the expression of nucleic acid molecules encoding the protein TaVRS3 in the target plant to obtain transgenic plants;

[0065] The transgenic plant has a greater number of spikelets than the target plant;

[0066] The protein TaVRS3 is either B1, B2, or B3 as follows:

[0067] B1) A protein consisting of an amino acid sequence including the sequence shown in sequence 2, 4, or 6 of the sequence listing;

[0068] B2) Proteins derived from B1) with the same function, formed by substitution and / or deletion and / or addition of one or more amino acid residues of the amino acid sequence shown in sequence 2, 4 or 6 of the sequence listing.

[0069] B3) is a fusion protein obtained by attaching a protein tag to the N-terminus and / or C-terminus of B1) or B2).

[0070] Sixthly, the present invention provides a method for cultivating transgenic plants with increased ear grain number, as follows: D1) or D2):

[0071] D1) The method includes the following steps: reducing or inhibiting the content and / or activity of protein TaVRS3 in the target plant to obtain a transgenic plant;

[0072] The method described in D2) includes the following steps: reducing or inhibiting the expression of nucleic acid molecules encoding the protein TaVRS3 in the target plant to obtain transgenic plants;

[0073] The number of grains per spike of the transgenic plant is greater than that of the target plant;

[0074] The protein TaVRS3 is either B1, B2, or B3 as follows:

[0075] B1) A protein consisting of an amino acid sequence including the sequence shown in sequence 2, 4, or 6 of the sequence listing;

[0076] B2) Proteins derived from B1) with the same function, formed by substitution and / or deletion and / or addition of one or more amino acid residues of the amino acid sequence shown in sequence 2, 4 or 6 of the sequence listing.

[0077] B3) is a fusion protein obtained by attaching a protein tag to the N-terminus and / or C-terminus of B1) or B2).

[0078] In a seventh aspect, the present invention provides a method for cultivating transgenic plants with increased grain weight, as follows: D1) or D2).

[0079] D1) The method includes the following steps: reducing or inhibiting the content and / or activity of protein TaVRS3 in the target plant to obtain a transgenic plant;

[0080] The method described in D2) includes the following steps: reducing or inhibiting the expression of nucleic acid molecules encoding the protein TaVRS3 in the target plant to obtain transgenic plants;

[0081] The seeds of the genetically modified plant are heavier than those of the target plant;

[0082] The protein TaVRS3 is either B1, B2, or B3 as follows:

[0083] B1) A protein consisting of an amino acid sequence including the sequence shown in sequence 2, 4, or 6 of the sequence listing;

[0084] B2) Proteins derived from B1) with the same function, formed by substitution and / or deletion and / or addition of one or more amino acid residues of the amino acid sequence shown in sequence 2, 4 or 6 of the sequence listing.

[0085] B3) is a fusion protein obtained by attaching a protein tag to the N-terminus and / or C-terminus of B1) or B2).

[0086] Eighthly, the present invention provides a method for cultivating transgenic plants with increased floret number, as follows: D1) or D2):

[0087] D1) The method includes the following steps: reducing or inhibiting the content and / or activity of protein TaVRS3 in the target plant to obtain a transgenic plant;

[0088] The method described in D2) includes the following steps: reducing or inhibiting the expression of nucleic acid molecules encoding the protein TAVRS3 in the target plant to obtain transgenic plants;

[0089] The transgenic plant has a greater number of florets than the target plant;

[0090] The protein TaVRS3 is either B1, B2, or B3 as follows:

[0091] B1) A protein consisting of an amino acid sequence including the sequence shown in sequence 2, 4, or 6 of the sequence listing;

[0092] B2) Proteins derived from B1) with the same function, formed by substitution and / or deletion and / or addition of one or more amino acid residues of the amino acid sequence shown in sequence 2, 4 or 6 of the sequence listing.

[0093] B3) is a fusion protein obtained by attaching a protein tag to the N-terminus and / or C-terminus of B1) or B2).

[0094] In the above text, the plant is any one of the following G1) to G5): G1) dicotyledonous plant; G2) monocotyledonous plant; G3) grass; G4) wheat; G5) wheat variety Fielder.

[0095] Experiments of this invention demonstrate that protein genes can be simultaneously edited in wild-type wheat Fielder. TaVrs-B3 and TaVrs-D3 It can significantly increase the number of spikelets, florets, and grains per spike. Therefore, the protein TaVrs3 has important application value in regulating wheat spike type traits and has broad prospects in wheat variety breeding. Attached Figure Description

[0096] Figure 1 The T7E1 restriction enzyme digestion method was used to detect TaVrs3 gene knockout mutants.

[0097] Figure 2 for Taurus3 Genotypic analysis of gene knockout mutants.

[0098] Figure 3 for TaVrs3 Analysis of spikelet type and agronomic traits in gene knockout mutants; *** indicates P<0.001, bar=3cm. False color plot shows compound spikelets. Detailed Implementation

[0099] The present invention will now be described in further detail with reference to specific embodiments. The given embodiments are merely illustrative of the invention and not intended to limit its scope. The embodiments provided below can serve as a guide for further improvements by those skilled in the art and do not constitute a limitation on the invention in any way.

[0100] Unless otherwise specified, the experimental methods used in the following examples are conventional methods, performed according to the techniques or conditions described in the literature in this field or according to the product instructions. Unless otherwise specified, the materials and reagents used in the following examples are commercially available.

[0101] Unless otherwise specified, the quantitative experiments in the following examples are all repeated three times, and the results are averaged.

[0102] In the following examples, wheat A genome Taurus3 The gene sequence is sequence 1, and the amino acid sequence of its encoded protein is sequence 2; in the wheat B genome Taurus3 The gene sequence is sequence 3, and the amino acid sequence of its encoded protein is sequence 4; in the wheat D genome Taurus3 The gene sequence is sequence 5, and the amino acid sequence of the protein it encodes is sequence 6.

[0103] Example 1: Construction of CRISPR / Cas9 expression vector

[0104] I. Construction of CRISPR / Cas9 expression vector

[0105] 1. gRNA design

[0106] Based on the wheat A, B, and D genomes Taurus3 The gene editing gRNA sequence was designed using the CRISPRdirect website (http: / / crispr.dbcls.jp / ), with the target sites being positions 1301-1319 of sequence 1, positions 1251-1269 of sequence 3, or positions 1297-1315 of sequence 5.

[0107] 2. Primer design

[0108] Forward primer (5'-3') F:

[0109] 5'-ccgaggtctcgggcgTCCCCGCAGAGGTCAGGAAgtttcagagctatgctggaaac-3'

[0110] Reverse primer (5'-3') R:

[0111] 5'-acctcggtctccaaacTTCCTGACCTCTGCGGGGAcaagtctgatgcagcaagc-3'

[0112] 3. PCR amplification

[0113] Using the intermediate vector pMETaU6.1 (Chen et al., WPA1 encodes a vWA domain protein that regulates wheat plant architecture. 2024:12 992-1000.) as a template, PCR amplification was performed using the primers designed above, and the target band of about 800 bp was recovered, which is the PCR product.

[0114] The amplification system described above is shown in Table 2 below:

[0115] Table 2 shows the amplification system.

[0116]

[0117] The PCR procedure is shown in Table 3:

[0118] Table 3 shows the PCR procedure.

[0119]

[0120] 4. Ligation of PCR products with gene editing vectors

[0121] The gene editing backbone vector pLGY-E003 (Chen et al., WPA1 encodes a vWAdomain protein that regulates wheat plant architecture. 2024:12 992-1000.) was digested with Bsa1, and the vector was recovered from the gel. The PCR product was cloned into the gene editing backbone vector pLGY-E003 (a vector recovered from BsaI digestion). The ligation reaction was performed in a PCR instrument under the following conditions: 37℃ for 5 min, 16℃ for 10 min, for a total of 60 cycles; then 16℃ for 1 h. The reaction system is shown in Table 4 below:

[0122] Table 4 shows the connection system.

[0123]

[0124] 5. Obtaining CRISPR / Cas9 expression vectors

[0125] The ligation product was transformed into *E. coli* (5 μl of product transformed into 50 μl of competent cells), and positive clones were screened on LB+Kan solid medium. Plasmids were extracted, and positive clones were identified by PCR and sequenced. The primers for identification and sequencing were: F: AGCACGTCTACATTAGTCCC, R: AACTTAGACATGCAATGCTCA. The amplified fragment of the positive clone was 1310 bp. The obtained positive clone bacterial culture was used for plasmid extraction.

[0126] The extracted plasmid was a recombinant knockout plasmid, named pLGY-E003-Tavrs3. - sgRNA.

[0127] pLGY-E003-Tavrs3 - The sgRNA is a plasmid obtained by inserting a fragment (sequence 7) between the BsaI restriction site of the pLGY-E003 plasmid (containing the Cas9 encoding gene). This plasmid expresses Tavrs3. - sgRNA.

[0128] In sequence 7 above, positions 1-15 are Bsa I. Enzyme cleavage site and its protective bases: Positions 16-34 are the target sequence, positions 35-59 are the regulatory sequence, positions 60-124 are the gRNA scaffold, positions 125-409 are the regulatory sequence, positions 410-771 are the wheat U6 promoter, positions 772-790 are the target sequence, and positions 791-806 are... Bsa I. Enzyme cleavage site and its protective base.

[0129] 6. Agrobacterium-mediated transformation and positive clone screening

[0130] The above plasmid pLGYE-3-Tavrs3 - sgRNA was transformed into Agrobacterium strain EHA105. Positive clones were screened on LB+Kan+Rif solid medium and colony PCR was performed (primers F: AGCACGTCTACATTAGTCCC, R: AACTTAGACATGCAATGCTCA, a 1310bp result was considered positive) to identify positive colonies. The recombinant strain was named EHA105 / pLGY-E003-Tavrs3. - sgRNA.

[0131] II. T0 generation Taurus3 The acquisition of gene-edited wheat

[0132] 1. Transformation

[0133] Agrobacterium-mediated genetic transformation was used to transform the recombinant strain EHA105 / pLGYE-3-Tavrs3. - sgRNA was used to infect the scutellum of wheat Fielder (receptor) embryos. The embryos were then transferred to an induction medium and cultured at 22-23°C in the dark to induce embryogenic callus. The embryogenic callus was then transferred to a rooting medium and cultured at 22-23°C for 3-4 weeks under 12h light / 12h dark conditions to obtain T0 generation regenerated seedlings with good rhizome growth. Taurus3 Proposed genetically modified wheat.

[0134] The formulations of the relevant culture media are as follows:

[0135] Callus induction medium (1L): 100mL MS Macro salts (×10), 1mL L7 Micro salts (×1000), 10mL FeNaEDTA (×100), 1mL MS vitamins (×1000), 100mg inositol, 0.5g glutamine, 100mg casein, 1.95g MES, 40g maltose. Mix well and adjust the pH to 5.7. Add 2g of plant gel and sterilize at 121℃ for 15 min. After the medium cools to 55℃, add the filtered and sterilized reagents according to the stock solution ratio, including 0.25mg 2,4-D, 1 mg Picloram, and 80mg Timentin.

[0136] Rooting medium (1L): 100mL L7 Macro salts (×10), 1mL L7 Micro salts (×1000), 10mL FeNaEDTA (×100), 5mL Vitamins / inositol (×200), 100mg inositol, 30g maltose. Mix well and adjust the pH to 5.7. Add 2g of plant gel and sterilize at high temperature. After the medium cools to 55℃, add the filtered and sterilized reagents according to the stock solution ratio, including 0.05mg 2,4-D, 80mg Timentin, and 2.5mg Zeatin. The selection medium is the regeneration medium with 1.25mg glufosinate added.

[0137] MS Macro salts (×10): 16.5 g / L ammonium nitrate, 19.0 g / L potassium nitrate, 1.7 g / L potassium dihydrogen phosphate, 3.7 g / L magnesium sulfate heptahydrate, 4.4 g / L calcium chloride dihydrate. Mix well, incubate at 121°C for 15 min, and store at 4°C.

[0138] L7 Macro salts (×10): 2.5 g / L ammonium nitrate, 15.0 g / L potassium nitrate, 2.0 g / L potassium dihydrogen phosphate, 3.5 g / L magnesium sulfate heptahydrate, 4.5 g / L calcium chloride dihydrate. Mix well, incubate at 121°C for 15 min, and store at 4°C.

[0139] L7 Micro salts (×1,000): 15.0 g / L manganese sulfate, 5.0 g / L boric acid, 7.5 g / L zinc sulfate heptahydrate, 0.75 g / L potassium iodide, 0.25 g / L sodium molybdate dihydrate, 0.025 g / L copper sulfate pentahydrate, 0.025 g / L cobalt chloride hexahydrate. Sterilize by filtration and store at 4°C.

[0140] Vitamins / inositol (×200): 40.0g / l inositol, 2.0g / l vitamin B1 hydrochloride, 0.2g / l vitamin B6, 0.2g / l niacin, 0.2g / l calcium pantothenate, 0.2g / l vitamin C. Filtered for sterilization, store at 4°C.

[0141] 2. T0 generation Taurus3 Detection of genetically modified wheat

[0142] Ten T0 generation plants were randomly selected. Taurus3 The specific steps for PCR testing of the proposed genetically modified wheat are as follows:

[0143] 1) Genomic DNA was extracted from 10 T0 generation strains using the CTAB genomic DNA extraction method. Taurus3 Total DNA in leaves of transgenic wheat seedlings. The DNA content in the leaves of each T0 generation transgenic wheat was approximately 200 ng / μL.

[0144] 2) Use PCR technology to obtain fragment sequences, including gene editing target sites, from each T0 generation of transgenic wheat.

[0145] The PCR primers were: forward primer: 5'-CTACTAGTACTCCCAAGTTAAG-3' and reverse primer: 5'-GTCCACTCATAAAGAAAGTGACTGT-3'.

[0146] The reaction system is 20 μL, consisting of 10 μL of SYBR. ® PremixExTaq TM 0.5 μL of 10 μM forward primer, 0.5 μL of 10 μM reverse primer, and 1 μL of T0 metabolite. TaVrs3 It consists of genomic DNA from genetically modified wheat and 8.0 μL of nuclease-free water.

[0147] Reaction program: 94℃ pre-denaturation for 3 min; 95℃ denaturation for 3 sec; 60℃ annealing for 30 sec; 35 cycles.

[0148] 3) T7E1 enzyme digestion method for detecting mutants.

[0149] The PCR products were digested with T7E1 enzyme, and then the banding was detected by 2% agarose gel electrophoresis. The 1.2kb bands were the unedited plants, and the 600bp bands were the gene-edited mutants.

[0150] The results are as follows Figure 1 As shown, plants numbered 2-10 are gene-edited plants, and plant number 1 is wild-type wheat. It can be seen that plants 2-10 are all gene-edited mutants, denoted as generation T0. TaVrs3 Gene knockout wheat.

[0151] The above T0 generation TaVrs3 Gene knockout wheat was self-crossed for two consecutive generations to obtain the T2 generation. TaVrs3 Gene knockout wheat.

[0152] Select T2 generation TaVrs3 Gene knockout wheat CR_m1 and CR_m2 The PCR products were sent for sequencing, and the results were as follows: Figure 2 As shown, it can be seen that: CR_m1 as follows:

[0153] Compared with wild-type wheat A genome TaVrs3 Gene( Figure 2 Chinese record TaVrs3 Compared to -3A), CR_m1 In the A genome TaVrs3 Gene( Figure 2 Chinese record CR_m1 -A) The sequence remains unchanged;

[0154] Compared with the wild-type wheat B genome TaVrs3 Gene (represented in the diagram) TaVrs3 Compared to -3B), CR_m1 Two homologous chromosomes in the B genome TaVrs3 Gene( Figure 2 Chinese record CR_m1 The region corresponding to -B) has undergone the following changes: two bases AG have been knocked out at positions 1265-1266 of sequence 3;

[0155] Compared with the D genome of wild-type wheat TaVrs3 Gene (represented in the diagram) TaVrs3 Compared to -3D, CR_m1 Two homologous chromosomes in the C genome TaVrs3 Gene( Figure 2 Chinese record CR_m1 The region corresponding to -D) has undergone the following changes: two GT bases have been knocked out at positions 1308-1309 of sequence 5;

[0156] CR_m2 as follows:

[0157] Compared with wild-type wheat A genome TaVrs3 Gene( Figure 2 Chinese record TaVrs3 Compared to -3A), CR_m2 In the A genome TaVrs3 Gene( Figure 2 Chinese record CR_m2 -A) The sequence remains unchanged;

[0158] Compared with the wild-type wheat B genome TaVrs3 Gene( Figure 2 Chinese record TaVrs3 Compared to -3B), CR_m2 Two homologous chromosomes in the B genome TaVrs3 Gene( Figure 2 Chinese record CR_m2 The region corresponding to -B) has undergone the following changes: one G base has been knocked out at position 1266 of sequence 3;

[0159] Compared with the D genome of wild-type wheat TaVrs3 Gene( Figure 2 Chinese record TaVrs3 Compared to -3D, CR_m2 Two homologous chromosomes in the D genome TaVrs3 Gene( Figure 2 Chinese record CR_m2 The region corresponding to -D) underwent the following changes: two bases AG were knocked out at positions 1312-1313 of sequence 5;

[0160] III. T2 Generation TaVrs3 Analysis of spikelet type traits in gene knockout wheat

[0161] The wheat to be tested was of generation T2. TaVrs3 Gene knockout wheat CR_m1 and CR_m2 .

[0162] The wheat samples were planted in a greenhouse. Twenty days after flowering, the number of spikelets per spike, the number of florets per spike, the number of grains per spike, and the grain weight per plant were investigated. The specific cultivation conditions were as follows: temperature 25℃, light intensity 350 μmol photons / m². -2 s -1 Humidity 60-70%. Wild-type wheat was used as a control.

[0163] The results are as follows Figure 3 As shown in the graph on the left, it can be seen that the T2 generation TaVrs3 Gene knockout wheat exhibits a compound spikelet phenotype (i.e., two fertile spikelets can be produced from a single rachis segment).

[0164] The number of spikelets per spike, the number of grains per spike, the number of florets per spike, and the grain weight per plant were counted, and the results are as follows: Figure 3 As shown in the bar chart on the right, it can be seen that, compared with wild-type wheat, the T2 generation... TaVrs3 Gene knockout wheat CR_m1 and CR_m2 The number of spikelets per spike, the number of florets per spike, the number of grains per spike, and the grain weight per plant all increased.

[0165] The above results indicate that the protein TaVrs3 has important application value in regulating wheat spike traits (such as spikelet number, floret number, and grain number per spike).

[0166] The present invention has been described in detail above. For those skilled in the art, the invention can be practiced in a wide range of ways with equivalent parameters, concentrations, and conditions without departing from its spirit and scope, and without requiring unnecessary experiments. Although specific embodiments have been given, it should be understood that further modifications can be made to the invention. In summary, according to the principles of the invention, this application is intended to include any changes, uses, or improvements to the invention, including changes made using conventional techniques known in the art that depart from the scope disclosed herein. Some of the essential features can be applied within the scope of the following appended claims.

Claims

1. A substance that knocks out the protein TaVRS3, or a substance that inhibits the expression of nucleic acid molecules encoding said protein TaVRS3, in any of the following applications: F1) causes wheat spikelets to form compound spikelets; F2) Increase the number of spikelets per wheat ear; F3) Increase the number of grains per wheat spike; F4) Increases the number of florets per wheat spike; F5) Increases the grain weight per wheat plant; The protein TaVRS3 is a protein composed of the amino acid sequences shown in sequences 4 and 6 of the sequence listing.

2. The application according to claim 1, characterized in that: The nucleic acid molecule encoding the protein TAVRS3 is a nucleic acid molecule whose coding region is shown in sequences 3 and 5 of the sequence listing.

3. A method for regulating wheat agronomic traits, as shown in D1) or D2). The method described in D1) includes the following steps: knocking out the target wheat protein TaVRS3 to regulate wheat agronomic traits; The method described in D2) includes the following steps: reducing or inhibiting the expression of nucleic acid molecules encoding the target protein TaVRS3 in wheat to regulate wheat agronomic traits; The regulation of wheat agronomic traits is any one of the following: F1) causes wheat spikelets to form compound spikelets; F2) Increase the number of spikelets per wheat spike; F3) Increase the number of grains per wheat spike; F4) Increases the number of florets per wheat spike; F5) Increases the grain weight per wheat plant; The target wheat contains nucleic acid encoding the protein TaVRS3; The protein TaVRS3 is a protein composed of the amino acid sequences shown in sequences 4 and 6 of the sequence listing.

4. A method for cultivating transgenic wheat with compound spikelets, comprising the following D1) or D2): D1) The method includes the following steps: knocking out the TaVRS3 protein in the target wheat to obtain transgenic wheat; The method described in D2) includes the following steps: reducing or inhibiting the expression of nucleic acid molecules encoding the protein TaVRS3 in the target wheat to obtain transgenic wheat; The genetically modified wheat is a wheat with compound spikelets; The protein TaVRS3 is a protein composed of the amino acid sequences shown in sequences 4 and 6 of the sequence listing.

5. A method for breeding transgenic wheat with increased spikelet number, comprising the following D1) or D2): D1) The method includes the following steps: knocking out the TaVRS3 protein in the target wheat to obtain transgenic wheat; The method described in D2) includes the following steps: reducing or inhibiting the expression of nucleic acid molecules encoding the protein TaVRS3 in the target wheat to obtain transgenic wheat; The number of spikelets per ear of the genetically modified wheat is greater than that of the target wheat; The protein TaVRS3 is a protein composed of the amino acid sequences shown in sequences 4 and 6 of the sequence listing.

6. A method for breeding transgenic wheat with increased grain number per ear, comprising the following D1) or D2): D1) The method includes the following steps: knocking out the TaVRS3 protein in the target wheat to obtain transgenic wheat; The method described in D2) includes the following steps: reducing or inhibiting the expression of nucleic acid molecules encoding the protein TaVRS3 in the target wheat to obtain transgenic wheat; The number of grains per ear of the genetically modified wheat is greater than that of the target wheat; The protein TaVRS3 is a protein composed of the amino acid sequences shown in sequences 4 and 6 of the sequence listing.

7. A method for breeding transgenic wheat with increased grain weight, comprising the following D1) or D2): D1) The method includes the following steps: knocking out the TaVRS3 protein in the target wheat to obtain transgenic wheat; The method described in D2) includes the following steps: reducing or inhibiting the expression of nucleic acid molecules encoding the protein TaVRS3 in the target wheat to obtain transgenic wheat; The grain weight of the genetically modified wheat plant is greater than that of the target wheat; The protein TaVRS3 is a protein composed of the amino acid sequences shown in sequences 4 and 6 of the sequence listing.

8. A method for cultivating transgenic wheat with increased floret number, comprising the following D1) or D2): D1) The method includes the following steps: knocking out the TaVRS3 protein in the target wheat to obtain transgenic wheat; The method described in D2) includes the following steps: reducing or inhibiting the expression of nucleic acid molecules encoding the protein TAVRS3 in the target wheat to obtain transgenic wheat; The number of florets per spike of the genetically modified wheat is greater than that of the target wheat; The protein TaVRS3 is a protein composed of the amino acid sequences shown in sequences 4 and 6 of the sequence listing.

Images