Application of SNPs in miR-493 promoter region in Qinchuan cattle body size and meat quality character prediction

Abstract

The invention discloses an application of SNPs (Single Nucleotide Polymorphism) in a miR-493 gene promoter region in prediction of Qinchuan cattle body size and meat quality traits. According to the invention, four SNP (Single Nucleotide Polymorphism) loci positioned in a miR-493 gene promoter region are found to be obviously related to the characters of oblique length and back fat thickness of Qinchuan cattle. Based on the discovery, the Qinchuan cattle body size and meat quality traits can be predicted by detecting the SNPs locus genotype of the miR-493; meanwhile, the invention provides a kit for SNP locus detection and an operation method, and the kit and the operation method can realize rapid detection of beef cattle groups and determination of individual genotypes, can be used for early-stage selection and reservation of calves, can accelerate the breeding process of beef, and can save the production cost.

Description

Technical Field

[0001] The animal of the invention belongs to the technical field of molecular markers, and specifically relates to a SNP molecular marker related to the body size and meat quality traits of Qinchuan cattle, a detection kit and an application thereof. Background Art

[0002] my country has rich local cattle breed resources, but the degree of meat breeding is relatively low compared with foreign specialized beef cattle breeds. Marker assisted selection (MAS) method is one of the necessary means for breeders to carry out efficient breeding of livestock and poultry. In-depth exploration of single nucleotide polymorphism (SNP) marker sites related to livestock and poultry traits has always been a hot topic in livestock and poultry genetics research. DNA marker technology is used to directly select livestock and poultry quantitative trait loci and select individuals with superior genotypes to achieve the purpose of more effectively improving livestock and poultry. The development and application of marker-assisted selection technology overcomes the limitations of traditional breeding methods such as long cycle, poor predictability and low accuracy, shortens the generation interval, improves selection efficiency, and makes rapid directional breeding of new varieties a reality.

[0003] Therefore, screening and developing molecular markers related to the economic traits of Qinchuan cattle and carrying out molecular marker-assisted selection breeding will become an effective means to improve the production performance of Qinchuan cattle, and is of great significance for accelerating the selection and breeding of Qinchuan cattle. Summary of the invention

[0004] In order to solve the problems of long beef cattle breeding cycle and insufficient breeding markers in Qinchuan cattle industry and breeding technology, the present invention provides the application of miR-493 gene promoter region molecular markers and detection primers in Qinchuan cattle body size, meat quality identification and breeding, the sequence of the miR-493 gene promoter molecular marker is shown in SIQ ID NO.1, SIQ ID NO.2, SIQID NO.3 or / and SIQ ID NO.4; wherein:

[0005] The nucleotide sequence shown in SIQ ID NO.1 is located at position g.67691871 of chromosome 21 of Qinchuan cattle, and there is an A / G base mutation. This mutation site is significantly correlated with the height of Qinchuan cattle;

[0006] The nucleotide sequence shown in SIQ ID NO.2 is located at position g.67692006 of chromosome 21 of Qinchuan cattle, and there is a C / T base mutation. This mutation site is significantly correlated with the oblique length, body height and waist horn width of Qinchuan cattle.

[0007] The nucleotide sequence shown in SIQ ID NO.3 is located at position g.67692026 of chromosome 21 of Qinchuan cattle, and there is a T / C base mutation. This mutation site is significantly correlated with the back fat thickness of Qinchuan cattle.

[0008] The nucleotide sequence shown in SIQ ID NO.4 is located at position g.67692044 of chromosome 21 of Qinchuan cattle, and there is an A / G base mutation. This mutation site is significantly correlated with the oblique body length, body height and waist horn width of Qinchuan cattle.

[0009] An optional scheme is that the primers of the present invention are:

[0010] SNP F :5'-GCCCACAGACACCCATCAAG-3';

[0011] SNP R :5'-GAGCTGGCAGTATCCACGAAAT-3'.

[0012] The invention also provides the application of miR-493 gene promoter molecular marker primers in the preparation of Qinchuan cattle body size, meat quality identification and seed selection kits. The corresponding kit contains DNA polymerase, miR-493 gene promoter region molecular marker forward primers and miR-493 gene promoter molecular marker reverse primers.

[0013] The present invention also provides a Qinchuan cattle seed selection and seed preservation method, which comprises the following steps:

[0014] 1) Extracting genomic DNA of the cattle to be selected, detecting and sequencing to determine the genotype of the miR-493 gene promoter molecular marker of the cattle to be selected;

[0015] 2) Select individuals with AA genotype at SNP1 g.67691871A / G, CC genotype at SNP2g.67692006C / T, TT genotype at SNP3 g.67692026T / C, or / and AA genotype at SNP4 g.67692044A / G for breeding. Among them, individuals with AA genotype at SNP1 (rs525652231, A / G), CC genotype at SNP2 (rs521422772, C / T), and AA genotype at SNP4 (rs518556071, A / G) are selected, and these beef cattle individuals have advantages in body height, body oblique length, and waist width; individuals with TT genotype at SNP3 (rs41991252, T / C) are selected, and these beef cattle individuals have advantages in back fat thickness.

[0016] The miR-493 molecular marker associated with the body size and meat quality traits of beef cattle was found by screening the SNPs of the miR-493 gene of Qinchuan cattle, genotyping and analyzing the association with the body size traits and meat quality traits.

[0017] Four SNP molecular markers, SNP (rs521422772, C / T), SNP3 (rs41991252, T / C), and SNP4 (rs518556071, A / G), are significantly correlated with the body size and meat quality traits of Qinchuan cattle. Based on this discovery, the present invention can realize the rapid detection of beef cattle groups and determine the individual genotypes, which can be used for early seed selection and seed preservation, and will greatly accelerate the process of beef cattle breeding. BRIEF DESCRIPTION OF THE DRAWINGS

[0018] Figure 1 The figure is a 1.2% agarose gel electrophoresis diagram of the PCR amplification product containing the SNP site in the promoter region of the Qinchuan cattle miR-493 gene in the example.

[0019] Figure 2 The results are the sequence comparison of PCR amplification products of the four SNP sites in 15 samples to be tested.

[0020] Figure 3 This is the sequencing peak diagram of the four SNP sites of the miR-493 gene of the present invention. DETAILED DESCRIPTION

[0021] Unless otherwise specified, the scientific and technical terms used herein are understood according to the knowledge of ordinary technicians in the relevant fields.

[0022] miRNA is a type of single-stranded small non-coding RNA with a length of about 22 nucleotides (19-25 nt), which is processed from a stem-loop structured transcription precursor. miRNA plays an important post-transcriptional regulatory role during development, and each miRNA may regulate the transcriptional expression of dozens or even hundreds of genes. Therefore, slight changes in miRNA activity may have a great impact on the development of the body system.

[0023] miR-493 is involved in multiple biological processes of the body, such as cell proliferation, mitosis, growth, autophagy and apoptosis. The study found that miR-493 was significantly differentially expressed in the longissimus dorsi muscle of Lantang pigs on the first and 90th day after birth, and miR-493 was related to pig myogenesis; at the same time, miR-493 was involved in the regulation of cattle muscle cell proliferation and differentiation and the regulation of adipogenesis. Further cluster analysis of cattle miR-493 target genes found that the target genes of miR-493 were enriched in signaling pathways such as Cell cycle, P53, MAPK and PI3K / AKT, which are closely related to the growth, development and adipogenesis of beef cattle. In addition, the study found that miR-493 also played an important role in the osteogenic differentiation of bone marrow mesenchymal stem cells. The above studies show that miR-493 is an important candidate functional gene that affects the growth, meat production and fat deposition of livestock and poultry.

[0024] Existing studies have found that the SNP density of precursor miRNA and mature miRNA is lower than that of adjacent flanking regions, and the flanking regions far away from miRNAs have a higher SNP density. 49.5% of the SNP sites (841 / 1700) in flanking regions such as promoter regions can change the secondary structure of the corresponding miRNA from stable to unstable, and most SNPs further affect the expression of target genes. The present invention found 4 SNP molecular marker sites related to the body size and meat quality traits of Qinchuan cattle in the promoter region of miR-493, which can be used for early selection of Qinchuan cattle.

[0025] Embodiment 1:

[0026] 1. Test materials

[0027] 1.1 Experimental animals

[0028] The Qinchuan cattle group, which is a representative of local yellow cattle in my country, was taken as the test object, and blood samples were collected through venous blood collection.

[0029] 1.2 Test reagents

[0030] Agarose (BIOWEST); Blood genome extraction kit (provided by Tiangen Biochemical Technology Co., Ltd.); PCR primers (the following SNP F and SNP R ).

[0031] 1.3 DNA analysis software

[0032] PCR primer design software: Primer Premier 5; sequence analysis software: DNAman, Chromas; data analysis software: IBM SPSS statistics 19.

[0033] 2. Detection of gene polymorphism

[0034] The extraction of genomic DNA was carried out according to the instructions of the blood genomic DNA extraction kit of TIANGEN Company. The quality of genomic DNA was detected by 1.2% agarose gel electrophoresis. The extracted genomic DNA was stored at -20°C for future use.

[0035] Considering that the proportion of the selected SNP haplotypes cannot be too low when detecting Qinchuan cattle related traits through SNP, the present invention randomly selected 15 samples of DNA to detect the gene mutation or gene polymorphism in the promoter region of the miR-493 gene of Qinchuan cattle. Based on the sequencing results of 15 cattle, multiple sequence alignment was performed using DNAman software to obtain the screening and genotype detection results of 4 SNP sites in 15 samples, as shown in Figure 2. Figure 2 shown.

[0036] Primers were designed for the promoter region of the bovine miR-493 gene according to the annotated sequence in the NCBI database (GenBank No.: NC_037348.1). The exon fragments were amplified by PCR and sequenced. SNP1 (rs525652231, A / G; sequence shown in SIQ ID NO.1), SNP2

[0037] Four polymorphic sites, SNP (rs521422772, C / T; sequence shown in SIQ ID NO.2), SNP3 (rs41991252, T / C; sequence shown in SIQ ID NO.3), and SNP4 (rs518556071, A / G; sequence shown in SIQ ID NO.4), such as Figure 3 shown.

[0038] SNP1 (rs525652231, A / G)

[0039] CCCAGCACC[A / G]CACTGGAAGACCAGGCCAGAGGGAGTGAGGCTGCTCGGCGGGATGGAGTGATGGGACAGGAAGACCCACTTCTGGGGATCTAGGGAGCCAGGCTCAGCCACCATTTGTCTCTGACTGTCC CGTGGGGCTTTAGTCCCCCCGTCAGTCACTCTGTTCTCCTCCGTTTTGGAGGAATGTTCTCTGATGGGAGCCCCCGTTTTGCTTAGTGAGTAGTGACCACTTGGTGAAATGGATTCACCGCGAGGAGGCAGGCAA

[0040] SNP2(rs521422772,C / T)

[0041] CCCAGCACCACACTGGAAGACCAGGCCAGAGGGAGTGAGGCTGCTCG

[0042] GCGGGATGGAGTGATGGGACAGGAAGACCCACTTCTGGGGATCTAGG

[0043] GAGCCAGGCTCAGCCACCATTTGTCTCTGACTGTCCCGTGGGGCTTTA

[0044] GT[C / T]CCCCCGTCAGTCACTCTGTTCTCCTCCGTTTTGGAGGAATGTT

[0045] CTCTGATGGGAGCCCCCGTTTTGCTTAGTGAGTAGTGACCACTTGGTG

[0046] AAATGGATTCACCGCGAGGA

[0047] SNP3(rs41991252,T / C)

[0048] CCCAGCACCACACTGGAAGACCAGGCCAGAGGGAGTGAGGCTGCTCG

[0049] GCGGGATGGAGTGATGGGACAGGAAGACCCACTTCTGGGGATCTAGG

[0050] GAGCCAGGCTCAGCCACCATTTGTCTCTGACTGTCCCGTGGGGCTTTA

[0051] GTCCCCCCGTCAGTCACTCTGT[T / C]CTCCTCCGTTTTGGAGGAATGTT

[0052] CTCTGATGGGAGCCCCCGTTTTGCTTAGTGAGTAGTGACCACTTGGTG

[0053] AAATGGATTCACCGCGAGGA

[0054] SNP4(rs518556071,A / G)

[0055] CCCAGCACCACACTGGAAGACCAGGCCAGAGGGAGTGAGGCTGCTCG

[0056] GCGGGATGGAGTGATGGGACAGGAAGACCCACTTCTGGGGATCTAGG

[0057] GAGCCAGGCTCAGCCACCATTTGTCTCTGACTGTCCCGTGGGGCTTTA

[0058] GTCCCCCCGTCAGTCACTCTGTTCTCCTCCGTTTTGGAGG[A / G]ATGTT

[0059] CTCTGATGGGAGCCCCCGTTTTGCTTAGTGAGTAGTGACCACTTGGTG

[0060] AAATGGATTCACCGCGAGGA

[0061] 3. SNPs typing and association analysis of Qinchuan cattle body size and meat quality traits

[0062] The fragments of the above-mentioned sites were amplified using the provided kit primer pairs and reagents (provided by Xi'an Branch of Beijing Qingke Biotechnology Co., Ltd.).

[0063] Primer Pairs:

[0064] SNP F :5'-GCCCACAGACACCCATCAAG-3';

[0065] SNP R :5'-GAGCTGGCAGTATCCACGAAAT-3'

[0066] The reaction system of the PCR kit is as follows:

[0067] Reagent Volume EX Taq 12.5μL <![CDATA[Primer SNP F ]]> 0.3μL <![CDATA[Primer SNP R ]]> 0.3μL Template DNA 0.5μL <![CDATA[ddH2O]]> 11.4μL Total 25.0μL

[0068] PCR reaction conditions: pre-denaturation at 95°C for 2 min; denaturation at 98°C for 10 s, annealing at 58°C for 15 s, extension at 72°C for 20 s, 36 cycles; extension at 72°C for 5 min, and finally storage at 4°C.

[0069] The results of 1.2% agarose gel electrophoresis of the PCR products of Qinchuan cattle miR-493 gene primers are as follows Figure 1 shown.

[0070] The PCR products were sequenced and analyzed, and the genotyping and genetic parameter analysis results of the above four SNP loci in the Qinchuan cattle population are shown in Table 1:

[0071] Table 1 Analysis of genetic parameters related to SNP loci

[0072]

[0073] As can be seen from Table 1, in the Qinchuan cattle population, at the SNP1 (rs525652231, A / G) site, AA is the dominant genotype and A is the dominant allele; at the SNP2 (rs521422772, C / T) site, CC is the dominant genotype and C is the dominant allele; at the SNP3 (rs41991252, T / C) site, TC is the dominant genotype and T is the dominant allele; at the SNP4 (rs518556071, A / G) site, AA is the dominant genotype and A is the dominant allele. The chi-square test showed that SNP2 and 4 were in Hardy-Weinberg equilibrium (P>0.05), and SNP1 and 3 were in Hardy-Weinberg imbalance (P<0.05).

[0074] The results of association analysis between different genotypes and body size traits are shown in Table 2:

[0075] At the SNP1 site in the promoter region of miR-493, the height of individuals with AA genotype was significantly higher than that of individuals with AG and GG genotypes (P<0.05).

[0076] At SNP2 locus, the CC genotype individuals were significantly higher in body length and height than the TT genotype; the CC genotype individuals were significantly higher in waist width than the TC and TT individuals (P<0.01).

[0077] At SNP4, the AA genotype individuals had significantly higher body length than the GG genotype individuals (P<0.05); the AA genotype individuals had significantly higher body height (P<0.05) and waist width (P<0.01) than the AG and GG genotype individuals.

[0078] Table 2 Association analysis between miR-493 promoter region SNPs and body size traits

[0079]

[0080] Note: Data are expressed as mean ± standard error. A, b, different lowercase letters indicate significant differences (P<0.05); A, B different capital letters indicate extremely significant differences (P<0.01).

[0081] In terms of Qinchuan beef quality traits, the back fat thickness trait of individuals with SNP3 TT genotype was significantly higher than that of individuals with CC genotype (P<0.05). However, there were no significant differences in carcass traits of Qinchuan cattle between the genotypes of individuals at other loci, as shown in Table 3:

[0082] Table 3 Association analysis between SNPs in the promoter region of miR-493 and meat quality traits

[0083]

[0084] Note: Same as Table 2

[0085] It should be noted that the above embodiments are preferred examples of the present application, which are only used to illustrate the technical solution of the present invention, so that those skilled in the art can fully understand the present invention, and the present invention is not limited to the above embodiments. On the basis of the technical solution of the present invention, some additions or replacements can be made to the technical features therein, which is obvious to those skilled in the art. Therefore, without departing from the technical solution of the present invention, the additions or replacements made all belong to the scope of protection claimed in the present invention.

[0086]

[0087]

Claims

1. Application of miR-493 gene promoter molecular marker and primers thereof in Qinchuan cattle body size, meat quality identification and seed selection, wherein the sequence of the miR-493 gene promoter molecular marker is shown in SIQ ID NO.1, SIQ ID NO.2, SIQ ID NO.3 or / and SIQ ID NO.4; wherein: The nucleotide sequence shown in SIQ ID NO.1 is located at position g.67691871 of chromosome 21 of Qinchuan cattle, and there is an A / G base mutation. This mutation site is significantly correlated with the height of Qinchuan cattle; The nucleotide sequence shown in SIQ ID NO.2 is located at position g.67692006 of chromosome 21 of Qinchuan cattle, and there is a C / T base mutation. This mutation site is significantly correlated with the oblique length, body height and waist horn width of Qinchuan cattle. The nucleotide sequence shown in SIQ ID NO.3 is located at position g.67692026 of chromosome 21 of Qinchuan cattle, and there is a T / C base mutation. This mutation site is significantly correlated with the back fat thickness of Qinchuan cattle. The nucleotide sequence shown in SIQ ID NO.4 is located at position g.67692044 of chromosome 21 of Qinchuan cattle, and there is an A / G base mutation. This mutation site is significantly correlated with the oblique body length, body height and waist horn width of Qinchuan cattle.

2. The use according to claim 1, characterized in that: The primers are: SNP F :5’-GCCCACAGACACCCATCAAG-3’; SNP R :5’-GAGCTGGCAGTATCCACGAAAT-3’。 3. Application of miR-493 gene promoter molecular marker primers in the preparation of Qinchuan cattle body size, meat quality identification and breeding selection kits.

4. A kit for identifying the body size and meat quality of Qinchuan cattle and selecting the same, characterized in that: The kit contains DNA polymerase, a miR-493 gene promoter molecule marker forward primer and a miR-493 gene promoter molecule marker reverse primer.

5. A Qinchuan cattle seed selection and seed preservation method, characterized in that: The method comprises the following steps: 1) Extracting genomic DNA of the cattle to be selected, detecting and sequencing to determine the genotype of the miR-493 gene promoter molecular marker of the cattle to be selected; 2) Select individuals with AA genotype at g.67691871A / G site, CC genotype at g.67692006C / T site, TT genotype at g.67692026T / C site and AA genotype at g.67692044A / G site of miR-493 gene for seed preservation.

Images