A SNP molecular marker associated with the total teat number trait in pigs and its application
By identifying SNP molecular markers on pig chromosome 2 and designing specific primers, the problem of unclear association between the total nipple number trait and genes in pigs was solved, efficient screening and breeding were achieved, and the reproductive performance of sows and the survival rate of piglets were improved.
Patent Information
- Application Number
- CN202411667684.0
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-11-21
- Publication Date
- 2025-09-26
- Estimated Expiration
- 2044-11-21
AI Technical Summary
In the existing technology, the relationship between the total nipple number trait of pigs and genes is unclear, making it difficult to improve the sow's lactation ability and piglet survival rate through molecular marker-assisted selection.
A single-nucleotide polymorphism (SNP) molecular marker associated with the total teat number trait was identified on chromosome 2 of pigs through genome-wide association study (GWAS). Specific primers were designed for PCR amplification, and the polymorphic site was detected using Tetra primer ARMS PCR technology to screen sows with a high teat number.
It has realized a reliable detection method for early selection of sows with high nipple numbers, improved breeding efficiency, provided effective molecular markers for genetic improvement of pigs, and significantly improved the reproductive performance of sows and the survival rate of piglets.
Smart Images

Figure SMS_2 
Figure SMS_3 
Figure HDA0005145010720000011
Abstract
Description
Technical Field
[0001] The invention belongs to the field of biotechnology, and in particular relates to a SNP molecular marker on pig chromosome 2 related to the total nipple number trait and an application thereof. Background Art
[0002] The total number of teats in pigs is an indicator of a sow's lactation ability and a key reproductive trait, directly impacting the reproductive efficiency and economic benefits of a pig herd. The total number of teats a sow has is directly related to the number of piglets that survive during lactation, thereby affecting their survival rate and growth and development. The total number of teats is strongly correlated with the reproductive performance of sows and the growth performance of their offspring: the greater the total number of teats, the higher the sow's lactation ability and piglet survival rate. Therefore, studying and improving the total number of teats in pigs has important research and practical significance for improving reproductive efficiency and economic benefits. Molecular marker-assisted selection is an effective method for improving the total number of teats in pigs, but the specific genes associated with the total number of teats in pigs and the specific relationship between them remain unclear.
[0003] This study, based on a high-generation crossbreeding population of Large White and Tongcheng pigs developed by the applicant's research group, identified a single-nucleotide polymorphism (SNP) on chromosome 2 that influences the total nipple number trait by resequencing whole-genome genetic variation and conducting a genome-wide association study (GWAS) for the total nipple number trait. These findings have not yet been reported. TTC17 gene expression is negatively correlated with breast cancer, and its absence or low expression is a key factor in promoting breast cancer metastasis (Zhang et al., 2023). Therefore, the SNP marker-assisted selection method of this invention has potential value for improving pig reproductive traits. Summary of the Invention
[0004] The purpose of the present invention is to provide a SNP molecular marker related to the total nipple number trait of pigs and its application.
[0005] To achieve the above object, the present invention adopts the following technical solutions:
[0006] A SNP molecular marker associated with the total teat number trait of pigs. The SNP molecular markers are located at bases 18782565 on chromosome 2 of the pig genome version 11.1 reference sequence. The bases 18782565 are A or T, and the mutation causes polymorphism.
[0007] Furthermore, the nucleotide sequence of the molecular marker is as shown in SEQ ID NO. 1, wherein W at the 501st bp is A or T, and the mutation results in the A / T polymorphism of the molecular marker.
[0008] As described above, in the application of SNP molecular markers in sow assisted breeding, individuals with AA or TA genotypes at the polymorphic sites have significantly higher total nipple numbers than individuals with TT genotypes.
[0009] A primer for detecting the SNP molecular marker associated with the total teat number trait of pigs as described above, the nucleotide sequence of the primer is shown in SEQ ID NO. 2-5.
[0010] A kit for detecting the SNP molecular marker associated with the total teat number trait of pigs as described above, comprising primers having nucleotide sequences as shown in SEQ ID NO. 2-5.
[0011] A method for detecting the SNP molecular marker associated with the total nipple number trait of pigs as described above comprises the following steps:
[0012] 1) PCR amplification of sow genomic DNA using the primers shown in SEQ ID NO. 2-5;
[0013] 2) Typing and identifying the polymorphic sites of the amplified product obtained in step 1).
[0014] In the method as described above, preferably, in step 1), the sow genomic DNA can be extracted from sow blood DNA or sow ear tissue DNA.
[0015] According to the above method, preferably, in step 2), when three bands of 744 bp, 499 bp and 299 bp appear in the amplified product, the genotype of the sow is determined to be AT type;
[0016] When two bands of 744 bp and 499 bp appeared in the amplified product, the genotype of the sow was determined to be AA;
[0017] When two bands of 744 bp and 299 bp appeared in the amplified product, the genotype of the sow was determined to be TT type.
[0018] The primers, kits or methods for detecting SNP molecular markers associated with the total nipple number trait of pigs as described above are used in sow assisted breeding to select sow breeds with a larger number of nipples; when the genotype of the polymorphic site is AA or TA, the total nipple number of the sow is significantly higher than that of the TT type.
[0019] The beneficial effects of the present invention are:
[0020] The present invention provides a SNP molecular marker associated with the total teat number trait in pigs. The polymorphism at this site significantly affects the total teat number trait in pigs. By determining the genotype of this polymorphism, it is possible to effectively identify breeds with high reproductive potential, providing a detection technology for early breeding and improving breeding efficiency. The present invention also provides a reliable molecular marker detection method for the genetic improvement of pig reproductive traits, which is of great significance to the genetic improvement of pigs. BRIEF DESCRIPTION OF THE DRAWINGS
[0021] Figure 1 This is the Manhattan plot of the GWAS results for the total number of papillae in Example 1 of the invention.
[0022] Figure 2 This is the significance analysis of the phenotypic values corresponding to different genotypes of SNP sites in the present invention; * is significantly correlated (p < 0.05), **** is extremely significantly correlated (p < 0.0001), and N represents the sample size.
[0023] Figure 3 The figure is an agarose gel electrophoresis pattern of the PCR product of the Tetra primer ARMS PCR amplification of rs340400902 of the porcine TTC17 gene in the present invention, wherein lane M is a DNA molecular weight marker (DL2000), lanes 1-3: TT; lanes 4-6: AT; lanes 7-9: AA; lane 10: water control. DETAILED DESCRIPTION
[0024] The present invention is based on a high-generation cross-bred resource population constructed by the applicant's research team using Large White pigs and Tongcheng pigs. By measuring and recording the total nipple number and combining the SNP typing data obtained by whole-genome sequencing, a genome-wide association study (GWAS) related to the total nipple number was carried out. Subsequently, the GWAS results were deeply analyzed and two SNP molecular markers significantly correlated with the total nipple number were identified. The SNP molecular markers can be used for marker-assisted selection of the total nipple number, thereby screening in the early stages of breeding and improving breeding efficiency. This invention provides a reliable molecular marker detection method for the genetic improvement of the total nipple number.
[0025] The following examples are used to further illustrate the present invention, but should not be construed as limiting the present invention. Without departing from the spirit and substance of the present invention, modifications or substitutions made to the present invention all fall within the scope of the present invention.
[0026] Unless otherwise specified, the technical means used in the examples are conventional means well known to those skilled in the art. Unless otherwise specified, all reagents used in the present methods are of analytical grade or above.
[0027] Example 1 Obtaining the gene affecting the total number of pig nipples SNP site
[0028] 1. Experimental population
[0029] The high-generation crossbreeding group of Large White pigs and Tongcheng pigs was used as the research object. Individual measurements were collected from Yunzhi Pig Farm in Tongcheng County (277 pigs) and the boutique pig farm of Huazhong Agricultural University (611 pigs). The phenotypic data of the total nipple number of all individuals were collected and recorded, and ear tissue samples were collected.
[0030] 2. Test methods
[0031] 2.1 DNA Extraction
[0032] The DNA of ear tissues of relevant populations is extracted using the DNA phenol-chloroform crude extraction method (the phenol-chloroform crude extraction method can be found in Sambrook J, Fritsch EF, Maniatis T. Molecular Cloning Laboratory Guide [M]. 2nd edition. Jin Dongyan, Li Mengfeng. Beijing: Science Press, 1999. 465-467) or other recognized extraction methods with the same effectiveness. These methods are all commonly reported methods.
[0033] 3. Genome-wide association analysis
[0034] GWAS analysis of the total nipple number trait was performed based on the mixed linear model of GEMMA software.
[0035] The analysis model is as follows:
[0036] Y=Wα+Xβ+u+ε
[0037] Where Y is the phenotypic value of the trait; W and X are the corresponding association matrices; α represents the fixed effect, including sex and the first three principal components (PCA); β represents the additive effect of genetic markers (SNPs); u represents the random polygenic effect, where u~N(0, Gσ g 2 ), where G is the genomic kinship matrix between individuals estimated using GEMMA, σ g 2 is the variance of the polygenic additive effect; ε is the vector of random residual effects, which is distributed as ε~N(0, Iσ ε 2 ), where I is the identity matrix, σ ε 2 is the residual variance.
[0038] GWAS results such as Figure 1The results showed that the SNP sites significantly associated with the total nipple number were mainly located on chromosomes 2 and 7. Further analysis of the significantly associated SNP sites revealed that the specific nucleotide sequence of position 2:18782565 (A>T) on chromosome 2, as shown in SEQ ID NO. 1, where W at base 501 is A or T, showed a significant correlation between the polymorphism of this nucleotide and the total nipple number (based on the porcine genome version 11.1 reference sequence). The results are shown in Table 1.
[0039] Table 1 Statistical analysis of TTC17 gene rs340400902 genotype and total papilla number phenotype
[0040]
[0041]
[0042] Note: The values in the table are "mean ± standard deviation". Different lowercase letters in the same row indicate extremely significant differences (P<0.0001), and the same letters indicate no significant differences.
[0043] SEQ ID NO.1:GGGGTGGGGGACGTCATCTAGGGGATTTAAGGAG。
[0044] In this study, 794 individuals with the AA, 75 with the TA, and 19 with the TT variants of the TTC17 gene were found. The results showed that individuals with the AA genotype of the TTC17 gene had significantly more total teats than those with the TT genotype. Therefore, the AA genotype can be used as a basis for breeding selection. Utilizing this SNP locus allows for marker-assisted selection for the total teat number trait, thereby improving the efficiency of early breeding and providing a reliable detection method for genetic improvement of the total teat number trait in pigs.
[0045] Example 2 Establishment of a polymorphism detection method for molecular markers associated with the total teat number trait of pigs
[0046] 1. Primer design
[0047] Tetraprimer ARMS PCR primers were designed using the online Tetraprimer ARMS PCR primer design program (http: / / cedar.genetics.soton.ac.uk / public_html / primer1.html) based on the flanking 500 bp sequence information of the candidate SNP locus in the Ensembl database (SNP number: Ensembl genome browser database rs340400902; reference genome: Sscrofa11.1, mutation position: 2:18782565, allele: , gene name: TTC17). Multiple primer sets were designed, with product fragment size controlled to be between 150 and 800 bp. For each SNP locus, two inner primers with 3′ ends that paired with the two alleles of the SNP and extended in opposite directions, and two outer primers extending in opposite directions, were designed. Primer length should be kept between 20 and 30 bp. Primers that are too short will reduce their specificity. At the same time, an artificial mismatch was introduced at the third base from the 3′ end of the inner primer to increase amplification specificity. Primers with mismatches at this position have the highest specificity. Because this method involves adding four primers simultaneously to the same PCR reaction tube, the concentration and ratio of inner and outer primers are crucial for optimizing the Tetra Primer ARMS PCR reaction system. Multiple optimizations are required to find the optimal ratio, ensuring bright amplified bands and accurate differentiation between genotypes while avoiding false positives and nonspecific amplification. The final optimized primer information is shown in Table 2. Primer synthesis was performed by Wuhan Qingke Biotechnology Co., Ltd.
[0048] Table 2 Primer sequence information
[0049]
[0050] 2. Tetra primer ARMS PCR amplification
[0051] DNA template
[0052] According to the results of whole-genome DNA sequencing, genomic DNA of three individuals for each genotype at the SNP site was selected as DNA templates.
[0053] 2.1. Tetra primer ARMS PCR amplification of rs340400902
[0054] The PCR reaction system (20 μL) consisted of 10.0 μL of 2× Taq Master Mix, 0.2 μL of each of the two outer primers (10 μM), 0.6 μL of each of the two inner primers (10 μM), 1.0 μL of DNA template (50 ng / μL), and 7.4 μL of ddH2O. The PCR reaction program was as follows: 95°C pre-denaturation for 5 min, 95°C denaturation for 30 s, annealing (annealing temperature see Table 3) for 30 s, and extension at 72°C for 30 s, for a total of 27 cycles; 72°C extension for 5 min, and storage at 4°C. A 5 μL aliquot of the PCR product was mixed with 3 μL of loading buffer and separated by 2% agarose gel electrophoresis. The gel was imaged and visualized using a gel imaging system. Amplified products were detected by 2% agarose gel electrophoresis and visualized using a gel imaging system. Genotypes were distinguished based on the size of the amplified fragment and the number of bands.
[0055] 2.2. Tetra primer ARMS PCR amplification of rs340400902
[0056] The PCR reaction system (20 μL) consisted of 10.0 μL of 2× Taq Master Mix, 0.2 μL of each of the two outer primers (10 μM), 0.2 μL of each of the two inner primers (10 μM), 1.0 μL of DNA template (50 ng / μL), and 8.2 μL of ddH₂O. The PCR reaction protocol was as follows: 95°C pre-denaturation for 5 min, followed by 29 cycles of denaturation at 95°C for 30 s, annealing (annealing temperature see Table 2) for 30 s, and extension at 72°C for 30 s; then extension at 72°C for 5 min and storage at 4°C. A 5 μL aliquot of the PCR product was mixed with 3 μL of loading buffer and separated by 2% agarose gel electrophoresis. The gel was imaged and visualized using a gel imaging system. Amplified products were detected by 2% agarose gel electrophoresis and visualized using a gel imaging system. Genotypes were distinguished based on the size of the amplified fragment and the number of bands.
[0057] 3.1 Results
[0058] The Tetra Primer ARMS PCR amplification system includes one outer primer pair and one inner primer pair. The outer primer pair (SEQ ID NOs. 2-3) amplifies the target fragment as a positive reference, and its amplified fragment is the largest (744 bp). The letter R at position 501 in SEQ ID NO. 1 indicates an A or T allele mutation in rs340400902. The inner primers specifically bind to the mutant site A (SEQ ID NO. 4) and the wild-type site T (SEQ ID NO. 5), respectively. SEQ ID NO. 4 and outer primer SEQ ID NO. 3 amplify a target band of 499 bp, while SEQ ID NO. 5 and outer primer SEQ ID NO. 2 amplify a target band of 299 bp. The size and presence of electrophoretic bands can be used to determine whether the mutation has occurred and the individual's genotype.
[0059] Method for determining the results of the rs340400902 SNP site polymorphism detection:
[0060] If three amplified fragments are present, namely the amplified bands of the outer primer pair (SEQ ID NOs. 2 and 3), the inner primer SEQ ID NO. 5 and the outer primer SEQ ID NO. 4, and the inner primer SEQ ID NO. 4 and the outer primer SEQ ID NO. 3, and their sizes are consistent with the expected fragment size (744 bp + 499 bp + 299 bp), the individual's genotype is determined to be heterozygous AT;
[0061] If two amplified fragments are detected, namely the amplified bands of the outer primer pair (SEQ ID NOs. 2 and 3), the inner primer SEQ ID NO. 4, and the outer primer SEQ ID NO. 3, and their sizes are consistent with the expected fragment size (744 + 499 bp), the individual's genotype is determined to be homozygous AA;
[0062] If there are two amplified fragments, namely the amplified bands of the outer primer pair (SEQ ID NO.2-3), the inner primer SEQ ID NO.5 and the outer primer SEQ ID NO.2, and their sizes are consistent with the expected fragment size (744+299 bp), the individual genotype is determined to be homozygous TT.
[0063] For the DNA extracted from the three genotype pig ear tissue samples (three samples for each), nine DNA samples were tested according to the amplification system and PCR reaction procedure for PCR amplification of the target fragment described above.
[0064] For the electrophoresis test results of rs340400902, Figure 3As shown, band M is a 2000 marker, with labels 1-3 for the TT genotype, 4-6 for the AA genotype, 7-9 for the AT genotype, and 10 for the water control. The test results were consistent with expectations. Thus, the primer pair SEQ ID NOs. 2-5 provided above can be used to identify the genotype of nucleotide position 501 in the sequence of SEQ ID NO. 1, thereby screening sows with a high total teat number and selecting sows homozygous for the AA genotype for breeding.
[0065] Compared with the existing technology, the present invention discovered for the first time a SNP molecular marker in the pig TTC17 gene that is related to the total teat number trait of pigs, and used it to screen and breed for the improvement of the total teat number trait of pigs; and the present invention uses Tetraprimer ARMS PCR technology to simultaneously detect multiple genotypes (TT, AA, AT) in a single PCR reaction, which is not only simple to operate and low in cost, but also has high specificity and accuracy.
Claims
1. Application of a SNP molecular marker associated with the total nipple number trait in sow assisted breeding, characterized in that: The nucleotide sequence of the SNP molecular marker is as shown in SEQ ID NO.1, wherein W at the 501st bp is A or T. This mutation causes the A / T polymorphism of the SNP molecular marker. When the genotype of the polymorphic site is AA or TA, the total number of teats of the sows is significantly higher than that of the individuals with the genotype of TT.
2. A primer for detecting SNP molecular markers associated with the total nipple number trait in pig assisted breeding, characterized in that: The nucleotide sequences of the primers are shown in SEQ ID NO. 2-5; The nucleotide sequence of the SNP molecular marker is as shown in SEQ ID NO.1, wherein W at the 501st bp is A or T. This mutation causes the A / T polymorphism of the SNP molecular marker. When the genotype of the polymorphic site is AA or TA, the total number of teats of the sows is significantly higher than that of the individuals with the genotype of TT.
3. A kit for detecting SNP molecular markers associated with the total nipple number trait in pig assisted breeding, characterized in that: The kit includes primers with nucleotide sequences as shown in SEQ ID NO.2-5, and the nucleotide sequence of the SNP molecular marker is as shown in SEQ ID NO.1, wherein W at the 501st bp is A or T, and the mutation causes the A / T polymorphism of the SNP molecular marker. When the genotype of the polymorphic site is AA or TA, the total number of teats of the sow is significantly higher than that of the individual with the genotype of TT.
4. A method for detecting SNP molecular markers associated with the total nipple number trait of pigs in sow assisted breeding, characterized in that: It includes the following steps: 1) PCR amplification of sow genomic DNA using the primers shown in SEQ ID NO. 2-5; 2) typing and identifying the polymorphic sites of the amplified product obtained in step 1); In step 2), when three bands of 744 bp, 499 bp, and 299 bp appear in the amplified product, the genotype of the sow is determined to be AT; When two bands of 744 bp and 499 bp appeared in the amplified product, the genotype of the sow was determined to be AA; When two bands of 744 bp and 299 bp appeared in the amplified product, the genotype of the sow was determined to be TT type; The nucleotide sequence of the SNP molecular marker is as shown in SEQ ID NO.1, wherein W at the 501st bp is A or T. This mutation causes the A / T polymorphism of the SNP molecular marker. When the genotype of the polymorphic site is AA or TA, the total number of teats of the sows is significantly higher than that of the individuals with the genotype of TT.
5. The use according to claim 4, characterized in that In step 1), the sow genomic DNA can be extracted from the sow's blood DNA or the sow's ear tissue DNA.
Citation Information
Patent Citations
Molecular marker influencing porcine effective total nipple number character and application of molecular marker
CN107365853A
Molecular marker related to total teat number of pig and application
CN110484636A