Method for detecting early warning factor of SAA-ichthyophthirius multifiliis infection

Abstract

The invention discloses an early warning factor detection method for SAA-ichthyophthirius multifiliis infection, and particularly relates to the technical field of SAA-ichthyophthirius multifiliis infection detection.The specific steps are as follows: S1, RNA extraction; s2, removing reverse transcription of the genome DNA and cDNA (complementary deoxyribonucleic acid); s3, constructing a cloning vector of the Saa CDS region; s4, constructing an Saa phylogenetic tree; s5, constructing a Saa fluorescent quantitative detection primer design and standard curve; s6, performing saa expression after the ichthyophthirius multifilis infects the pelteobagrus vachelli; and S7, data statistics and analysis. Pelteobagrus vachelli is taken as a research object, a saa CDS region of the pelteobagrus vachelli is cloned and analyzed, a saa fluorescent quantitative detection method is established, saa mRNA expression level is dynamically monitored at different stages of ichthyophthirius multifiliis infected by the pelteobagrus vachelli, the reaction time and part of the saa in the ichthyophthirius multifiliis infection are disclosed, and the application of the saa fluorescent quantitative detection method to the detection of the ichthyophthirius multifiliis infection is realized. A foundation is laid for function analysis and application research of saa, and a foundation is laid for early prevention and early control of ichthyophthiriasis.

Description

Technical Field

[0001] The invention relates to the technical field of SAA-Ichthyophthirius avium infection detection, and in particular to an early warning factor detection method for SAA-Ichthyophthirius avium infection. Background Art

[0002] Pelteobagrus vachelli, also known as Yellow Catfish, belongs to the order Siluriformes, family Catfish, genus Pelteobagrus. Pelteobagrus vachelli mainly lives in the Yangtze River system and its affiliated lakes and rivers. As a native fish of the Yangtze River, it has the advantages of fast growth, large size, tender meat, no intramuscular spines, and high muscle fat content. It is an important economic fish for farming.

[0003] Ichthyophthirius is a common parasitic disease in fish, and the pathogen is Ichthyophthirius multifida. Ichthyophthirius multifida belongs to the order Hymenostomata, family Stomidae, and genus Ichthyophthirius. The disease mainly occurs in spring and autumn. The pathogen multiplies fastest at 15-25℃, and the skin and gills are the main sites of disease. After fish are infected with Ichthyophthirius, they will have anorexia, slow reaction, emaciation, and white spots all over the affected parts. This disease is particularly harmful to scaleless fish such as Pelteobagrus vachelli and fish with underdeveloped scales. There is no specific drug for Ichthyophthirius. Once an outbreak occurs, the mortality rate of fish is extremely high, and it is considered to be a cancer of fish. Conventional microscopic examinations are difficult to distinguish between Ichthyophthirius multifida and ciliates in the breeding environment, and it is not easy to detect when the number of pathogens is small. The National Standard of the People's Republic of China "Diagnostic Procedure for Ichthyophthirius Disease in Freshwater Fish" (GB / T3473-2017) stipulates the detection method of Ichthyophthirius multifida after the onset of the disease. Cao Zeyi, Zhou Qingjie, Chen Kai, et al. Establishment and application of PCR and SYBR Green real-time fluorescence quantitative PCR detection methods for Ichthyophthirius multispermum[J]. Journal of Fisheries of China, 2024, 60:1-9. A fluorescence quantitative detection method for Ichthyophthirius multispermum was successfully constructed using the mitochondrial CoI sequence of Ichthyophthirius multispermum, with a detection sensitivity of 0.02 cells / μL. However, these are all detection methods for pathogens, and fish body testing is still required to determine whether they are infected.

[0004] Serum amyloid A (SAA) is a sensitive acute phase protein mainly derived from the liver. When an organism is infected by pathogenic microorganisms, mechanical trauma, or tumor proliferation, it is synthesized by liver cells and secreted into the blood, causing a sharp increase in the serum concentration of SAA; during the recovery period of the disease, it drops rapidly, and is one of the biomarkers of acute inflammation. In mammals, serum amyloid A is composed of SAA1, SAA2, SAA3, and SAA4. SAA1 and SAA2 are called acute-phase SAA (A-SAA), which have the function of activating the immune system. During the acute reaction, the protein level can be 100-1000 times higher than the normal level. SAA4 has a similar effect to A-SAA and can also activate immune cells. As for SAA3, it is only known that its expression is not affected by inflammatory factors, and other aspects have not been clearly studied. The expression characteristics of fish SAA are similar to those of A-SAA in mammalian SAA: after being infected, the body induces inflammation, and the expression level of SAA will increase significantly. Given the high sensitivity of SAA to the health status of organisms, SAA concentration has become one of the criteria for judging the effects of drugs and additives on the immune status and anti-infection ability of organisms.

[0005] In order to lay a foundation for the functional analysis and application research of SAA, and for the early prevention and control of Ichthyophthirius avium disease, the present invention proposes a method for detecting early warning factors of SAA-Ichthyophthirius avium infection. Summary of the invention

[0006] The purpose of the present invention is to provide a method for detecting early warning factors of SAA-Ichthyophthirius punctatus infection, to lay a foundation for the functional analysis and applied research of SAA, and to lay a foundation for the early prevention and early control of Ichthyophthirius punctatus disease.

[0007] In order to achieve the above object, the present invention provides the following technical solution: a method for detecting early warning factors of SAA-Ichthyophthirius infection, the specific steps are as follows:

[0008] S1. Extract RNA;

[0009] S2, genomic DNA removal and cDNA reverse transcription;

[0010] Construction of cloning vector for S3 and Saa CDS regions:

[0011] S3.1, PCR amplification: using the cDNA reverse transcribed in S2 as a template and wa-saa-F / R as primers, configure the PCR system and amplify;

[0012] S3.2, Connection: saa was amplified according to the PCR method in S3.1, and the amplified product was subjected to agarose gel electrophoresis and gel recovery for Cloning vector construction;

[0013] S3.3, the ligation product is transformed into DH5α;

[0014] S4. Construct the phylogenetic tree of Saa and analyze the evolutionary relationship of Saa within the same species and between different species;

[0015] S5. Design of primers and standard curve for Saa fluorescence quantitative detection;

[0016] S6, saa expression after Ichthyophthirius multifida infects Pelteobagrus vachelli;

[0017] S7. Data statistics and analysis.

[0018] Preferably, in S1, heart, liver, spleen and kidney tissue samples are collected from healthy and wounded Pelteobagrus vachelli, RNA is extracted after the samples are homogenized, and RNA concentration is measured; the specific steps of sample collection are: using a clean blade to make a 0.5 cm wound on the side of the fish body, and after 4-5 hours, the sample is collected in an EP tube.

[0019] Preferably, the specific steps of S2 are: referring to the cDNA reverse transcription kit, configuring a residual genomic DNA reaction system, placing it in a PCR instrument for incubation, the reaction solution is continuously used for the next step of reverse transcription reaction system configuration, and then the reverse transcription reaction procedure is performed, and after the reaction is completed, it is placed at -20°C for short-term storage.

[0020] Preferably, in S3.1, after the amplification is completed, 1% agarose gel electrophoresis is performed, the PCR results are observed using a gel imaging system, and the products are sequenced.

[0021] Preferably, the specific steps of S3.3 are: slowly add the saa connection liquid to DH5α, mix gently, place on ice for 30 minutes, transfer to 42°C heat shock for 90 seconds, ice bath for 5 minutes, add LB broth, and culture at 37°C for 2 hours. After 2 hours, centrifuge the transformation liquid at 4000r / min for 2 minutes, discard the supernatant, mix the remaining material and evenly spread it on Amp culture medium, culture at 37°C overnight, and the next day, pick colonies for colony PCR identification and expansion, and sequence the strains identified as positive by PCR. After the sequence is confirmed by NCBI, the bacteria are preserved in 10% glycerol for later use.

[0022] Preferably, in S3.3, after the sequencing results are processed by NCBI BLAST, EditSeq, and DNAMAN to remove the vector sequence, the sequence number is uploaded to NCBI to apply for the sequence number, and the saa CDS region sequences of other fish or mammals are downloaded from NCBI, and a phylogenetic tree is constructed using DNAMAN and AI software to analyze the evolutionary relationship of saa between the same species and between different species.

[0023] Preferably, the specific steps of S5 are as follows: According to the sequencing results in S3.3, select sequences with a length of 100-200 bp, and use Primer Premier 5.0 to design the upstream and downstream primers q-W-saa-F / R for saa fluorescence quantitative detection; Dilute the cDNA extracted in S2 in five concentration gradients of 10-1, 10-2, 10-3, 10-4, and 10-5 in a 10-fold ratio. Refer to the instruction manual of the Perfect StartGreen qPCR SuperMix dye method fluorescence quantitative premixed reagent to configure the fluorescence quantitative primer titer evaluation reaction system, and amplify saa according to the given program and temperature in a two-step method to form a standard curve with the Cq value as the ordinate and the dilution concentration as the abscissa, and analyze the slope, amplification efficiency, and R 2 value of the standard curve; At the same time, analyze the undulation degree of the reaction result trend line, line distribution, peak graph size, peak position, and Cq value size to judge whether the primer under this reaction condition is effective when a single overlapping peak is amplified by the same primer. If not, the reaction conditions should be optimized or the primer should be redesigned.

[0024] Preferably, in S6, using the cDNA of each tissue of Pelteobagrus vachelli at different infection times as a template, the target gene uses q-W-saa-F / R as primers, and the internal reference gene uses β-actin-F / R as primers. Refer to the PerfectStart Green qPCRSuperMix dye method fluorescence quantitative premixed kit to configure the PCR detection reaction system and reaction program. Set 3 parallel control groups for each sample of each gene, and set 3 negative control groups and 3 positive control groups for each tissue, with a total of 96 samples in one tissue.

[0025] Preferably, in S7, with the infection time as the horizontal axis and different samples of the same tissue as the vertical axis, calculate the average value of each parallel control group of saa and β-actin respectively. Take the average value of each parallel control group of β-actin as Ref, subtract Ref from the saa Cq average value to get ΔCq, and use the prism software one-way-anova difference analysis program to process the data of ΔCq. Through Dunnett's multiple comparison test method, obtain the significant differences and P value sizes between 0d and 5d, 10d, 20d, 40d, and near death after Ichthyophthirius multifiliis infects Pelteobagrus vachelli among the same tissues; Calculate ΔΔCq for each group according to ΔCq, ΔΔCq = ΔCq - AVERAGE; AVERAGE is the ΔCq of 5 different samples of the same infection gradient in the same tissue. Obtain 2 through ΔΔCq and the POWER function -ΔΔCqGraphPad Prism 8.0 was used to obtain the geometric mean and geometric SD of SAA in each tissue, and the significant difference results were analyzed according to the previous Dunnett's multiple comparison test method.

[0026] In the above technical solution, the technical effects and advantages provided by the present invention are:

[0027] The early warning factor detection method for SAA-Ichthyophthirius vachellii infection of the present invention takes Pelteobagrus vachellii as the research object, clones and analyzes the SAA CDS region of Pelteobagrus vachellii, establishes a SAA fluorescence quantitative detection method, and dynamically monitors the expression level of SAA mRNA at different stages of Pelteobagrus vachellii infection with Ichthyophthirius vachellii, reveals the reaction time and position of SAA in Ichthyophthirius vachellii infection, lays a foundation for the functional analysis and application research of SAA, and lays a foundation for the early prevention and early control of Ichthyophthirius vachellii disease. BRIEF DESCRIPTION OF THE DRAWINGS

[0028] Figure 1 This is the result of PCR amplification of Saa CDS region;

[0029] Figure 2 This is the BLAST comparison chart of the sequencing results of Saa-positive strains;

[0030] Figure 3 This is the phylogenetic tree diagram of Saa;

[0031] Figure 4 is the Saa standard curve;

[0032] Figure 5 is the dissolution curve of Saa;

[0033] Figure 6 This is a diagram showing the expression of SAA in different tissues of Yellow Catfish after Ichthyophthirius multifida infected it. DETAILED DESCRIPTION

[0034] In order to enable those skilled in the art to better understand the technical solution of the present invention, the present invention will be further described in detail below with reference to the accompanying drawings.

[0035] 1. Experimental Materials

[0036] 1. Experimental fish and cDNA:

[0037] (1) Pelteobagrus vachelli: provided by the breeding base of the Key Laboratory of Fishery Resources Protection and Benefit in the Upper Reaches of the Yangtze River in Sichuan Province. The experimental fish weighed about 10±2 g.

[0038] (2) cDNA of Pelteobagrus walleye infected with Ichthyophthirius: The cDNA samples of Pelteobagrus walleye infected with Ichthyophthirius were stored in the laboratory. Five experimental fish were selected at each time point. The liver, kidney, spleen, gill, skin, head kidney and intestine were collected 0 day before infection and 5 days, 10 days, 20 days and 40 days after infection. RNA was extracted using an RNA extraction kit, reverse transcribed into cDNA, and stored at -80°C.

[0039] 2. Primer design and synthesis:

[0040] Referring to the predicted gene sequence of saa of Pelteobagrus vachelli in the NCBI database, GenBank accession number: XM_060886830.1, PrimerPremier5.0 was used to design the upstream and downstream primers of the saa CDS region, which were named: v-saa-F-1404bp and v-saa-R-1404bp respectively. After the design was completed, it was sent to Shenggong Biotechnology (Shanghai) Co., Ltd. for synthesis. The upstream and downstream primers of the internal reference β-actin were synthesized and saved by the laboratory. The specific sequences are shown in Table 1:

[0041] Table 1 Design of saa primers and β-actin primers for Pelteobagrus vachelli

[0042] Primer name Primer sequence (5'-3') wa-saa-F-1404bp ATGTTTATGGACTCACCACAGATG wa-saa-R-1404bp TTACACTGGCTCTGGTTTAGGCTC q-β-actin-F GATTCGCTGGAGATGATGCT q-β-actin-R CGTGCTCAATGGGGTACTTC

[0043] 3. Main reagents for the experiment:

[0044] The main experimental reagents and their sources are shown in Table 2:

[0045] Table 2 Main reagents for the experiment

[0046]

[0047]

[0048] 4. Main instruments for the experiment:

[0049] The main experimental instruments and their sources are shown in Table 3:

[0050] Table 3 Main experimental instruments

[0051]

[0052] Second, this embodiment provides a method for detecting early warning factors of SAA-Ichthyophthirius infection, and the specific steps are as follows:

[0053] S1. RNA extraction:

[0054] The heart, liver, spleen and kidney tissues of healthy Pelteobagrus vachelli were collected and mixed in EP tubes. At the same time, the same samples of wounded Pelteobagrus vachelli were collected. The specific steps were as follows: a clean blade was used to cut a wound of about 0.5 cm on the side of the fish body. After 4-5 hours, the heart, liver, spleen and kidney tissues were collected and mixed in EP tubes. After homogenization, about 20 mg of homogenate samples were taken from each sample, RNA was extracted using the reference RNA extraction kit, and the RNA concentration was measured using the NanoDropOneC spectrophotometer.

[0055] S2. Genomic DNA removal and cDNA reverse transcription:

[0056] Refer to the cDNA reverse transcription kit to prepare the residual genomic DNA reaction system, place it in a PCR instrument for incubation, and the reaction solution is used for the next step of reverse transcription reaction system configuration, followed by the reverse transcription reaction procedure (Table 4). After the reaction is completed, store it at -20°C for a short term.

[0057] Table 4 Residual genomic DNA removal reaction system

[0058]

[0059] Construction of cloning vector for S3 and Saa CDS regions:

[0060] S3.1, PCR amplification:

[0061] The cDNA reverse transcribed in S2 was used as a template, and wa-saa-F / R was used as a primer to prepare a 25 μL PCR system for amplification (Table 5). After amplification, 1% agarose gel electrophoresis was performed, and the PCR results were observed using a gel imaging system, and the product was sent to the company for sequence determination.

[0062] Table 5 PCR amplification reaction system and procedure

[0063]

[0064] S3.2, connect:

[0065] The saa was amplified according to the PCR method in S3.1, and the amplified product was subjected to agarose gel electrophoresis and gel recovery. Cloning vector construction, connection system and procedures are shown in Table 6:

[0066] Table 6 Connection system and procedures

[0067]

[0068] S3.3, DH5α transformation:

[0069] The ligation product was transformed into DH5α, and the steps were as follows: 10 μL saa ligation solution was slowly added to 50 μL DH5α, and after gentle mixing, it was placed on ice for 30 minutes, transferred to 42°C heat shock for 90 seconds, and after ice bathing for 5 minutes, 940 μL LB broth was added, and cultured at 37°C for 2 hours. After 2 hours, the transformation solution was centrifuged at 4000r / min for 2 minutes, 800 μL supernatant was discarded, and the remaining 200 μL was evenly spread on Amp medium after mixing, and cultured at 37°C overnight. The next day, colonies were picked for colony PCR identification and expansion. Strains identified as positive by PCR were sent to Shenggong Biotechnology Co., Ltd. for sequencing. After the sequence was verified by NCBI, 10% glycerol was used to preserve the bacteria for later use.

[0070] S4. Construction of Saa phylogenetic tree:

[0071] After the sequencing results in S3.3 were removed from the vector sequence by NCBI BLAST, EditSeq, and DNAMAN, the sequence number was uploaded to NCBI to apply for the sequence number, and the saa CDS region sequences of other fish or mammals were downloaded from NCBI. The phylogenetic tree was constructed using DNAMAN and AI software to analyze the evolutionary relationship of saa between the same species and between different species.

[0072] S5. Design of primers for Saa fluorescence quantitative detection and construction of standard curve:

[0073] According to the sequencing results in S3.3, a 100-200bp sequence was selected, and the upstream and downstream primers q-wa-saa-F / R for saa fluorescence quantitative detection were designed using Primer Premier5.0. The cDNA extracted from S2 was diluted 10 times according to five concentration gradients of 10-1, 10-2, 10-3, 10-4, and 10-5. The fluorescence quantitative primer titer evaluation reaction system was configured according to the instructions of the Perfect Start Green qPCR SuperMix dye method fluorescence quantitative premix reagent. Saa was amplified according to the given program and temperature of the two-step method (see Table 7), and a standard curve with Cq value as the ordinate and dilution concentration as the abscissa was formed. The slope of the standard curve, amplification efficiency and R 2 At the same time, the fluctuation degree of the reaction result trend line, line distribution, peak graph size, peak top position, Cq value, etc. are analyzed to determine whether the primers under the reaction conditions are effective when the same primer amplifies a single overlapping peak. If not, the reaction conditions should be optimized or the primers should be redesigned.

[0074] Table 7 Fluorescence quantitative titer assessment reaction system and procedure

[0075]

[0076] S6. saa expression in Pelteobagrus vachelli infected with Ichthyophthirius multifiliis:

[0077] Using the cDNA of each tissue of Pelteobagrus vachelli at different infection times as templates, the target gene was primed with q-Wa-saa-F / R, and the internal reference gene was primed with β-actin-F / R. Referring to the PerfectStart Green qPCR SuperMix dye-based fluorescence quantitative premix kit, the PCR detection reaction system and reaction program were configured, as shown in Table 7. Each sample of each gene was set with 3 parallel control groups, and another 3 negative control groups and 3 positive control groups were set for each tissue, with a total of 96 samples for one tissue.

[0078] S7. Data statistics and analysis:

[0079] Taking the infection time as the horizontal axis and different samples of the same tissue as the vertical axis, the average values of saa and β-actin in each parallel control group were calculated respectively. Taking the average value of each parallel control group of β-actin as Ref, the ΔCq was obtained by subtracting Ref from the average saa Cq value. The prism software one-way-anova difference analysis program was used to process the ΔCq data, and the significant differences and P-value between 0d and 5d, 10d, 20d, 40d and near death after Ichthyophthirius multifiliis infection of Pelteobagrus vachelli in the same tissue were obtained through Dunnett's multiple comparison test method. The ΔΔCq of each group was calculated according to ΔCq, ΔΔCq = ΔCq - AVERAGE(ΔCq of 5 different samples of the same infection gradient in the same tissue), and 2 -ΔΔCq . The geometric mean and geometric SD graphs of saa in each tissue were obtained using GraphPad Prism 8.0, and were marked graphically according to the significant difference results obtained by the previous Dunnett multiple comparison test method. 0.01 < P < 0.05 was significant, marked as ☆; P < 0.01 was extremely significant, marked as ★.

[0080] III. Results:

[0081] 1. PCR amplification of the saa CDS region:

[0082] Using the cDNA of the mixed tissues of Pelteobagrus vachelli as a template and Wa-saa-F / R as primers, after PCR amplification and gel electrophoresis, the results showed that a specific band of about 1500bp could be obtained by PCR amplification using the cDNA of the mixed tissues of wounded Pelteobagrus vachelli as a template, while no specific band was amplified from the PCR product using the cDNA of the mixed tissues of healthy Pelteobagrus vachelli as a template. As Figure 1 shown in the figure, M. DNA marker 2000; 0. Negative control; 1. cDNA of the mixed tissues of healthy Pelteobagrus vachelli; 2. cDNA of the mixed tissues of wounded Pelteobagrus vachelli.

[0083] 2. Cloning of saa CDS region:

[0084] After electrophoresis, gel recovery, T-vector connection, transformation, strain screening, identification, and expansion of Saa PCR amplification products, a positive strain was obtained. After strain sequencing, a 1404bp base sequence was obtained. The sequence was compared with NCBI BLAST and showed that the sequence had a high similarity with yellow catfish saa. Figure 2 As shown, it shows that the T vector cloning strain was successfully constructed and named

[0085] 3. Construction of Saa evolutionary tree:

[0086] The colony sequencing results were compared using EditSeq and DNAMAN, and after removing the vector sequence, they were uploaded to NCBI to obtain the Genbank accession number: PP790568.1. The saa CDS regions of different similarities and species were downloaded, and the phylogenetic tree was constructed using DNAMAN and AI, such as Figure 3 The results showed that the CDS region sequence of saa of P. vachelli in this experiment was clustered with the saa of Tachysurus fulvidraco (XM_027163767.2) and P. vachelli (XM_060886829.1); it had a high similarity with Hemibagrus wyckioides (XM_058407425.1), Ictalurus punctatus (XM_053641118.1), Silurus soldatovi meridionalisChen (XM_046858632.1), etc.; it had a high similarity with Oreochromis niloticus (XM_003443930.5), Cichlidae

[0087] (XM_005727952.2), salmon (Oncorhynchus keta) (XR_004211143.1), etc. have low similarity; Homo sapiens (AAA85338.1), cattle (Bovini

[0088] (BFE12144.1), horse (Equuscaballus)(NP_001075322.1), domestic cat (Felis catus)(BAE93428.1), rainbow trout (Oncorhynchus mykiss)(NP_001117908.1), red crucian carp (Carassiusauratusred var)(QJU71673.1), zebrafish (Danio rerio)

[0089] (NP_001005599.1), Paramisgurnus dabryanus (Sauvage)

[0090] (XP_065105414.1), Scaphesthes macrolepis (XP_063350571), etc. have low similarity.

[0091] 4. Design of Saa fluorescence quantitative primers and construction of standard curve:

[0092] Using the saa CDS region sequencing sequence, fluorescent quantitative primers were designed in Primer premier5.0. Results Fluorescent quantitative upstream and downstream primers with a length of 111 bp were screened (Table 8). Using q-Wa-saa-F / R as primers and 10-fold diluted mixed tissue cDNA of traumatized yellow catfish as template, the fluorescent quantitative standard curve and melting curve were constructed. The results showed that the amplification efficiency was 96.8%, R 2 0.991, standard curve slope -3.402, single overlapping peaks in melting curve, indicating that the amplification product of q-wa-saa-F / R has good specificity and high amplification efficiency, and can be used for subsequent quantitative analysis of saa mRNA expression. Figure 4-5 shown.

[0093] Table 8 Saa fluorescence quantitative primer design

[0094] Primer name Sequence (5'-3') q-wa-saa-F GTACAGCAGCCTCCAGT q-watt-saa-R ATGAGGAATTGATGAAGAGC

[0095] 4. Effects of Ichthyophthirius spp. on the expression of SAA in Pelteobagrus vachelli:

[0096] qRT-PCR was used to detect the expression of saa in the liver, spleen, kidney, head kidney, intestine, gill, and skin of P. vachelli before and after infection with Ichthyophthirius multifida. β-actin and 0d were used as the first and second references, respectively, and 2 -ΔΔCq The results showed that the expression level of saa was highest in the spleen tissue on the 5th day after infection, which was 14.06 times that of the second control group, and was lowest in the intestinal tissue of BS, which was 0.12 times that of the second control group (Table 9).

[0097] Table 9 Results of fluorescence quantitative detection of SAA in Pseudobulbus varanus infected with Ichthyophthirius multifida

[0098]

[0099]

[0100]

[0101] GraphPad Prism8.0 was used to analyze the tissue distribution of SAA, and Dunnett's multiple comparison test was used to analyze the significant differences. The results showed that on the 5th day after infection with Ichthyophthirius multifida, SAA was significantly upregulated in the spleen (P=0.001); on the 10th day, it was extremely significantly upregulated in the spleen (P=0.0035) and head kidney (P=0.003); on the 20th day, it was extremely significantly upregulated in the head kidney (P=0.0067), and extremely significantly downregulated in the gills (P=0.0024); on the 40th day, the expression in all organs tested was not significant; on the 40th day, it was extremely significantly upregulated in the spleen (P=0.0093) and head kidney (P=0.0009) of the moribund animals, and significantly upregulated in the skin (P=0.0152). Figure 6 As shown in the figure, ☆ indicates significant (0.01<P<0.05); ★ indicates extremely significant (P<0.01).

[0102] 5. Discussion:

[0103] SAA is an acute response protein. When an organism is infected by pathogenic microorganisms, mechanical trauma, or tumor proliferation, it is synthesized by liver cells and then secreted into the blood, causing a sharp increase in SAA serum concentration. During the recovery period of the disease and in a healthy state, SAA expression is low. In the healthy, untreated yellow catfish tissue, the method of this embodiment did not amplify SAA. After the scratch treatment, PCR amplification and detection yielded a specific band with a band size of approximately 1500 bp, indicating that SAA is expressed at a low level in healthy yellow catfish and at a high level in yellow catfish with acute reactions.

[0104] As acute coding proteins, SAA1 and SAA2 are the main inflammatory marker proteins. They are early defense proteins against inflammation and mechanical trauma expressed in the liver. Their expression is mainly affected by the proinflammatory cytokines IL-1, IL-6 and TNF-α. In humans and mice, the nucleotide sequence identity of the coding and non-coding regions of SAA1 and SAA2 is about 95%, and they have similar regulatory mechanisms. Other serum amyloid A (SAA) proteins are expressed outside the liver. SAA3 is the main and only SAA subtype secreted and expressed by the epithelial cells of the mammary gland when dairy cows suffer from mastitis and during lactation. It is also called mammary-associated serum amyloid A3 (M-SAA), which is proportional to the severity of mastitis. In addition, SAA3 is also the main serum amyloid protein expressed by mice, rats, and rabbits in pathological processes. SAA4 is currently mainly studied in human tumors. Li Xuyu et al. (Li Xuyu, Zhang Yu, Wang Xudong, et al. Effect of serum SAA4 and KLKB1 on the prognosis of patients with non-muscle invasive bladder cancer treated with TURBT [J]. Journal of Difficult Diseases, 2023, 22(07): 697-701.) found that the expression level of SAA4 in the serum of patients with non-muscle invasive bladder cancer (NMIBC) with different clinical and pathological characteristics was significantly higher than that of healthy people (t=31.508, P<0.01), and its increased level was related to the TNM stage and pathological grade of the tumor. The saa CDS region cloned by the method of this embodiment has the highest similarity with the predicted sequence of saa1 on NCBI, which is consistent with the characteristics of the saa PCR product amplified after trauma in this experiment.

[0105] Qi Lin et al. (Qi Lin, Feng Xiao, Xiang Zhiming, et al. Analysis of the expression of zebrafish serum amyloid A gene during viral infection [J]. Journal of Henan University (Natural Science Edition), 2013, 43(5): 540-544.) found that under the stimulation of bacteria, viruses, LPS and Poly (I: C), saa in zebrafish showed the characteristics of acute response protein: under the stimulation of bacteria and pure components, Saa showed a sharp increase and sharp decrease within 24 hours and then returned to normal expression change pattern; under viral stimulation, the time from infection to recovery was as long as 4 days. He et al. (Yang H, Zhujin D, Marana MH, et al. Immersion vaccines against Yersinia ruckeri infection in rainbow trout: Comparative effects of strain differences [J]. Journal of Fish Diseases. 2021, 44 (12): 1937-1950.) studied Yersinia ruckeri infection in yellow catfish and found that saa was significantly upregulated in the liver and spleen 1 day after infection, and significantly upregulated in the gills, liver, and spleen on the 5th day after infection. In the method of this embodiment, after infection with Ichthyophthirius multifida, the expression pattern of saa in yellow catfish was as follows: saa was extremely significantly upregulated in the spleen (5d, 10d and BS) and head kidney (10d, 20d and BS), and the gills were extremely significantly downregulated at 20d and significantly downregulated at 40d.

[0106] Ichthyophthirius multifida mainly parasitizes on the skin and gills of fish. When the larvae use a drill to absorb and rotate into the epidermis 0.1-1.0mm deep, epithelial cells show obvious hyperplasia, mucus secretion increases, and the typical symptom "white spots" is formed. It takes about 1 week, and it proliferates explosively within 1-2 weeks after infection. The disease develops very quickly, causing a large number of infections and deaths in fish. Therefore, early prevention and control of Ichthyophthirius multifida is of great significance. Conventional microscopic examinations are difficult to distinguish between Ichthyophthirius multifida and ciliates in the breeding environment, and it is not easy to detect when the number of pathogens is small. The National Standard of the People's Republic of China "Diagnostic Procedure for Ichthyophthirius Disease in Freshwater Fish" (GB / T3473-2017) stipulates the detection method of Ichthyophthirius multifida after the onset of the disease. Cao Zeyi et al. (Cao Zeyi, Zhou Qingjie, Chen Kai, et al. Establishment and application of PCR and SYBR Green real-time fluorescence quantitative PCR detection methods for Ichthyophthirius multispermum [J]. Journal of Fisheries of China, 2024, 60: 1-9.) successfully constructed a fluorescence quantitative detection method for Ichthyophthirius multispermum using the mitochondrial CoI sequence of Ichthyophthirius multispermum, with a detection sensitivity of 0.02 cells / μL. However, these are all detection methods for pathogens, and fish body testing is still required to determine whether they are infected. This experiment found that on the 5th day after Ichthyophthirius multispermum infection, before white spots appeared, saa showed a significant upregulation in the spleen, suggesting that spleen saa has research prospects for monitoring Ichthyophthirius disease in Pelteobagrus vachelli.

[0107] 5. Conclusion:

[0108] PCR amplification using cDNA from mixed tissues of traumatized yellow catfish as templates yielded a 1404bp saa CDS region (GenBank accession number: PP790568.1). The sequence had the highest similarity to saa1, and was clustered with yellow catfish. The expression pattern of saa after infection of yellow catfish with Ichthyophthirius multifida was as follows: saa was significantly upregulated in spleen (5d, 10d and BS) and head kidney (10d, 20d and BS), and significantly downregulated in gills at 20d and 40d. The results revealed the expression of saa in seven different organs at six time points after infection with Ichthyophthirius multifida in yellow catfish, laying a foundation for the subsequent functional analysis and application research of SAA.

[0109] The above description is only by way of illustration of certain exemplary embodiments of the present invention. It is undoubted that those skilled in the art can modify the described embodiments in various ways without departing from the spirit and scope of the present invention. Therefore, the above drawings and descriptions are illustrative in nature and should not be construed as limiting the scope of protection of the claims of the present invention.

Claims

1. A method for detecting early warning factors of SAA-Ichthyophthirius spp. infection, characterized in that: The specific steps are as follows: S1. Extract RNA; S2, genomic DNA removal and cDNA reverse transcription; Construction of cloning vector for S3 and Saa CDS regions: S3.1, PCR amplification: using the cDNA reverse transcribed in S2 as a template and wa-saa-F / R as primers, configure the PCR system and amplify; S3.2, -T1 connection: saa was amplified according to the PCR method in S3.1, and the amplified product was subjected to agarose gel electrophoresis and gel recovery and then used for -T1 cloning vector construction; S3.3, the ligation product is transformed into DH5α; S4. Construct the phylogenetic tree of Saa and analyze the evolutionary relationship of Saa within the same species and between different species; S5. Design of primers and standard curve for Saa fluorescence quantitative detection; S6, saa expression after Ichthyophthirius multifida infects Pelteobagrus vachelli; S7. Data statistics and analysis.

2. The method for detecting early warning factors of SAA-Ichthyophthirius infection according to claim 1, characterized in that: In S1, heart, liver, spleen, and kidney tissue samples were collected from healthy and injured P. vachelli. After the samples were homogenized, RNA was extracted and the RNA concentration was measured. The specific steps of sample collection are as follows: use a clean blade to make a 0.5 cm wound on the side of the fish body, and after 4-5 hours, collect the sample in an EP tube.

3. The method for detecting early warning factors of SAA-Ichthyophthirius infection according to claim 1, characterized in that: The specific steps of S2 are: refer to the cDNA reverse transcription kit to configure the residual genomic DNA reaction system, place it in a PCR instrument for incubation, and continue to use the reaction solution for the next step of reverse transcription reaction system configuration, followed by the reverse transcription reaction procedure. After the reaction is completed, it is placed in -20℃ for short-term storage.

4. The method for detecting early warning factors of SAA-Ichthyophthirius infection according to claim 1, characterized in that: In S3.1, after the amplification is completed, 1% agarose gel electrophoresis is performed, the PCR results are observed using a gel imaging system, and the products are sequenced.

5. The method for detecting early warning factors of SAA-Ichthyophthirius infection according to claim 1, characterized in that: S3.3 The specific steps are: slowly add the saa ligation solution to DH5α, mix gently, place on ice for 30 minutes, transfer to 42℃ heat shock for 90 seconds, ice bath for 5 minutes, add LB broth, culture at 37℃ for 2 hours, after 2 hours, centrifuge the transformation solution at 4000r / min for 2 minutes, discard the supernatant, mix the remaining material and evenly spread it on Amp culture medium, culture at 37℃ overnight, the next day, pick colonies for colony PCR identification and expansion, sequence the strains identified as positive by PCR, and after the sequence is confirmed by NCBI, preserve the bacteria in 10% glycerol for later use.

6. The method for detecting early warning factors of SAA-Ichthyophthirius infection according to claim 1, characterized in that: In S3.3, after the sequencing results were processed by NCBI BLAST, EditSeq, and DNAMAN to remove the vector sequence, they were uploaded to NCBI to apply for the sequence number, and the CDS region sequences of saa of other fish or mammals were downloaded from NCBI. The phylogenetic tree was constructed using DNAMAN and AI software to analyze the evolutionary relationship of saa within the same species and between different species.

7. The method for detecting early warning factors of SAA-Ichthyophthirius infection according to claim 1, characterized in that: The specific steps of S5 are as follows: according to the sequencing results in S3.3, select 100-200bp length sequences, and use Primer Premier5.0 to design saa fluorescence quantitative detection upstream and downstream primers q-wa-saa-F / R; The cDNA extracted from S2 was diluted 10-fold according to five concentration gradients of 10-1, 10-2, 10-3, 10-4, and 10-5. The fluorescent quantitative primer titer evaluation reaction system was prepared according to the instructions of Perfect Start Green qPCR SuperMix dye method fluorescent quantitative premix reagent. saa was amplified according to the given program and temperature of the two-step method to form a standard curve with Cq value as the ordinate and dilution concentration as the abscissa. The slope, amplification efficiency and R of the standard curve were analyzed. 2 value; At the same time, the fluctuation degree of the reaction result trend line, line distribution, peak graph size, peak top position, and Cq value are analyzed to determine whether the primers under the reaction conditions are effective when the same primer amplifies a single overlapping peak. If not, the reaction conditions should be optimized or the primers should be redesigned.

8. The method for detecting early warning factors of SAA-Ichthyophthirius infection according to claim 1, characterized in that: In S6, cDNA of various tissues of P. vachelli at different infection times was used as template, q-v-saa-F / R was used as primer for target gene, β-actin-F / R was used as primer for internal reference gene, and the PCR detection reaction system and reaction procedure were configured with reference to PerfectStart Green qPCR SuperMix dye method fluorescence quantitative premix kit. Three parallel control groups were set for each sample of each gene, and three negative control groups and three positive control groups were set for each tissue, for a total of 96 samples for one tissue.

9. The method for detecting early warning factors of SAA-Ichthyophthirius infection according to claim 1, characterized in that: In S7, the infection time was taken as the horizontal axis and different samples of the same tissue were taken as the vertical axis. The average values ​​of each parallel control group of saa and β-actin were calculated respectively. The average value of each parallel control group of β-actin was taken as Ref. The average value of saaCq was subtracted from Ref to obtain ΔCq. The one-way-anova difference analysis program of prism software was used to process the data of ΔCq. The significant differences and P values ​​between 0d and 5d, 10d, 20d, 40d and dying in the same tissue after infection of P. vachelli were obtained by Dunnett's multiple comparison test method. The ΔΔCq of each group was calculated based on ΔCq, ΔΔCq = ΔCq-AVERAGE; AVERAGE is 5 different ΔCq of the same infection gradient in the same tissue, and 2 was obtained by ΔΔCq and POWER function. -ΔΔCq ; GraphPad Prism 8.0 was used to obtain the geometric mean and geometric SD of SAA in each tissue, and the significant difference results were analyzed according to the previous Dunnett's multiple comparison test method.

Images