Application of NPE1 protein and biomaterials encoding NPE1 protein in regulating the catalytic efficiency of metabolic enzymes

Abstract

The present invention belongs to the field of biotechnology and relates to new applications of proteins. Disclosed is an application of NPE1 protein and a biological material encoding NPE1 protein in regulating the catalytic efficiency of metabolic enzymes. NAME1 Overexpression in soybeans will significantly enhance the catalytic efficiency of key metabolic enzymes GmPGK3a, GmPFK3a, GmGS1γ1 and GmPGD2a in nodules, thereby enhancing the nitrogen fixation ability of soybean nodules, and then increasing the biomass of the aboveground part of the plant and the final yield. The inventor's research will provide genetic resources for nitrogen efficiency and molecular breeding of legumes including soybeans, and provide a theoretical basis for the molecular design of high-efficiency nitrogen-fixing soybean varieties, thereby promoting the development of environmentally friendly, green and sustainable agriculture.

Description

Technical Field

[0001] The invention belongs to the field of biotechnology and relates to new applications of proteins. Background Art

[0002] Nitrogen is a macronutrient essential for plant growth and development, and is an important component of molecules such as proteins and nucleic acids in organisms. Although the earth's atmosphere contains 78.1% nitrogen, it cannot be directly used by most plants, so agricultural production is highly dependent on industrial nitrogen fertilizers. However, the production of nitrogen fertilizers requires a large amount of fossil fuels, and excessive application of nitrogen fertilizers will cause soil compaction and degradation and water pollution, affecting the sustainable development of agriculture. Biological nitrogen fixation is the largest natural source of biologically available nitrogen in nature. Leguminosae and rhizobia can interact to form a unique organ, the symbiotic nodule. In the global ecosystem, the nitrogen content fixed by leguminous plants and rhizobia through symbiotic nitrogen fixation accounts for 60%-70% of the total biological nitrogen fixation. Symbiotic nitrogen fixation between leguminous plants and rhizobia not only reduces energy consumption, but also helps to improve soil. It is an important way to improve the nitrogen efficiency of leguminous crops. In agricultural systems, soybean nitrogen fixation accounts for more than 86% of the total symbiotic nitrogen fixation of legumes, and the annual nitrogen production reaches 16.44 million tons. Therefore, improving the efficiency of symbiotic nitrogen fixation between soybeans and rhizobia is of great significance to the development of green and sustainable agriculture.

[0003] Symbiotic nitrogen fixation in nodules is a highly energy-intensive biological process, and the carbohydrates produced by photosynthesis in legumes are the main energy source for symbiotic nitrogen fixation. The photosynthetic product is transported to mature nodules through the phloem in the form of sucrose. After reaching the nodules, the sucrose is broken down into hexose by sucrose synthase and alkali invertase and then enters the glycolysis pathway to produce phosphoenolpyruvate (PEP). PEP can generate malate through a two-step reaction catalyzed by phosphoenolpyruvate carboxylase (PEPC) and malate dehydrogenase (MDH). Malate is transported into the bacteroid to carry out the tricarboxylic acid cycle to produce ATP to provide energy for the nitrogen fixation reaction. The ammonium ions generated by nitrogen fixation will then be assimilated into asparagine and glutamine in amide-exporting legumes and transported to the aboveground parts. In ureide-exporting legumes represented by soybeans, the glutamine generated by ammonium will enter the denovo purine biosynthesis pathway to generate inosine monophosphate (IMP), and finally converted into ureide and then transported to the aboveground parts. In addition, PEP can also be converted into ureide and transported to the aboveground parts in the presence of pyruvate kinase. The final product of glycolysis, pyruvate, is generated under the catalysis of mitochondrial kinase (PK), and then pyruvate enters the tricarboxylic acid cycle of the mitochondria to produce ATP to provide energy for the assimilation of nitrogen in the nodules.

[0004] Although the carbon and nitrogen metabolic pathways of soybean nodules have been studied relatively clearly, the genes that regulate the activity of key catalytic enzymes in these metabolic pathways and their regulatory mechanisms have not yet been elucidated. How to regulate the catalytic efficiency of key metabolic enzymes in soybean nodules and how to use this regulatory mechanism to improve the symbiotic nitrogen fixation ability of soybeans and thereby improve the utilization rate of nitrogen in soybeans are the primary technical problems that our research group needs to solve. In addition, since these metabolic pathways and key metabolic enzymes are highly conserved in different species, whether this regulatory mechanism can be applied to humans and other species to solve metabolic-related diseases is also a technical problem we want to explore. Summary of the invention

[0005] In order to solve the above technical problems, the present invention proposes an application of NPE1 protein and a biomaterial encoding NPE1 protein in regulating the catalytic efficiency of metabolic enzymes.

[0006] The technical solution of the present invention is achieved in this way:

[0007] A protein that controls the catalytic efficiency of metabolic enzymes. The protein is a small peptide consisting of 26 amino acids.

[0008] The above proteins can interact with phosphoglycerate kinase GmPGK3a, phosphofructokinase GmPFK3a, glutamine synthetase GmGS1γ1 and 6-phosphogluconate dehydrogenase GmPGD2a in soybean and improve their catalytic efficiency, thereby enhancing the nitrogen fixation ability of soybean nodules.

[0009] Furthermore, the protein can also enhance the catalytic ability of human phosphoglycerate kinase HsPGK1.

[0010] Furthermore, the protein can also regulate the catalytic ability of human phosphofructokinase HsPFKP.

[0011] The protein for controlling the catalytic efficiency of metabolic enzymes is NPE1 protein, and its amino acid sequence is shown in SEQ ID No.3.

[0012] Encoding NPE1 protein NPE1 The nucleotide sequence of the gene is shown in SEQ ID No. 1, NPE1 The nucleotide sequence of the coding region of the gene after removing introns is shown in SEQ ID No.2.

[0013] Contains the above NPE1 Gene overexpression vector.

[0014] The application of the above protein or gene in improving the efficiency of plant symbiotic nitrogen fixation, enhancing the environmental adaptability of plants and increasing plant yield.

[0015] Application of the above proteins or genes in medicine and pharmaceuticals.

[0016] The above-mentioned overexpression vector is used to improve the efficiency of plant symbiotic nitrogen fixation, enhance the environmental adaptability of plants and increase plant yield.

[0017] Application of the above-mentioned overexpression vector in medicine and pharmaceuticals.

[0018] Further, the steps are: transferring the above-mentioned overexpression vector into the plant to be improved through a genetic transformation method, and then selecting transgenic positive plants for cultivation to complete the application of enhancing the symbiotic nitrogen fixation ability of soybeans.

[0019] Preferably, the plant is a leguminous plant.

[0020] The present invention has the following beneficial effects:

[0021] 1. This application discovered a new gene in soybean NPE1The gene sequence was obtained by reverse genetics and successfully isolated, cloned and verified using soybean hairy root transient transformation system, stable transgenic plants, PCR reaction and gene sequencing. NPE1 The gene encodes a small peptide NPE1 containing 26 amino acids, which can interact with phosphoglycerate kinase GmPGK3a, phosphofructokinase GmPFK3a, glutamine synthetase GmGS1γ1 and 6-phosphogluconate dehydrogenase GmPGD2a in soybean nodules and improve their catalytic efficiency.

[0022] 2. The soybean protein NPE1 of this application can enhance the catalytic capacity of key metabolic enzymes GmPGK3a, GmPFK3a, GmGS1γ1 and GmPGD2a in nodules. NPE1 Gene, which can significantly enhance the nitrogen fixation efficiency of soybean nodules.

[0023] 3. A new gene in soybean NPE1 Overexpression in soybeans will significantly enhance the catalytic efficiency of key metabolic enzymes GmPGK3a, GmPFK3a, GmGS1γ1 and GmPGD2a in nodules, thereby enhancing the nitrogen fixation ability of soybean nodules, and then increasing the biomass of the aboveground part of the plant and the final yield. The inventor's research will provide genetic resources for nitrogen efficiency and molecular breeding of legumes including soybeans, and provide a theoretical basis for the molecular design of high-efficiency nitrogen-fixing soybean varieties, thereby promoting the development of environmentally friendly, green and sustainable agriculture.

[0024] 4. The soybean protein NPE1 of the present application can also enhance the catalytic efficiency of human phosphoglycerate kinase HsPGK1. By applying NPE1 protein in clinical practice, it may be possible to treat metabolic-related diseases.

[0025] 5. The soybean protein NPE1 of the present application can also regulate the catalytic efficiency of human phosphofructokinase HsPFKP. By applying NPE1 protein in clinical practice, it may be possible to treat metabolic-related diseases. BRIEF DESCRIPTION OF THE DRAWINGS

[0026] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments or the description of the prior art will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying creative work.

[0027] Figure 1 The interaction between NPE1 and GmPGK3a / GmPFK3a / GmGS1γ1 / GmPGD2a in tobacco leaf epidermal cells.

[0028] Figure 2 The interaction between NPE1 and GmPGK3a / GmPFK3a / GmGS1γ1 / GmPGD2a in vitro.

[0029] Figure 3 The effects of NPE1 and phosphorylated NPE1 proteins on the catalytic efficiency of GmPGK3a.

[0030] Figure 4 The effects of NPE1 and phosphorylated NPE1 proteins on the catalytic efficiency of GmPFK3a.

[0031] Figure 5 The effects of NPE1 and phosphorylated NPE1 proteins on the catalytic efficiency of GmGS1γ1.

[0032] Figure 6 The effects of NPE1 and phosphorylated NPE1 proteins on the catalytic efficiency of GmPGD2a.

[0033] Figure 7 for NPE1 and phosphorylation site mutations NPE1 Effects of gene overexpression on nitrogen fixation ability of soybean nodules.

[0034] Figure 8 The effects of NPE1 and phosphorylated NPE1 proteins on the catalytic efficiency of HsPGK1.

[0035] Fig. 9 The effects of NPE1 and phosphorylated NPE1 proteins on the catalytic efficiency of HsPFKP. DETAILED DESCRIPTION

[0036] The technical solution of the present invention will be clearly and completely described below in conjunction with the embodiments of the present invention. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0037] Unless otherwise specified, the experimental methods used in the following experimental examples are all conventional methods; the materials and reagents used are reagents and materials that can be obtained from commercial channels unless otherwise specified.

[0038] Example 1

[0039] This application identifies a new soybean gene through the soybean genome and transcriptome database published online NPE1 , the sequence is shown in SEQ ID No.1.

[0040] NPE1 The gene sequence was obtained using the following method:

[0041] The template was 1 μL (about 50 ng) of genomic DNA of soybean line W82, 5 μL of 10×KOD enzyme reaction buffer, 2 μL of 25mMMgCl2, 5 μL of 5 mM dNTP, 5 μL of 5 uM primer (primers NPE1-FP and NPE1-RP, 2.5 μL of each primer), 1 μL of KOD enzyme, and ddH2O (sterile deionized water) was added to 50 μL.

[0042] The primers are:

[0043] NPE1-FP: ATGATGAAATGTGAAAATAT;

[0044] NPE1-RP: TCATGATGAAACTGCAACTG.

[0045] The reaction program was as follows: denaturation at 94°C for 5 min, 94°C for 30 s, 55°C for 1 min, 68°C for 2 min, 35 cycles, and extension at 68°C for 10 min.

[0046] Finally, a gene sequence containing the nucleotide sequence of SEQ ID No. 1 was obtained, and the protein encoded by the gene was shown in SEQ ID No. 3.

[0047] Example 2

[0048] 1. Amplify the gene using primers NPE1-YC-FP and NPE1-YC-RP NPE1 The coding sequence (sequence shown in SEQ ID No. 2) was then inserted into the backbone vector pXY105 , obtain a fusion protein vector expressing NPE1 and the carboxyl terminus of yellow fluorescent protein (YC) NPE1-YC ; Primers GmPGK3a-YN-FP and GmPGK3a-YN-RP were used to amplify GmPGK3a Coding sequence, which is then inserted into the backbone vector pXY103 , obtain a fusion protein vector expressing GmPGK3a and the amino terminus of yellow fluorescent protein (YN) GmPGK3a-YN ; Primers GmPFK3a-YN-FP and GmPFK3a-YN-RP were used to amplify GmPFK3a Coding sequence, which is then inserted into the backbone vector pXY103 , obtain the fusion protein vector expressing GmPFK3a and YN GmPFK3a-YN ; Primers GmGS1γ1-YN-FP and GmGS1γ1-YN-RP were used to amplify GmGS1γ1 Coding sequence, which is then inserted into the backbone vector pXY103 , obtain the fusion protein vector expressing GmGS1γ1 and YN GmGS1γ1-YN ; Primers GmPGD2a-YN-FP and GmPGD2a-YN-RP were used to amplify GmPGD2a Coding sequence, which is then inserted into the backbone vector pXY103 , obtain the fusion protein vector expressing GmPGD2a and YN GmPGD2a-YN .

[0049] in GmPGK3a The gene ID is Glyma.08G165400; GmPFK3a The gene ID is Glyma.07G126400; GmGS1γ1 The gene ID is Glyma.14G213300; GmPGD2a The gene ID is Glyma.18G277300;

[0050] After the YC-expressing pXY105, YN-expressing pXY103 and the above vectors were transferred into Agrobacterium tumefaciens GV3101, the Agrobacterium tumefaciens GV3101 transformed with different vectors were mixed and injected into Nicotiana tabacum leaves together. The YFP fluorescence in the leaf epidermal cells was observed using a laser confocal microscope. It was found that yellow fluorescence could be observed after NPE1-YC was mixed with GmPGK3a-YN, GmPFK3a-YN, GmGS1γ1-YN, and GmPGD2a-YN and injected respectively, indicating that NPE1 can interact with GmPGK3a / GmPFK3a / GmGS1γ1 / GmPGD2a in tobacco leaves ( Figure 1 ).

[0051] The primers are:

[0052] NPE1-YC-FP:

[0053] TACTATTTACAATTACAGGTACCATGATGAAATGTGAAAATATAATCAAAC;

[0054] NPE1-YC-RP:

[0055] ACGCTGCCCATACCGCCGTCGACTGATGAAACTGCAAAGTTCAT;

[0056] GmPGK3a-YN-FP:

[0057] CAATTACAGGTACCCGGGGATCCATGGCGACTAAGAGGAGCGTG;

[0058] GmPGK3a-YN-RP:

[0059] TTGCTCACCATACCGCCGTCGACAGCATCATCAAGGGCAAGGACAC;

[0060] GmPFK3a-YN-FP:

[0061] CAATTACAGGTACCCGGGGATCCATGGATTCTAATTCTTCTCTCCAAG;

[0062] GmPFK3a-YN-RP:

[0063] TTGCTCACCATACCGCCGTCGACATGCTGGATTGTGTCACTTCCCATG;

[0064] GmGS1γ1-YN-FP:

[0065] CAATTACAGGTACCCGGGGATCCATGTCGTTGCTCTCCGATCTTATC;

[0066] GmGS1γ1-YN-RP:

[0067] TTGCTCACCATACCGCCGTCGACTGGTTTCCAAAGAATGGTTGTCTC;

[0068] GmPGD2a-YN-FP:

[0069] CAATTACAGGTACCCGGGGATCCATGGCTCAACCCACAACAAGAATAG;

[0070] GmPGD2a-YN-RP:

[0071] TTGCTCACCATACCGCCGTCGACATTTCTTGACTGTTTGGCAAGCTTG.

[0072] 2. Amplify the gene using primers NPE1-GST-FP and NPE1-GST-RP NPE1 The coding sequence (sequence is shown in SEQ ID No. 2), which is then inserted into the backbone vector pGEX4T1 , obtain the fusion protein vector expressing NPE1 and glutathione S-transferase (GST) NPE1-GST ; Primers His-GmPGK3a-FP and His-GmPGK3a-RP were used to amplify GmPGK3a Coding sequence, which is then inserted into the backbone vector pET28a, obtain the fusion protein vector expressing GmPGK3a and histidine (His) His- GmPGK3a ; Primers His-GmPFK3a-FP and His-GmPFK3a-RP were used to amplify GmPFK3a Coding sequence, which is then inserted into the backbone vector pET28a , obtain the fusion protein vector expressing GmPFK3a and His His-GmPFK3a ; Primers His-GmGS1γ1-FP and His-GmGS1γ1-RP were used to amplify GmGS1γ1 Coding sequence, which is then inserted into the backbone vector pET28a , obtain the fusion protein vector expressing GmGS1γ1 and His His-GmGS1γ1 ; Primers His-GmPGD2a-FP and His-GmPGD2a-RP were used to amplify GmPGD2a Coding sequence, which is then inserted into the backbone vector pET28a , obtain the fusion protein vector expressing GmPGD2a and His His-GmPGD2a .

[0073] The above-mentioned prokaryotic expression vector was transformed into Escherichia coli BL21 strain, and isopropyl-β-D-thiogalactoside (IPTG) was added to the final concentration of 0.8 mM after shaking in LB medium. The NPE1-GST, His-GmPGK3a, His-GmPFK3a, His-GmGS1γ1 and His-GmPGD2a fusion proteins were expressed overnight at 16°C, and the proteins were purified using commercial agarose beads. Then, NPE1-GST was incubated with His-GmPGK3a / His-GmPFK3a / His-GmGS1γ1 / His-GmPGD2a proteins, respectively, and the expression of NPE1-GST was detected by immunoblotting with anti-His agarose beads. After the His-GmPGK3a / His-GmPFK3a / His-GmGS1γ1 / His-GmPGD2a proteins were pulled down by sugar beads, anti-GST antibody was used to detect whether NPE1-GST interacted with these proteins. The results showed that NPE1-GST interacted with His-GmPGK3a / His-GmPFK3a / His-GmGS1γ1 / His-GmPGD2a in the in vitro pull-down experiment ( Figure 2 ).

[0074] The primers are:

[0075] NPE1-GST-FP:

[0076] CTTTAAGAAGGAGATATACTGCAGATGATGAAATGTGAAAATATAATCAAAC;

[0077] NPE1-GST-RP:

[0078] GACATGCTACCACCACCACCGCTACCACCACCACCTGATGAAACTGCAAAGTTCAT;

[0079] His-GmPGK3a-FP:

[0080] GTGGACAGCAAATGGGTCGCGGATCCGCGACTAAGAGGAGCGTGGGAAC;

[0081] His-GmPGK3a-RP:

[0082] TCGAGTGCGGCCGCAAGCTTGTCGACTCAAGCATCATCAAGGGCAAGGAC;

[0083] His-GmPFK3a-FP:

[0084] GTGGACAGCAAATGGGTCGCGGATCCATGGATTCTAATTCTTCTTCTCCAAG;

[0085] His-GmPFK3a-RP:

[0086] TCGAGTGCGGCCGCAAGCTTGTCGACCTAGCAAGTTGTGGGATAAATGC;

[0087] His-GmGS1γ1-FP:

[0088] GTGGACAGCAAATGGGTCGCGGATCCTCGTTGCTCTCCGATCTTATCAAC;

[0089] His-GmGS1γ1-RP:

[0090] TCGAGTGCGGCCGCAAGCTTGTCGACTTATGGTTTCCAAAGAATGGTTGTC;

[0091] His-GmPGD2a-FP:

[0092] GTGGACAGCAAATGGGTCGCGGATCCATGGCTCAACCCACAACAAGAATAG;

[0093] His-GmPGD2a-RP:

[0094] TCGAGTGCGGCCGCAAGCTTGTCGACCTAATTTCTTGACTGTTTGGCAAGCTTG.

[0095] Example 3

[0096] Artificially synthesized NPE1 peptide and NPE1 peptide with phosphorylation modification of serine 16 pS16 , incubated with the His-GmPGK3a protein expressed and purified according to Example 2 at 4°C for 10 min, then 0.1 mM, 0.2 mM, 0.5 mM, 0.8 mM, 1 mM, 1.5 mM or 1.8 mM 3-phosphoglycerate (3PG) was added to initiate the catalytic reaction, and the expression of His-GmPGK3a, His-GmPGK3a with NPE1 added, and His-GmPGK3a with NPE1 added were measured. pS16 The reaction kinetic constants of His-GmPGK3a were found to be k cat increased by about 17%, compared with NPE1 pS16 Post-binding catalytic constant k cat increased by about 60%, but NPE1 and NPE1 pS16 It also increases the catalytic Michaelis constant of His-GmPGK3a K m Therefore, His-GmPGK3a k cat / K m The values ​​were not affected, indicating that NPE1 and NPE1 pS16 Enhanced catalytic efficiency of GmPGK3a when sufficient substrate is available ( Figure 3 ).

[0097] The synthetic NPE1 and NPE1 pS16 The small peptides were incubated with the His-GmPFK3a protein expressed and purified according to Example 2 at 4°C for 10 min, and then 0.2 mM, 0.5 mM, 1 mM, 2.5 mM, 3.5 mM, 5 mM, 6 mM or 8 mM fructose 6-phosphate (F6P) was added to initiate the catalytic reaction. The activity of His-GmPFK3a, His-GmPFK3a with NPE1 added, and His-GmPFK3a with NPE1 added were measured. pS16 The reaction kinetic constants of His-GmPFK3a were found to be pS16 After combination k cat increased by about 28%, but His-GmPFK3aK m The value was also significantly increased, so the k cat / K m The values ​​were not affected, indicating that NPE1 pS16 Enhanced the catalytic efficiency of GmPFK3a when the reaction substrate is sufficient ( Figure 4 ).

[0098] The synthetic NPE1 and NPE1 pS16 The small peptides were incubated with the His-GmGS1γ1 protein expressed and purified according to Example 2 at 4°C for 10 min, and then 5 mM, 10 mM, 15 mM, 20 mM, 30 mM, 40 mM, 60 mM, 70 mM or 80 mM glutamate (Glu) was added to initiate the catalytic reaction. The activity of His-GmGS1γ1, His-GmGS1γ1 with NPE1 added, and His-GmGS1γ1 with NPE1 added were measured. pS16 The reaction kinetic constants of His-GmGS1γ1 were found to be k cat increased by about 42%, compared with NPE1 pS16 Post-binding catalytic constant k cat increased by about 73%, but NPE1 and NPE1 pS16 It also increases the catalytic Michaelis constant of His-GmGS1γ1 K m Therefore, His-GmGS1γ1 k cat / K m The values ​​were not affected, indicating that NPE1 and NPE1 pS16 Enhanced the catalytic efficiency of GmGS1γ1 when the reaction substrate is sufficient ( Figure 5 ).

[0099] The synthetic NPE1 and NPE1 pS16 The small peptides were incubated with the His-GmPGD2a protein expressed and purified according to Example 2 at 4°C for 10 min, and then 5 μM, 10 μM, 20 μM, 50 μM, 75 μM, 100 μM or 200 μM 6-phosphogluconate (6PG) was added to initiate the catalytic reaction. The activity of His-GmPGD2a, His-GmPGD2a with NPE1 added, and His-GmPGD2a with NPE1 added were measured. pS16 The reaction kinetic constants of His-GmPGD2a, NPE1 and NPE1 were found pS16No effect on His-GmPGD2a k cat Value, but add NPE1 pS16 After His-GmPGD2a K m The value is reduced by about 43%, so k cat / K m The value increased by about 73%, indicating that NPE1 pS16 Improves the affinity of GmPGD2a for the substrate 6PG, thereby enhancing the catalytic efficiency of GmPGD2a when the reaction substrate is insufficient ( Figure 6 ).

[0100] Example 4

[0101] The primers OE-NPE1-FP and OE-NPE1-RP were used to amplify NPE1 The coding sequence (sequence shown in SEQ ID No. 2) was then inserted into the backbone vector pUBI3-3×FLAG-35S-mCherry , obtain NPE1 overexpression vector pUBI3: NPE1 ; Synthetic coding sequence of NPE1 with serine 16 mutated to alanine NPE1 S16A , which is then inserted into the backbone vector pUBI3-3×FLAG-35S-mCherry , obtain NPE1 S16A Overexpression vector pUBI3:NPE1 S16A ; Synthetic coding sequence of NPE1 with serine 16 mutated to aspartic acid NPE1 S16D , which is then inserted into the backbone vector pUBI3-3×FLAG- 35S-mCherry , get NPE1 S16D Overexpression vector pUBI3:NPE1 S16D .

[0102] These overexpression vectors and empty vector (EV) were respectively transferred into Agrobacterium rhizogenes K599, and the successfully transformed K599 strain was used to infect soybean root callus. The transgenic hairy roots of the corresponding vectors were obtained by the hairy root transformation method. The nitrogenase activity of the transgenic hairy root nodules was determined by the acetylene reduction method on the 25th day after inoculation of rhizobium USDA110. pUBI3:NPE1 and pUBI3:NPE1 S16D The nitrogenase activity of transgenic hairy root nodules was increased by about 70% and 49% compared with that of empty vector transgenic hairy root nodules, respectively. pUBI3:NPE1 S16A The nitrogenase activity of transgenic hairy root nodules was similar to that of empty vector transgenic hairy root nodules ( Figure 7),illustrate NPE1 Gene overexpression significantly enhanced the nitrogen fixation ability of soybean nodules, and the function of NPE1 protein depended on the phosphorylation modification of its serine 16.

[0103] The primers are:

[0104] OE-NPE1-FP: GATTGTTGACTCGACAGTCTAGAATGATGAAATGTGAAAATATAATCAAAC;

[0105] OE-NPE1-RP:

[0106] TGTTTGAACGATCGATGGCGCGCCTCATGATGAAACTGCAAAGTT.

[0107] Example 5

[0108] Human HxPGK1 (GeneID 5230) is soybean GmPGK3a In order to understand the effect of NPE1 on the catalytic activity of human HsPGK1 protein, we firstly transformed the artificially synthesized NPE1 and NPE1 pS16 The small peptides were incubated with the purified prokaryotic expressed His-HsPGK1 protein at 4°C for 5 min, and then 0.01 mM, 0.02 mM, 0.05 mM, 0.1 mM, 0.2 mM or 0.5 mM 3-phosphoglycerate (3PG) was added to initiate the catalytic reaction. The activity of His-HsPGK1, His-HsPGK1 with NPE1 added and His-HsPGK1 with NPE1 added were measured. pS16 The reaction kinetic constants of His-HsPGK1 and the results showed that His-HsPGK1 and NPE1 pS16 Post-binding catalytic constant k cat increased by about 53%, but NPE1 pS16 It also increases the catalytic Michaelis constant of His-HsPGK1 K m Therefore, His-HsPGK1 k cat / K m The values ​​were not affected, indicating that NPE1 pS16 Enhanced the catalytic efficiency of HsPGK1 when the reaction substrate is sufficient ( Figure 8 ).

[0109] Human HkDJ (GeneID is 5214) is soybean GmPFK3aIn order to understand the effect of NPE1 on the catalytic activity of human HsPFKP protein, we firstly transformed the artificially synthesized NPE1 and NPE1 pS16 The small peptides were incubated with recombinant HsPFKP protein (MedChemExpress, HY-P75971) at 4°C for 5 min, and then 0.5 mM, 1 mM, 2 mM, 3 mM, 4 mM, 5 mM, or 7 mM fructose 6-phosphate (F6P) was added to initiate the catalytic reaction. The activity of HsPFKP, HsPFKP with NPE1, and HsPFKP with NPE1 was measured. pS16 The reaction kinetic constants of HsPFKP were found to be k cat The reduction was about 45%, while NPE1 pS16 Post-binding catalytic constant k cat The decrease was about 62%, indicating that NPE1 and NPE1 pS16 The catalytic efficiency of HsPFKP was inhibited when the reaction substrate was sufficient ( Fig. 9 ); however, HsPFKP and NPE1 pS16 After combination k cat / K m The value increased by about 103%, indicating that NPE1 pS16 The catalytic efficiency of HsPFKP was significantly enhanced when the reaction substrate was insufficient ( Fig. 9 ).

[0110] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions, improvements, etc. made within the spirit and principle of the present invention should be included in the protection scope of the present invention.

Claims

1. Application of overexpressed soybean NPE1 protein in enhancing the catalytic efficiency of metabolic enzymes, characterized in that: The amino acid sequence of the soybean NPE1 protein is shown in SEQ ID No. 3, and the serine 16 of the soybean NPE1 protein is phosphorylated; The metabolic enzyme is any one of phosphoglycerate kinase GmPGK3a, phosphofructokinase GmPFK3a, glutamine synthetase GmGS1γ1 and 6-phosphogluconate dehydrogenase GmPGD2a in soybean; The metabolic enzyme is any one of human phosphoglycerate kinase HsPGK1 and human phosphofructokinase HsPFKP.

2. Application of biological materials encoding soybean NPE1 protein, characterized in that: The application is one or more of the following applications: ①Improving the efficiency of soybean symbiotic nitrogen fixation; ② Enhance the catalytic efficiency of human phosphoglycerate kinase HsPGK1; ③ Enhance the catalytic efficiency of human phosphofructokinase HsPFKP; The amino acid sequence of the soybean NPE1 protein is shown in SEQ ID No. 3, and the serine 16 of the soybean NPE1 protein is phosphorylated; The biological material is an overexpression vector, an engineering bacterium or an animal cell containing a gene encoding soybean NPE1 protein.

3. The use of the biological material for encoding soybean NPE1 protein according to claim 2, characterized in that: The coding region sequence of the gene is shown in SEQ ID No.

2.

4. The use of the biomaterial for encoding soybean NPE1 protein according to claim 2, characterized in that: The nucleotide sequence of the gene is shown in SEQ ID No.1.

Images