CRISPR (clustered regularly interspaced short palindromic repeats) interference therapy for C9ORF72 repetitive sequence amplification diseases

Abstract

Provided are guide RNAs and CRISPR / Cas systems that target the C9orf72 gene, lipid nanoparticles or viral vectors comprising such CRISPR / Cas systems, and cells or animals comprising such CRISPR / Cas systems. The invention also provides a method for inhibiting transcription of a transcription start site of a C9orf72 exon 1A and / or inhibiting transcription of a sense and / or antisense transcript containing a hexanucleotide repeat amplification sequence in a C9orf72 gene by using the CRISPR / Cas system, and also provides a method for inhibiting transcription of the C9orf72 exon 1A transcription start site and / or inhibiting transcription of a sense and / or antisense transcript containing the hexanucleotide repeat amplification sequence in the C9orf72 gene. And the use of the CRISPR / Cas system in prophylactic and therapeutic applications for the treatment and / or prevention of diseases associated with amplification of C9orf72 hexanucleotide repeats and / or for ameliorating at least one symptom associated with such diseases.

Description

[0001] CROSS-REFERENCE TO RELATED APPLICATIONS

[0002] This application claims the benefit of U.S. Application No. 63 / 365,558, filed May 31, 2022, which is incorporated herein by reference in its entirety for all purposes.

[0003] Reference to sequence listings submitted as XML files via EFS WEB

[0004] The sequence listing written into file 057766-596446.xml is 180 kilobytes, created on May 30, 2023, and is hereby incorporated by reference. Background Art

[0005] Amyotrophic lateral sclerosis (ALS) and frontotemporal lobar degeneration (FTLD) are progressive and fatal neurodegenerative diseases that cause motor neuron disease in the case of ALS and dementia in the case of FTLD. The most common cause of familial ALS is the expansion of the GGGGCC (G4C2) hexanucleotide repeat sequence between two alternative 5' non-coding exons of the C9orf72 gene. Normal individuals have 3 to 35 G4C2 repeats, while patients with ALS or FTLD have hundreds or thousands of repeats. The physiological function of the C9orf72 protein is not well understood, and no disease-causing mutations have been identified in its coding sequence. There is currently no effective treatment. Summary of the invention

[0006] Provided are guide RNA and CRISPR / Cas systems targeting the C9orf72 gene, lipid nanoparticles or viral vectors comprising such CRISPR / Cas systems, and cells or animals comprising such CRISPR / Cas systems. Also provided are methods for inhibiting transcription of the C9orf72 exon 1A transcription start site and / or inhibiting transcription of sense and / or antisense transcripts comprising a hexanucleotide repeat sequence expansion sequence in the C9orf72 gene, and uses of the CRISPR / Cas system in preventive and therapeutic applications for treating and / or preventing diseases associated with C9orf72 hexanucleotide repeat sequence expansion and / or for ameliorating at least one symptom associated with such diseases.

[0007] In one aspect, methods are provided for inhibiting transcription of a C9orf72 exon 1A transcription start site or inhibiting transcription of a sense or antisense transcript comprising a hexanucleotide repeat expansion sequence in a C9orf72 gene in a cell. Some such methods comprise contacting the C9orf72 gene with a first CRISPR / Cas complex comprising a nuclease-inactive Cas protein and a first guide RNA comprising a first DNA targeting segment that targets a first guide RNA target sequence upstream or near the C9orf72 exon 1A transcription start site, wherein the first CRISPR / Cas complex binds to the first guide RNA target sequence. Some such methods comprise contacting the C9orf72 gene with a second CRISPR / Cas complex comprising a nuclease-inactive Cas protein and a second guide RNA comprising a second DNA targeting segment that targets a second guide RNA target sequence within a C9orf72 hexanucleotide repeat expansion sequence between a first noncoding endogenous exon and exon 2 of the C9orf72 gene, wherein the second CRISPR / Cas complex binds to the second guide RNA target sequence. Some such methods include: (a) contacting a C9orf72 gene with a first CRISPR / Cas complex comprising a nuclease-inactive Cas protein and a first guide RNA comprising a first DNA targeting segment that targets a first guide RNA target sequence upstream or near the C9orf72 exon 1A transcription start site, wherein the first CRISPR / Cas complex binds to the first guide RNA target sequence; and / or (b) contacting a C9orf72 gene with a second CRISPR / Cas complex comprising a nuclease-inactive Cas protein and a second guide RNA comprising a second DNA targeting segment that targets a second guide RNA target sequence within a C9orf72 hexanucleotide repeat expansion sequence between a first non-coding endogenous exon and exon 2 of the C9orf72 gene, wherein the second CRISPR / Cas complex binds to the first guide RNA target sequence. In some such methods, the method includes option (a). In some such methods, the method includes option (b). In some such methods, the method includes option (a) and option (b).

[0008] In some such methods, option (a) comprises contacting the C9orf72 gene with at least two CRISPR / Cas complexes, wherein each CRISPR / Cas complex comprises a nuclease-inactive Cas protein and a different guide RNA, wherein each different guide RNA targets a different guide RNA target sequence upstream or near the C9orf72 exon 1A transcription start site, and / or wherein option (b) comprises contacting the C9orf72 gene with at least two CRISPR / Cas complexes, wherein each CRISPR / Cas complex comprises a nuclease-inactive Cas protein and a different guide RNA, wherein each different guide RNA targets a different guide RNA target sequence within the C9orf72 hexanucleotide repeat expansion sequence between the first non-coding endogenous exon and exon 2 of the C9orf72 gene. In some such methods, option (a) comprises contacting the C9orf72 gene with at least three CRISPR / Cas complexes, wherein each CRISPR / Cas complex comprises a nuclease-inactive Cas protein and a different guide RNA, wherein each different guide RNA targets a different guide RNA target sequence upstream or near the C9orf72 exon 1A transcription start site, and / or wherein option (b) comprises contacting the C9orf72 gene with at least three CRISPR / Cas complexes, wherein each CRISPR / Cas complex comprises a nuclease-inactive Cas protein and a different guide RNA, wherein each different guide RNA targets a different guide RNA target sequence within the C9orf72 hexanucleotide repeat expansion sequence between the first non-coding endogenous exon and exon 2 of the C9orf72 gene.

[0009] In some such methods, the C9orf72 hexanucleotide repeat expansion sequence has greater than 30, greater than 100, greater than 200, greater than 300, greater than 400, or greater than 500 repeats of the hexanucleotide sequence G4C2.

[0010] In some such methods, the first guide RNA target sequence is within 250 nucleotides, within 225 nucleotides, within 200 nucleotides, within 175 nucleotides, within 150 nucleotides, within 125 nucleotides, within 100 nucleotides, within 75 nucleotides, or within 50 nucleotides of the C9orf72 exon 1A transcription start site. In some such methods, the first guide RNA target sequence is within 100 nucleotides, within 75 nucleotides, or within 50 nucleotides of the C9orf72 exon 1A transcription start site.

[0011] In some such methods, the nuclease-inactive Cas protein is not fused to the heterologous transcriptional repressor domain, and the guide RNA is not linked to the heterologous transcriptional repressor domain.

[0012] In some such methods, the combination reduces or eliminates the expression of transcripts that start at C9orf72 exon 1A. In some such methods, the combination reduces or eliminates the expression of transcripts that start at C9orf72 exon 1A, but does not reduce or eliminate the expression of transcripts that start at C9orf72 exon 1B. In some such methods, the combination reduces or eliminates the expression of transcripts containing C9orf72 hexanucleotide repeats. In some such methods, the combination reduces or eliminates the expression of transcripts containing C9orf72 hexanucleotide repeats, but does not reduce or eliminate the expression of transcripts that start at C9orf72 exon 1B. In some such methods, the combination reduces or eliminates the expression of both sense and antisense transcripts containing C9orf72 hexanucleotide repeats. In some such methods, the combination reduces or eliminates the expression of both sense and antisense transcripts containing C9orf72 hexanucleotide repeats, but does not reduce or eliminate the expression of transcripts that start at C9orf72 exon 1B.

[0013] In some such methods, the method comprises: (a) introducing into the cell a nuclease-inactive Cas protein or a nucleic acid encoding a nuclease-inactive Cas protein and a first guide RNA or one or more DNAs encoding the first guide RNA; and / or (b) introducing into the cell a nuclease-inactive Cas protein or a nucleic acid encoding a nuclease-inactive Cas protein and a second guide RNA or one or more DNAs encoding the second guide RNA.

[0014] In some such methods, the first guide RNA is a single guide RNA (sgRNA). In some such methods, the nuclease inactive Cas protein is a nuclease inactive Cas9 protein. In some such methods, the nuclease inactive Cas9 protein is derived from Streptococcus pyogenes Cas9 protein, Staphylococcus aureus Cas9 protein, Campylobacter jejuni Cas9 protein, Streptococcus thermophilus Cas9 protein or Neisseria meningitidis Cas9 protein. In some such methods, the nuclease inactive Cas protein is derived from Streptococcus pyogenes Cas9 protein. In some such methods, the nucleic acid encoding the nuclease inactive Cas protein is codon optimized to be expressed in mammalian cells or human cells. In some such methods, the method comprises: (a) introducing a first guide RNA in the form of RNA, optionally wherein the first guide RNA comprises at least one modification; and / or (b) introducing a second guide RNA in the form of RNA, optionally wherein the second guide RNA comprises at least one modification. In some such methods, at least one modification comprises 2'-O-methyl modified nucleotides and / or phosphorothioate bonds between nucleotides. In some such methods, the method comprises introducing a nucleic acid encoding a nuclease-inactive Cas protein, wherein the nucleic acid comprises an mRNA encoding a nuclease-inactive Cas protein, optionally wherein the mRNA encoding the nuclease-inactive Cas protein comprises at least one modification. In some such methods, the method comprises: (a) introducing a nucleic acid encoding a nuclease-inactive Cas protein and one or more DNAs encoding a first guide RNA, wherein the nucleic acid encoding a nuclease-inactive Cas protein comprises DNA; and / or (b) introducing a nucleic acid encoding a nuclease-inactive Cas protein and one or more DNAs encoding a second guide RNA, wherein the nucleic acid encoding a nuclease-inactive Cas protein comprises DNA. In some such methods, (a) DNA encoding a nuclease-inactive Cas protein and one or more DNA encoding a first guide RNA are in one or more vectors; and / or (b) DNA encoding a nuclease-inactive Cas protein and one or more DNA encoding a second guide RNA are in one or more vectors. In some such methods, the one or more vectors are one or more viral vectors. In some such methods, the one or more viral vectors are one or more adeno-associated virus (AAV) vectors.In some such methods, (a) a nuclease-inactive Cas protein or a nucleic acid encoding a nuclease-inactive Cas protein and a first guide RNA or one or more DNAs encoding a first guide RNA are associated with a lipid nanoparticle; and / or (b) a nuclease-inactive Cas protein or a nucleic acid encoding a nuclease-inactive Cas protein and a second guide RNA or one or more DNAs encoding a second guide RNA are associated with a lipid nanoparticle.

[0015] In some such methods, the first DNA targeting segment comprises at least 17, at least 18, at least 19, or at least 20 consecutive nucleotides of the sequence set forth in any one of SEQ ID NOs: 72-111 and 113. In some such methods, the first DNA targeting segment is at least 90% or at least 95% identical to the sequence set forth in any one of SEQ ID NOs: 72-111 and 113. In some such methods, the first guide RNA target sequence comprises at least 17, at least 18, at least 19, or at least 20 consecutive nucleotides of the sequence set forth in any one of SEQ ID NOs: 32-71 and 112. In some such methods, the first DNA targeting segment comprises at least 17, at least 18, at least 19, or at least 20 consecutive nucleotides of the sequence set forth in any one of SEQ ID NOs: 93-95. In some such methods, the first DNA targeting segment is at least 90% or at least 95% identical to the sequence set forth in any one of SEQ ID NOs: 93-95. In some such methods, the first guide RNA target sequence comprises at least 17, at least 18, at least 19, or at least 20 consecutive nucleotides of the sequence set forth in any one of SEQ ID NOs: 53-55. In some such methods, the first DNA targeting segment comprises at least 17, at least 18, at least 19, or at least 20 consecutive nucleotides of the sequence set forth in SEQ ID NOs: 74. In some such methods, the first DNA targeting segment is at least 90% or at least 95% identical to the sequence set forth in SEQ ID NO: 74. In some such methods, the first guide RNA target sequence comprises at least 17, at least 18, at least 19, or at least 20 consecutive nucleotides of the sequence set forth in SEQ ID NOs: 34. In some such methods, the second DNA targeting segment comprises at least 17, at least 18, at least 19, or at least 20 consecutive nucleotides of the sequence set forth in any one of SEQ ID NOs: 118-121. In some such methods, the second DNA targeting segment is at least 90% or at least 95% identical to the sequence set forth in any one of SEQ ID NOs: 118-121. In some such methods, the second guide RNA target sequence comprises at least 17, at least 18, at least 19, or at least 20 consecutive nucleotides of the sequence set forth in any one of SEQ ID NOs: 114-117. In some such methods, the second DNA targeting segment comprises at least 17, at least 18, at least 19, or at least 20 consecutive nucleotides of the sequence set forth in SEQ ID NO: 74. In some such methods, the second DNA targeting segment is at least 90% or at least 95% identical to the sequence set forth in SEQ ID NO: 74.In some such methods, the second guide RNA target sequence comprises at least 17, at least 18, at least 19, or at least 20 consecutive nucleotides of the sequence set forth in SEQ ID NO:34.

[0016] In some such methods, the cell is a neuron, optionally wherein the neuron is a motor neuron. In some such methods, the cell is in vitro or ex vivo. In some such methods, the cell is in a subject, optionally wherein the subject is a human. In some such methods, the cell is a neuron in the subject's brain. In some such methods, the subject suffers from a C9orf72 hexanucleotide repeat expansion-related disease or is at risk of developing the disease. In some such methods, the C9orf72 hexanucleotide repeat expansion-related disease is amyotrophic lateral sclerosis (ALS) or frontotemporal dementia (FTD). In some such methods, (a) a nuclease-inactive Cas protein or a nucleic acid encoding a nuclease-inactive Cas protein and a first guide RNA or one or more DNAs encoding a first guide RNA are administered to the subject by intraventricular injection, intracranial injection, or intrathecal injection; and / or (b) a nuclease-inactive Cas protein or a nucleic acid encoding a nuclease-inactive Cas protein and a second guide RNA or one or more DNAs encoding a second guide RNA are administered to the subject by intraventricular injection, intracranial injection, or intrathecal injection. In some such methods, the cell is a mammalian cell and the C9orf72 gene is a mammalian C9orf72 gene. In some such methods, the cell is a human cell. In some such methods, the cell is a mouse cell. In some such methods, the C9orf72 gene comprises a human C9orf72 promoter. In some such methods, the C9orf72 gene is a human C9orf72 gene or a humanized C9orf72 gene.

[0017] In another aspect, methods are provided for inhibiting transcription of a C9orf72 exon 1A transcription start site or inhibiting transcription of a sense or antisense transcript comprising a hexanucleotide repeat expansion sequence in a C9orf72 gene in a subject. Some such methods include: (a) administering to a subject a nuclease-inactive Cas protein or a nucleic acid encoding a nuclease-inactive Cas protein and a first guide RNA or one or more DNAs encoding the first guide RNA, wherein the first guide RNA comprises a first DNA targeting segment that targets a first guide RNA target sequence upstream or near the transcription start site of exon 1A of C9orf72, wherein the first guide RNA and the nuclease-inactive Cas protein form a first CRISPR / Cas complex that binds to the first guide RNA target sequence; and / or (b) administering to a subject a nuclease-inactive Cas protein or a nucleic acid encoding a nuclease-inactive Cas protein and a second guide RNA or one or more DNAs encoding a second guide RNA, wherein the second guide RNA comprises a second DNA targeting segment that targets a second guide RNA target sequence within a C9orf72 hexanucleotide repeat expansion sequence between a first non-coding endogenous exon and exon 2 of a C9orf72 gene, wherein the second guide RNA and the nuclease-inactive Cas protein form a second CRISPR / Cas complex that binds to the second guide RNA target sequence. In another aspect, methods for preventing, treating, or ameliorating at least one symptom or indication of a disease associated with a C9orf72 hexanucleotide repeat expansion are provided. Some such methods include: (a) administering to a subject in need thereof a first pharmaceutical composition comprising a therapeutically effective amount of a nuclease-inactive Cas protein or a nucleic acid encoding a nuclease-inactive Cas protein and a first guide RNA or one or more DNAs encoding the first guide RNA, wherein the first guide RNA comprises a first DNA targeting segment that targets a first guide RNA target sequence upstream or near the C9orf72 exon 1A transcription start site, wherein the first guide RNA and the nuclease-inactive Cas protein form a first CRISPR / Cas complex that binds to the first guide RNA target sequence; and / or (b) administering to a subject in need thereof a first pharmaceutical composition comprising a therapeutically effective amount of a nuclease-inactive Cas protein or a nucleic acid encoding a nuclease-inactive Cas protein and a first guide RNA or one or more DNAs encoding the first guide RNA, wherein the first guide RNA comprises a first DNA targeting segment that targets a first guide RNA target sequence upstream or near the C9orf72 exon 1A transcription start site, wherein the first guide RNA and the nuclease-inactive Cas protein form a first CRISPR / Cas complex that binds to the first guide RNA target sequence; and / or The invention relates to administering a second pharmaceutical composition to a subject of interest, the second pharmaceutical composition comprising a therapeutically effective amount of a nuclease-inactive Cas protein or a nucleic acid encoding a nuclease-inactive Cas protein and a second guide RNA or one or more DNAs encoding a second guide RNA, wherein the second guide RNA comprises a second DNA targeting segment that targets a second guide RNA target sequence within a C9orf72 hexanucleotide repeat expansion sequence between a first non-coding endogenous exon and exon 2 of a C9orf72 gene, wherein the second guide RNA and the nuclease-inactive Cas protein form a second CRISPR / Cas complex that binds to the second guide RNA target sequence.In some such methods, the C9orf72 hexanucleotide repeat expansion-associated disease is amyotrophic lateral sclerosis (ALS) or frontotemporal dementia (FTD). In some such methods, the method includes option (a). In some such methods, the method includes option (b). In some such methods, the method includes both option (a) and option (b).

[0018] In some such methods, option (a) comprises administering to the subject at least two guide RNAs, wherein each guide RNA targets a different guide RNA target sequence upstream or near the C9orf72 exon 1A transcription start site, and / or wherein option (b) comprises administering to the subject at least two guide RNAs, wherein each guide RNA targets a different guide RNA target sequence within the C9orf72 hexanucleotide repeat expansion sequence between the first non-coding endogenous exon and exon 2 of the C9orf72 gene. In some such methods, option (a) comprises administering to the subject at least three guide RNAs, wherein each guide RNA targets a different guide RNA target sequence upstream or near the C9orf72 exon 1A transcription start site, and / or wherein option (b) comprises administering to the subject at least three guide RNAs, wherein each guide RNA targets a different guide RNA target sequence within the C9orf72 hexanucleotide repeat expansion sequence between the first non-coding endogenous exon and exon 2 of the C9orf72 gene.

[0019] In some such methods, the C9orf72 hexanucleotide repeat expansion sequence has more than 30, more than 100, more than 200, more than 300, more than 400, or more than 500 repeats of the hexanucleotide sequence G4C2. In some such methods, the administering is intracerebroventricular, intracranial, or intrathecal.

[0020] In some such methods, the first guide RNA target sequence is within 250 nucleotides, within 225 nucleotides, within 200 nucleotides, within 175 nucleotides, within 150 nucleotides, within 125 nucleotides, within 100 nucleotides, within 75 nucleotides, or within 50 nucleotides of the C9orf72 exon 1A transcription start site. In some such methods, the first guide RNA target sequence is within 100 nucleotides, within 75 nucleotides, or within 50 nucleotides of the C9orf72 exon 1A transcription start site.

[0021] In some such methods, the nuclease-inactive Cas protein is not fused to the heterologous transcriptional repressor domain, and the guide RNA is not linked to the heterologous transcriptional repressor domain.

[0022] In some such methods, the combination reduces or eliminates the expression of transcripts that start at C9orf72 exon 1A. In some such methods, the combination reduces or eliminates the expression of transcripts that start at C9orf72 exon 1A, but does not reduce or eliminate the expression of transcripts that start at C9orf72 exon 1B. In some such methods, the combination reduces or eliminates the expression of transcripts containing C9orf72 hexanucleotide repeats. In some such methods, the combination reduces or eliminates the expression of transcripts containing C9orf72 hexanucleotide repeats, but does not reduce or eliminate the expression of transcripts that start at C9orf72 exon 1B. In some such methods, the combination reduces or eliminates the expression of both sense and antisense transcripts containing C9orf72 hexanucleotide repeats. In some such methods, the combination reduces or eliminates the expression of both sense and antisense transcripts containing C9orf72 hexanucleotide repeats, but does not reduce or eliminate the expression of transcripts that start at C9orf72 exon 1B.

[0023] In some such methods, the first guide RNA is a single guide RNA (sgRNA). In some such methods, the nuclease-inactive Cas protein is a nuclease-inactive Cas9 protein. In some such methods, the nuclease-inactive Cas9 protein is derived from Streptococcus pyogenes Cas9 protein, Staphylococcus aureus Cas9 protein, Campylobacter jejuni Cas9 protein, Streptococcus thermophilus Cas9 protein, or Neisseria meningitidis Cas9 protein. In some such methods, the nuclease-inactive Cas protein is derived from Streptococcus pyogenes Cas9 protein. In some such methods, the nucleic acid encoding the nuclease-inactive Cas protein is codon-optimized for expression in mammalian cells or human cells. In some such methods, the method includes: (a) administering a first guide RNA in the form of RNA, optionally wherein the first guide RNA comprises at least one modification; and / or (b) administering a second guide RNA in the form of RNA, optionally wherein the second guide RNA comprises at least one modification. In some such methods, at least one modification includes 2'-O-methyl-modified nucleotides and / or phosphorothioate bonds between nucleotides. In some such methods, the method includes administering a nucleic acid encoding a nuclease-inactive Cas protein, wherein the nucleic acid comprises an mRNA encoding a nuclease-inactive Cas protein, and optionally wherein the mRNA encoding the nuclease-inactive Cas protein comprises at least one modification. In some such methods, the method includes: (a) administering a nucleic acid encoding a nuclease-inactive Cas protein and one or more DNAs encoding a first guide RNA, wherein the nucleic acid encoding the nuclease-inactive Cas protein comprises DNA; and / or (b) administering a nucleic acid encoding a nuclease-inactive Cas protein and one or more DNAs encoding a second guide RNA, wherein the nucleic acid encoding the nuclease-inactive Cas protein comprises DNA. In some such methods, (a) the DNA encoding the nuclease-inactive Cas protein and the one or more DNAs encoding the first guide RNA are in one or more vectors; and / or (b) the DNA encoding the nuclease-inactive Cas protein and the one or more DNAs encoding the second guide RNA are in one or more vectors. In some such methods, the one or more vectors are one or more viral vectors. In some such methods, the one or more viral vectors are one or more adeno-associated virus (AAV) vectors. In some such methods, (a) a nuclease-inactive Cas protein or a nucleic acid encoding a nuclease-inactive Cas protein and a first guide RNA or one or more DNAs encoding a first guide RNA are associated with a lipid nanoparticle; and / or (b) a nuclease-inactive Cas protein or a nucleic acid encoding a nuclease-inactive Cas protein and a second guide RNA or one or more DNAs encoding a second guide RNA are associated with a lipid nanoparticle.

[0024] In some such methods, the first DNA targeting segment comprises at least 17, at least 18, at least 19, or at least 20 consecutive nucleotides of the sequence set forth in any one of SEQ ID NOs: 72-111 and 113. In some such methods, the first DNA targeting segment is at least 90% or at least 95% identical to the sequence set forth in any one of SEQ ID NOs: 72-111 and 113. In some such methods, the first guide RNA target sequence comprises at least 17, at least 18, at least 19, or at least 20 consecutive nucleotides of the sequence set forth in any one of SEQ ID NOs: 32-71 and 112. In some such methods, the first DNA targeting segment comprises at least 17, at least 18, at least 19, or at least 20 consecutive nucleotides of the sequence set forth in any one of SEQ ID NOs: 93-95. In some such methods, the first DNA targeting segment is at least 90% or at least 95% identical to the sequence set forth in any one of SEQ ID NOs: 93-95. In some such methods, the first guide RNA target sequence comprises at least 17, at least 18, at least 19, or at least 20 consecutive nucleotides of the sequence set forth in any one of SEQ ID NOs: 53-55. In some such methods, the first DNA targeting segment comprises at least 17, at least 18, at least 19, or at least 20 consecutive nucleotides of the sequence set forth in SEQ ID NOs: 74. In some such methods, the first DNA targeting segment is at least 90% or at least 95% identical to the sequence set forth in SEQ ID NO: 74. In some such methods, the first guide RNA target sequence comprises at least 17, at least 18, at least 19, or at least 20 consecutive nucleotides of the sequence set forth in SEQ ID NOs: 34. In some such methods, the second DNA targeting segment comprises at least 17, at least 18, at least 19, or at least 20 consecutive nucleotides of the sequence set forth in any one of SEQ ID NOs: 118-121. In some such methods, the second DNA targeting segment is at least 90% or at least 95% identical to the sequence set forth in any one of SEQ ID NOs: 118-121. In some such methods, the second guide RNA target sequence comprises at least 17, at least 18, at least 19, or at least 20 consecutive nucleotides of the sequence set forth in any one of SEQ ID NOs: 114-117. In some such methods, the second DNA targeting segment comprises at least 17, at least 18, at least 19, or at least 20 consecutive nucleotides of the sequence set forth in SEQ ID NO: 74. In some such methods, the second DNA targeting segment is at least 90% or at least 95% identical to the sequence set forth in SEQ ID NO: 74.In some such methods, the second guide RNA target sequence comprises at least 17, at least 18, at least 19, or at least 20 consecutive nucleotides of the sequence set forth in SEQ ID NO:34.

[0025] In some such methods, the binding is located in a neuron of the subject, optionally wherein the neuron is a motor neuron. In some such methods, the neuron is located in the brain of the subject. In some such methods, the subject is a mammalian subject and the C9orf72 gene is a mammalian C9orf72 gene. In some such methods, the subject is a human subject. In some such methods, the subject is a mouse subject. In some such methods, the C9orf72 gene comprises a human C9orf72 promoter. In some such methods, the C9orf72 gene is a human C9orf72 gene or a humanized C9orf72 gene.

[0026] In another aspect, a CRISPR / Cas system is provided. Some such systems comprise: (a) a nuclease-inactive Cas protein or a nucleic acid encoding a nuclease-inactive Cas protein and a first guide RNA or one or more DNAs encoding the first guide RNA, wherein the first guide RNA comprises a first DNA targeting segment targeting a first guide RNA target sequence upstream or near the C9orf72 exon 1A transcription start site, wherein the first guide RNA and the nuclease-inactive Cas protein form a first CRISPR / Cas complex bound to the first guide RNA target sequence; and / or (b) a nuclease-inactive Cas protein or a nucleic acid encoding a nuclease-inactive Cas protein and a second guide RNA or one or more DNAs encoding a second guide RNA, wherein the second guide RNA comprises a second DNA targeting segment targeting a second guide RNA target sequence within a C9orf72 hexanucleotide repeat expansion sequence between a first non-coding endogenous exon and exon 2 of the C9orf72 gene, wherein the second guide RNA and the nuclease-inactive Cas protein form a second CRISPR / Cas complex bound to the second guide RNA target sequence. In some such systems, the CRISPR / Cas system comprises option (a). In some such systems, the CRISPR / Cas system comprises option (b).In some such systems, the CRISPR / Cas system comprises option (a) and option (b).

[0027] In some such systems, option (a) comprises at least two guide RNAs, wherein each guide RNA targets a different guide RNA target sequence upstream or near the C9orf72 exon 1A transcription start site, and / or option (b) comprises at least two guide RNAs, wherein each guide RNA targets a different guide RNA target sequence within the C9orf72 hexanucleotide repeat expansion sequence between the first non-coding endogenous exon and exon 2 of the C9orf72 gene. In some such systems, option (a) comprises at least three guide RNAs, wherein each guide RNA targets a different guide RNA target sequence upstream or near the C9orf72 exon 1A transcription start site, and / or option (b) comprises at least three guide RNAs, wherein each guide RNA targets a different guide RNA target sequence within the C9orf72 hexanucleotide repeat expansion sequence between the first non-coding endogenous exon and exon 2 of the C9orf72 gene.

[0028] In some such systems, the first guide RNA target sequence is within 250 nucleotides, within 225 nucleotides, within 200 nucleotides, within 175 nucleotides, within 150 nucleotides, within 125 nucleotides, within 100 nucleotides, within 75 nucleotides, or within 50 nucleotides of the C9orf72 exon 1A transcription start site. In some such systems, the first guide RNA target sequence is within 100 nucleotides, within 75 nucleotides, or within 50 nucleotides of the C9orf72 exon 1A transcription start site.

[0029] In some such systems, the nuclease-inactive Cas protein is not fused to the heterologous transcriptional repressor domain, and the guide RNA is not linked to the heterologous transcriptional repressor domain.

[0030] In some such systems, the combination reduces or eliminates the expression of transcripts that initiate at C9orf72 exon 1A. In some such systems, the combination reduces or eliminates the expression of transcripts that initiate at C9orf72 exon 1A, but does not reduce or eliminate the expression of transcripts that initiate at C9orf72 exon 1B. In some such systems, the combination reduces or eliminates the expression of transcripts containing C9orf72 hexanucleotide repeats. In some such systems, the combination reduces or eliminates the expression of transcripts containing C9orf72 hexanucleotide repeats, but does not reduce or eliminate the expression of transcripts that initiate at C9orf72 exon 1B. In some such systems, the combination reduces or eliminates the expression of both sense and antisense transcripts containing C9orf72 hexanucleotide repeats. In some such systems, the combination reduces or eliminates the expression of both sense and antisense transcripts containing C9orf72 hexanucleotide repeats, but does not reduce or eliminate the expression of transcripts that initiate at C9orf72 exon 1B.

[0031] In some such systems, the first guide RNA is a single guide RNA (sgRNA). In some such systems, the nuclease-inactive Cas protein is a nuclease-inactive Cas9 protein. In some such systems, the nuclease-inactive Cas9 protein is derived from Streptococcus pyogenes Cas9 protein, Staphylococcus aureus Cas9 protein, Campylobacter jejuni Cas9 protein, Streptococcus thermophilus Cas9 protein, or Neisseria meningitidis Cas9 protein. In some such systems, the nuclease-inactive Cas protein is derived from Streptococcus pyogenes Cas9 protein. In some such systems, the nucleic acid encoding the nuclease-inactive Cas protein is codon-optimized for expression in mammalian cells or human cells. In some such systems, the CRISPR / Cas system comprises: (a) a first guide RNA in the form of RNA, optionally wherein the first guide RNA comprises at least one modification; and / or (b) a second guide RNA in the form of RNA, optionally wherein the second guide RNA comprises at least one modification. In some such systems, at least one modification includes 2'-O-methyl-modified nucleotides and / or phosphorothioate bonds between nucleotides. In some such systems, the CRISPR / Cas system comprises a nucleic acid encoding a nuclease-inactive Cas protein, wherein the nucleic acid comprises an mRNA encoding a nuclease-inactive Cas protein, optionally wherein the mRNA encoding the nuclease-inactive Cas protein comprises at least one modification. In some such systems, the CRISPR / Cas system comprises: (a) a nucleic acid encoding a nuclease-inactive Cas protein and one or more DNAs encoding a first guide RNA, wherein the nucleic acid encoding the nuclease-inactive Cas protein comprises DNA; and / or (b) a nucleic acid encoding a nuclease-inactive Cas protein and one or more DNAs encoding a second guide RNA, wherein the nucleic acid encoding the nuclease-inactive Cas protein comprises DNA. In some such systems, (a) the DNA encoding the nuclease-inactive Cas protein and the one or more DNAs encoding the first guide RNA are in one or more vectors; and / or (b) the DNA encoding the nuclease-inactive Cas protein and the one or more DNAs encoding the second guide RNA are in one or more vectors. In some such systems, the one or more vectors are one or more viral vectors. In some such systems, the one or more viral vectors are one or more adeno-associated virus (AAV) vectors. In some such systems, (a) a nuclease-inactive Cas protein or a nucleic acid encoding a nuclease-inactive Cas protein and a first guide RNA or one or more DNAs encoding a first guide RNA are associated with a lipid nanoparticle; and / or (b) a nuclease-inactive Cas protein or a nucleic acid encoding a nuclease-inactive Cas protein and a second guide RNA or one or more DNAs encoding a second guide RNA are associated with a lipid nanoparticle.

[0032] In some such systems, the first DNA targeting segment comprises at least 17, at least 18, at least 19, or at least 20 consecutive nucleotides of the sequence set forth in any one of SEQ ID NOs: 72-111 and 113. In some such systems, the first DNA targeting segment is at least 90% or at least 95% identical to the sequence set forth in any one of SEQ ID NOs: 72-111 and 113. In some such systems, the first guide RNA target sequence comprises at least 17, at least 18, at least 19, or at least 20 consecutive nucleotides of the sequence set forth in any one of SEQ ID NOs: 32-71 and 112. In some such systems, the first DNA targeting segment comprises at least 17, at least 18, at least 19, or at least 20 consecutive nucleotides of the sequence set forth in any one of SEQ ID NOs: 93-95. In some such systems, the first DNA targeting segment is at least 90% or at least 95% identical to the sequence set forth in any one of SEQ ID NOs: 93-95. In some such systems, the first guide RNA target sequence comprises at least 17, at least 18, at least 19, or at least 20 consecutive nucleotides of the sequence set forth in any one of SEQ ID NOs: 53-55. In some such systems, the first DNA targeting segment comprises at least 17, at least 18, at least 19, or at least 20 consecutive nucleotides of the sequence set forth in SEQ ID NOs: 74. In some such systems, the first DNA targeting segment is at least 90% or at least 95% identical to the sequence set forth in SEQ ID NO: 74. In some such systems, the first guide RNA target sequence comprises at least 17, at least 18, at least 19, or at least 20 consecutive nucleotides of the sequence set forth in SEQ ID NOs: 34. In some such systems, the second DNA targeting segment comprises at least 17, at least 18, at least 19, or at least 20 consecutive nucleotides of the sequence set forth in any one of SEQ ID NOs: 118-121. In some such systems, the second DNA targeting segment is at least 90% or at least 95% identical to the sequence set forth in any one of SEQ ID NOs: 118-121. In some such systems, the second guide RNA target sequence comprises at least 17, at least 18, at least 19, or at least 20 consecutive nucleotides of the sequence set forth in any one of SEQ ID NOs: 114-117. In some such systems, the second DNA targeting segment comprises at least 17, at least 18, at least 19, or at least 20 consecutive nucleotides of the sequence set forth in SEQ ID NO: 74. In some such systems, the second DNA targeting segment is at least 90% or at least 95% identical to the sequence set forth in SEQ ID NO: 74.In some such systems, the second guide RNA target sequence comprises at least 17, at least 18, at least 19, or at least 20 contiguous nucleotides of the sequence set forth in SEQ ID NO:34.

[0033] In some such systems, the C9orf72 gene is a mammalian C9orf72 gene. In some such systems, the C9orf72 gene comprises a human C9orf72 promoter. In some such systems, the C9orf72 gene is a human C9orf72 gene or a humanized C9orf72 gene.

[0034] In another aspect, a pharmaceutical composition comprising any of the above-described CRISPR / Cas systems and a pharmaceutically acceptable carrier is provided.

[0035] In another aspect, compositions comprising a guide RNA or one or more DNAs encoding the guide RNA are provided. In some such compositions, the guide RNA comprises a DNA targeting segment that targets a guide RNA target sequence in a C9orf72 gene, wherein the guide RNA target sequence is within a C9orf72 hexanucleotide repeat expansion sequence between the first non-coding endogenous exon and exon 2 of the C9orf72 gene, and wherein the guide RNA is capable of binding to a nuclease-inactive Cas protein and targeting the nuclease-inactive Cas protein to the guide RNA target sequence.

[0036] In some such compositions, binding of a Cas protein to a guide RNA target sequence reduces or eliminates expression of a transcript that initiates at C9orf72 exon 1A. In some such compositions, binding of a Cas protein to a guide RNA target sequence reduces or eliminates expression of a transcript that initiates at C9orf72 exon 1A, but does not reduce or eliminate expression of a transcript that initiates at C9orf72 exon 1B. In some such compositions, binding of a Cas protein to a guide RNA target sequence reduces or eliminates expression of a transcript containing a C9orf72 hexanucleotide repeat sequence. In some such compositions, binding of a Cas protein to a guide RNA target sequence reduces or eliminates expression of a transcript containing a C9orf72 hexanucleotide repeat sequence, but does not reduce or eliminate expression of a transcript that initiates at C9orf72 exon 1B. In some such compositions, binding of a Cas protein to a guide RNA target sequence reduces or eliminates expression of both sense and antisense transcripts containing a C9orf72 hexanucleotide repeat sequence. In some such compositions, binding of the Cas protein to the guide RNA target sequence reduces or eliminates expression of both sense and antisense transcripts containing the C9orf72 hexanucleotide repeat sequence, but does not reduce or eliminate expression of transcripts that initiate at exon 1B of C9orf72.

[0037] In some such compositions, the guide RNA is a single guide RNA (sgRNA). In some such compositions, the nuclease-inactive Cas protein is a nuclease-inactive Cas9 protein. In some such compositions, the nuclease-inactive Cas9 protein is derived from Streptococcus pyogenes Cas9 protein, Staphylococcus aureus Cas9 protein, Campylobacter jejuni Cas9 protein, Streptococcus thermophilus Cas9 protein or Neisseria meningitidis Cas9 protein. In some such compositions, the nuclease-inactive Cas protein is derived from Streptococcus pyogenes Cas9 protein. In some such compositions, the CRISPR / Cas system comprises a guide RNA in the form of RNA, optionally wherein the guide RNA comprises at least one modification. In some such compositions, at least one modification includes a phosphorothioate bond between nucleotides and / or nucleotides modified by 2'-O-methyl. In some such compositions, one or more DNAs encoding the guide RNA are in one or more vectors. In some such compositions, one or more vectors are one or more viral vectors. In some such compositions, one or more viral vectors are one or more adeno-associated virus (AAV) vectors. In some such compositions, the guide RNA or one or more DNAs encoding the guide RNA is associated with a lipid nanoparticle.

[0038] In some such compositions, the DNA targeting segment comprises at least 17, at least 18, at least 19, or at least 20 consecutive nucleotides of the sequence set forth in any one of SEQ ID NOs: 118-121. In some such compositions, the DNA targeting segment is at least 90% or at least 95% identical to the sequence set forth in any one of SEQ ID NOs: 118-121. In some such compositions, the guide RNA target sequence comprises at least 17, at least 18, at least 19, or at least 20 consecutive nucleotides of the sequence set forth in any one of SEQ ID NOs: 114-117.

[0039] In some such compositions, the C9orf72 gene is a mammalian C9orf72 gene. In some such compositions, the C9orf72 gene comprises a human C9orf72 promoter. In some such compositions, the C9orf72 gene is a human C9orf72 gene or a humanized C9orf72 gene.

[0040] In another aspect, provided is a pharmaceutical composition comprising any of the above compositions and a pharmaceutically acceptable carrier. BRIEF DESCRIPTION OF THE DRAWINGS

[0041] Figure 1 A schematic diagram of RNA synthesis by the C9orf72 gene in normal and disease states is shown.

[0042] Figure 2 Shown is a schematic representation of a precisely targeted humanized C9orf72 expansion allele that recapitulates the molecular hallmarks of amyotrophic lateral sclerosis (ALS).

[0043] Figure 3 A schematic diagram for generating a C9orf72 allele with a humanized exon 1A promoter is shown.

[0044] Figure 4 Shown are bar graphs showing the expression levels of transcripts from the C9orf72 locus (as shown by the depiction of the C9orf72 locus at the top of each graph). These transcripts are exon 1A-exon 2 spliced ​​transcripts, exon 1B-exon 2 spliced ​​transcripts, exon 5-exon 6 spliced ​​transcripts, transcripts containing exon 1A and intron 1 sequences, or transcripts containing intron 1 in mouse ES cells comprising an allele having a humanized C9orf72 promoter region and a humanized C9orf72 locus comprising a 3x or 250x repeat of a hexanucleotide sequence as determined by a quantitative reverse transcription-coupled PCR (RT-qPCR) assay (y axis). Expression relative to 3x repeat control cells is shown. Figure 4 It was shown that the allele with the humanized C9orf72 promoter region recapitulated the RNA expression pattern seen in the repeat expansion allele with the mouse promoter, with exon 1A and intron-containing transcripts expressed at higher levels in 250x repeat mouse ES cells compared to 3x repeat mouse ES cells, while exon 1B transcripts were unchanged.

[0045] Figure 5 Shown is a schematic diagram of using a catalytically dead form of the Cas9 enzyme (dCas9) and a sequence-specific guide RNA (gRNA) targeting upstream of the transcription start site of exon 1A to selectively block transcription initiation and thereby block expression of exon 1A transcripts but not exon 1B transcripts.

[0046] Figure 6 Shown are bar graphs showing expression levels of transcripts from the C9orf72 locus following treatment with dCas9 and a sequence-specific guide RNA (gRNA) targeting upstream of the transcription start site of exon 1A (as shown by the depiction of the C9orf72 locus at the top of each graph). These transcripts are exon 1A-exon 2 spliced ​​transcripts (upper left), exon 1B-exon 2 spliced ​​transcripts (upper right), containing exon 1A sequence and intronic sequence near exon 1A (lower left), and containing intronic sequence near exon 1A (lower right) in mouse ES cells containing a humanized C9orf72 locus containing a 300 hexanucleotide sequence repeat and a mouse promoter region or in mouse ES cells containing a humanized C9orf72 locus containing a 250 hexanucleotide sequence repeat and a human promoter region, as determined by quantitative reverse transcription-coupled PCR (RT-qPCR) assay (y axis). Expression levels relative to ES cells treated with control gRNA are shown.

[0047] Figure 7 Shown is a schematic diagram of the use of a catalytically dead form of the Cas9 enzyme (dCas9) and a sequence-specific guide RNA (gRNA) targeting the C9orf72 hexanucleotide repeat sequence to selectively block transcription elongation and thereby block expression of exon 1A transcripts but not exon 1B transcripts.

[0048] Figure 8 Shown are bar graphs showing expression levels of transcripts from the C9orf72 locus following treatment with dCas9 and a sequence-specific guide RNA (gRNA) targeting a hexanucleotide repeat sequence (as shown by the depiction of the C9orf72 locus at the top of each graph). These transcripts are exon 1A-exon 2 spliced ​​transcripts (upper left), exon 1B-exon 2 spliced ​​transcripts (upper right), containing exon 1A sequence and intronic sequence near exon 1A (lower left), and containing intronic sequence near exon 1A (lower right) in mouse ES cells containing a humanized C9orf72 locus containing a 300 hexanucleotide sequence repeat and a mouse promoter region or in mouse ES cells containing a humanized C9orf72 locus containing a 250 hexanucleotide sequence repeat and a human promoter region, as determined by quantitative reverse transcription-coupled PCR (RT-qPCR) assay (y axis). Expression levels relative to ES cells treated with control gRNA are shown.

[0049] Fig. 9 Shown are bar graphs (bottom of the graphs) showing the expression levels of transcripts from the C9orf72 locus after treatment with dCas9 and a sequence-specific guide RNA (gRNA) targeting upstream of the transcription start site of exon 1A (top of the graphs) or targeting the hexanucleotide repeat sequence (as shown by the depiction of the C9orf72 locus at the top of each graph). These transcripts are exon 1A-exon 2 spliced ​​transcripts in mouse ES cells containing a humanized C9orf72 locus containing 300 hexanucleotide repeats and a mouse promoter region as determined by quantitative reverse transcription-coupled PCR (RT-qPCR) assay (y axis). Expression levels relative to ES cells treated with control gRNA are shown.

[0050] definition

[0051] The terms "protein", "polypeptide", and "peptide" used interchangeably herein include amino acids of any length in polymeric form, including coded amino acids and non-coded amino acids as well as chemically or biochemically modified amino acids or chemically or biochemically derivatized amino acids. These terms also include polymers that have been modified, such as polypeptides with modified peptide backbones. The term "domain" refers to any portion of a protein or polypeptide that has a specific function or structure.

[0052] Proteins are considered to have an "N-terminus" and a "C-terminus." The term "N-terminus" refers to the beginning of a protein or polypeptide, which terminates in an amino acid with a free amine group (-NH2). The term "C-terminus" refers to the end of an amino acid chain (protein or polypeptide), which terminates in a free carboxyl group (-COOH).

[0053] The terms "nucleic acid" and "polynucleotide", which are used interchangeably herein, include polymeric forms of nucleotides of any length, including ribonucleotides, deoxyribonucleotides, or analogs or modified forms thereof. These terms include single-stranded, double-stranded, and multi-stranded DNA or RNA, genomic DNA, cDNA, DNA-RNA hybrids, and polymers containing purine bases, pyrimidine bases, or other natural, chemically modified, biochemically modified, non-natural, or derived nucleotide bases.

[0054] Nucleic acids are considered to have a "5' end" and a "3' end" because mononucleotides are reacted to form oligonucleotides in a manner such that the 5' phosphate of one mononucleotide pentose ring is attached to the 3' oxygen of its adjacent mononucleotide pentose ring in one direction via a phosphodiester bond. If the 5' phosphate of an oligonucleotide is not attached to the 3' oxygen of a mononucleotide pentose ring, then the end of the oligonucleotide is referred to as the "5' end". If the 3' oxygen of an oligonucleotide is not attached to the 5' phosphate of another mononucleotide pentose ring, then the end of the oligonucleotide is referred to as the "3' end". A nucleic acid sequence may be considered to have a 5' end and a 3' end even if the nucleic acid sequence is within a larger oligonucleotide. In a linear or circular DNA molecule, a discrete element is referred to as "upstream" or 5' of the "downstream" or 3' element.

[0055] The term "targeting vector" refers to a recombinant nucleic acid that can be introduced into a target location in the genome of a cell by homologous recombination, non-homologous end joining-mediated ligation, or any other recombination means.

[0056] The term "viral vector" refers to a recombinant nucleic acid that contains at least one element of viral origin and contains elements sufficient or allowing packaging into viral vector particles. The vector and / or particle can be used for the purpose of transferring DNA, RNA or other nucleic acids into cells in vitro, ex vivo or in vivo. Various forms of viral vectors are known.

[0057] The term "isolated" with respect to cells, tissues, proteins and nucleic acids includes cells, tissues, proteins and nucleic acids that are relatively purified relative to other bacteria, viruses, cells or other components that may normally be present in situ, up to and including substantially pure preparations of cells, tissues, proteins and nucleic acids. The term "isolated" also includes cells, tissues, proteins and nucleic acids that do not have naturally occurring counterparts, have been chemically synthesized and are therefore substantially uncontaminated by other cells, tissues, proteins and nucleic acids, or have been separated or purified from most other components (e.g., cellular components) with which they are naturally associated (e.g., other cellular proteins, polynucleotides or cellular components).

[0058] The term "wild-type" includes an entity having structure and / or activity as found in a normal (as compared to mutation, disease, alteration, etc.) state or condition. Wild-type genes and polypeptides typically exist in multiple different forms (eg, alleles).

[0059] The term "endogenous sequence" refers to a nucleic acid sequence that naturally exists in a cell or subject. For example, a human endogenous C9orf72 sequence refers to a native C9orf72 sequence that naturally exists at the C9orf72 locus in humans.

[0060] "Exogenous" molecules or sequences include molecules or sequences that are not usually present in the cell in the form described. Normal presence includes the presence of a specific developmental stage and environmental conditions of the cell. For example, an exogenous molecule or sequence may include a mutant form of a corresponding endogenous sequence in the cell (such as a humanized form of an endogenous sequence), or may include a sequence that corresponds to an endogenous sequence in the cell but is in a different form (i.e., not in a chromosome). In contrast, an endogenous molecule or sequence includes a molecule or sequence that is usually present in the form described in a specific cell at a specific developmental stage under specific environmental conditions.

[0061] When used in the context of a nucleic acid or protein, the term "heterologous" indicates that the nucleic acid or protein comprises at least two segments that are not naturally present together in the same molecule. For example, when used with respect to a nucleic acid segment or a protein segment, the term "heterologous" indicates that the nucleic acid or protein comprises two or more subsequences that are not found in the same relationship (e.g., linked together) to each other in nature. As an example, a "heterologous" region of a nucleic acid vector is a nucleic acid segment that is not found in nature in association with another nucleic acid molecule or attached to it. For example, a heterologous region of a nucleic acid vector may comprise a coding sequence flanked by a sequence that is not found in nature in association with a coding sequence. Similarly, a "heterologous" region of a protein is an amino acid segment that is not found in nature in association with another peptide molecule (e.g., a fusion protein or a protein with a tag) or attached to it. Similarly, a nucleic acid or protein may comprise a heterologous marker or a heterologous secretion or localization sequence.

[0062] "Codon optimization" (i.e., "codon-optimized" sequences) exploits the degeneracy of codons, as demonstrated by the diversity of three-base pair codon combinations for a specified amino acid, and generally includes the process of modifying a nucleic acid sequence to enhance expression in a particular host cell by replacing at least one codon of the native sequence with a codon that is more frequently or most frequently used in the genes of the host cell while maintaining the native amino acid sequence. For example, a nucleic acid encoding a polypeptide of interest can be modified to replace a codon that has a higher frequency of usage in a given prokaryotic or eukaryotic cell, including a bacterial cell, a yeast cell, a human cell, a non-human cell, a mammalian cell, a rodent cell, a mouse cell, a rat cell, a hamster cell, or any other host cell, compared to the naturally occurring nucleic acid sequence. Codon usage tables are readily available, for example at "codon usage databases". These tables can be modified in a variety of ways. See Nakamura et al., (2000) Nucleic Acids Res. 28(1):292, which is incorporated herein by reference in its entirety for all purposes. Computer algorithms are also available for codon optimization of a specific sequence for expression in a specific host (see, e.g., Gene Forge).

[0063] The term "locus" refers to a gene (or significant sequence), a DNA sequence, a specific location of a polypeptide coding sequence, or a location on a chromosome of the genome of an organism. For example, a "C9orf72 locus" may refer to a C9orf72 gene, a specific location of a C9orf72 DNA sequence, or a location of C9orf72 on a chromosome of the genome of an organism, which location has been identified as a location where such a sequence resides. The "C9orf72 locus" may include regulatory elements of the C9orf72 gene, including, for example, enhancers, promoters, 5' and / or 3' untranslated regions (UTRs), or combinations thereof.

[0064] The term "gene" refers to a DNA sequence in a chromosome that, if naturally present, may contain at least one coding region and at least one non-coding region. The DNA sequence encoding a product (e.g., but not limited to, an RNA product and / or a polypeptide product) in a chromosome may include a coding region interrupted by a non-coding intron and a sequence (including 5' and 3' non-translated sequences) located adjacent to the coding region at both the 5' and 3' ends so that the gene corresponds to a full-length mRNA. In addition, other non-coding sequences including regulatory sequences (e.g., but not limited to, promoters, enhancers, and transcription factor binding sites), polyadenylation signals, internal ribosome entry sites, silencers, insulating sequences, and matrix attachment regions may be present in a gene. These sequences may be close to the coding region of a gene (e.g., but not limited to, within 10 kb) or located at a distant site, and these sequences may affect the transcription and translation levels or rates of the gene.

[0065] The term "allele" refers to a variant form of a gene. Some genes have multiple different forms that are located at the same position or genetic locus on a chromosome. Diploid organisms have two alleles at each locus. Each pair of alleles represents the genotype of a specific locus. If there are two identical alleles at a specific locus, the genotype is described as homozygous, and if the two alleles are different, the genotype is described as heterozygous.

[0066] "Promoter" is a regulatory region of DNA, which generally comprises a TATA box capable of guiding RNA polymerase II to initiate RNA synthesis at an appropriate transcription start site of a specific polynucleotide sequence. The promoter may also comprise other regions that affect the transcription initiation rate. The promoter sequence disclosed herein regulates the transcription of an operably linked polynucleotide. The promoter may be active in one or more cell types (e.g., human cells, human liver cells, or human liver hepatocytes) in the cell types disclosed herein. The promoter may be, for example, a constitutively active promoter, a conditional promoter, an inducible promoter, a time-limited promoter (e.g., a promoter regulated by development) or a spatially limited promoter (e.g., a cell-specific or tissue-specific promoter). Examples of promoters may be present in, for example, WO2013 / 176772, which is incorporated herein by reference in its entirety for all purposes.

[0067] "Operable linkage" or "operably linked" includes the juxtaposition of two or more components (e.g., a promoter and another sequence element) so that both components function normally and allow at least one component to mediate a function imposed on at least one other component. For example, a promoter can be operably linked to a coding sequence if it controls the level of transcription of the coding sequence in response to the presence or absence of one or more transcriptional regulatory factors. Operable linkage can include such sequences that are adjacent to each other or act in trans (e.g., a regulatory sequence can act at a distance to control the transcription of a coding sequence).

[0068] The methods and compositions provided herein employ a variety of different components. Some components throughout the specification may have active variants and fragments. The term "functional" refers to the innate ability of a protein or nucleic acid (or its fragment or variant) to exhibit biological activity or function. Compared to the original molecule, the biological function of a functional fragment or variant may be the same or may actually be changed (e.g., with respect to its specificity or selectivity or efficacy) but retain the basic biological function of the molecule.

[0069] The term "variant" refers to a nucleotide sequence that differs from the most prevalent sequence in a population (eg, by one nucleotide) or a protein sequence that differs from the most prevalent sequence in a population (eg, by one amino acid).

[0070] When referring to protein, the term "fragment" means a protein shorter than the full-length protein or with fewer amino acids. When referring to nucleic acids, the term "fragment" means a nucleic acid shorter than the full-length nucleic acid or with fewer nucleotides. When referring to protein fragments, fragments can be, for example, N-terminal fragments (i.e., removing a part of the C-terminal of the protein), C-terminal fragments (i.e., removing a part of the N-terminal of the protein) or internal fragments (i.e., removing a part of each of the N-terminal and C-terminal of the protein). When referring to nucleic acid fragments, fragments can be, for example, 5' fragments (i.e., removing a part of the 3' end of the nucleic acid), 3' fragments (i.e., removing a part of the 5' end of the nucleic acid) or internal fragments (i.e., removing a part of each of the 5' end and 3' end of the nucleic acid).

[0071] In the context of two polynucleotides or polypeptide sequences, "sequence identity" or "identity" refers to the same residues in two sequences when compared for maximum correspondence in a specified comparison window. When the sequence identity percentage is used relative to a protein, the non-identical residue positions are usually different due to conservative amino acid substitutions, wherein the amino acid residues are replaced by other amino acid residues with similar chemical properties (e.g., charge or hydrophobicity), and therefore the functional properties of the molecule are not changed. When the conservative substitutions of the sequence are different, the sequence identity percentage can be adjusted upward to correct the conservative nature of the substitution. Sequences that differ due to such conservative substitutions are considered to have "sequence similarity" or "similarity". The means for making such adjustments are well known. Typically, this involves counting conservative substitutions as partial mismatches rather than complete mismatches, thereby increasing the percentage sequence identity. Therefore, for example, when the obtained score of the same amino acid is 1 and the obtained score of the non-conservative substitution is zero, the obtained score of the conservative substitution is between zero and 1. For example, the score of the conservative substitution is calculated, such as implemented in the program PC / GENE (Tntelligenetics, Mountain View, California).

[0072] "Percentage of sequence identity" includes the value determined by comparing two optimally aligned sequences in a comparison window (the maximum number of fully matched residues), wherein the portion of the polynucleotide sequence in the comparison window may include additions or deletions (i.e., gaps) compared to the reference sequence (not including additions or deletions) to achieve optimal alignment of the two sequences. The percentage is calculated by determining the number of positions where the same nucleic acid base or amino acid residue appears in the two sequences to obtain the number of matching positions, dividing the number of matching positions by the total number of positions in the comparison window, and multiplying the result by 100 to obtain the percentage of sequence identity. Unless otherwise specified (e.g., the shorter sequence comprises a linked heterologous sequence), the comparison window is the full length of the shorter of the two compared sequences.

[0073] Unless otherwise indicated, sequence identity / similarity values ​​include values ​​obtained using GAP version 10 using the following parameters: nucleotide sequence identity % and similarity % using a GAP weight of 50 and a length weight of 3 and the nwsgapdna.cmp scoring matrix; amino acid sequence identity % and similarity % using a GAP weight of 8 and a length weight of 2 and the BLOSUM62 scoring matrix; or any equivalent programs thereof. "Equivalent programs" include any sequence comparison program that generates an alignment with identical nucleotide or amino acid residue matches and identical percent sequence identity for any two sequences in question when compared to the corresponding alignment generated by GAP version 10.

[0074] The term "conservative amino acid substitution" refers to replacing an amino acid normally present in a sequence with a different amino acid having a similar size, charge or polarity. Examples of conservative substitutions include replacing another non-polar residue with a non-polar (hydrophobic) residue (such as isoleucine, valine or leucine). Similarly, examples of conservative substitutions include replacing another polar residue with a polar (hydrophilic) residue, such as a polar residue between arginine and lysine, a polar residue between glutamine and asparagine, or a polar residue between glycine and serine. In addition, replacing another basic residue with a basic residue (such as lysine, arginine or histidine) or replacing another acidic residue with an acidic residue (such as aspartic acid or glutamic acid) is an additional example of conservative substitution. Examples of non-conservative substitutions include replacing a polar (hydrophilic) residue (such as cysteine, glutamine, glutamic acid or lysine) with a non-polar (hydrophobic) amino acid residue (such as isoleucine, valine, leucine, alanine or methionine) and / or replacing a non-polar residue with a polar residue. Typical amino acid classifications are summarized below.

[0075] Table 1: Amino Acid Classification .

[0076]

[0077] "Homologous" sequences (e.g., nucleic acid sequences) include sequences that are identical or substantially similar to a known reference sequence, such that they are, for example, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% identical to a known reference sequence. Homologous sequences can include, for example, orthologous sequences and paralogous sequences. For example, homologous genes are usually produced from a common ancestral DNA sequence by speciation events (orthologous genes) or genetic duplication events (paralogous genes). "Orthologous" genes include genes in different species that evolved from a common ancestor by speciation. Orthologs usually retain the same function during evolution. "Paralogous" genes include genes associated with replication within the genome. Paralogs can evolve new functions during evolution.

[0078] The term "in vitro" includes artificial environments and processes or reactions that occur within artificial environments (e.g., test tubes or isolated cells or cell lines). The term "in vivo" includes natural environments (e.g., cells, organisms, or the body) and processes or reactions that occur within natural environments. The term "ex vivo" includes cells that have been removed from an individual's body and processes or reactions that occur within such cells.

[0079] A composition or method that “comprises” or “includes” one or more of the recited elements may include other elements not specifically recited. For example, a composition that “comprises” or “includes” a protein may contain the protein alone or in combination with other ingredients. The transition phrase “consisting essentially of” means that the scope of the claim should be interpreted to encompass the specified elements recited in the claim as well as those elements that do not materially affect the basic and novel characteristics of the claimed invention. Therefore, when used in the claims of the present invention, the term “consisting essentially of” should not be interpreted as being equivalent to “comprising.”

[0080] "Optional" or "optionally" means that the subsequently described event or circumstance may or may not occur and that the description includes instances where said event or circumstance occurs and instances where it does not occur.

[0081] The designation of a numerical range includes all integers within or defining the range and all subranges defined by the integers within the range. For example, 5-10 nucleotides is understood to be 5, 6, 7, 8, 9 or 10 nucleotides, and 5%-10% is understood to include 5% and all possible values ​​up to 10%.

[0082] At least 17 nucleotides in a 20 nucleotide sequence are understood to include 17, 18, 19 or 20 nucleotides in the sequence provided, thereby providing an upper limit, even if an upper limit is not clearly provided as will be clearly understood. Similarly, at most 3 nucleotides will be understood to cover 0, 1, 2 or 3 nucleotides, thereby providing a lower limit, even if a lower limit is not clearly provided. When "at least", "at most" or other similar language modifies a number, it can be understood to modify each number in the series.

[0083] As used herein, "no more than" or "less than" is understood to mean the value adjacent to the phrase and any logically lower value or integer to zero that is reasonable from the context. For example, a duplex region of "no more than 2 nucleotide base pairs" has 2, 1, or 0 nucleotide base pairs. When "no more than" or "less than" is preceded by a series of numbers or ranges, it is understood that each number in the series or range is modified.

[0084] As used herein, it is understood that when the maximum amount of a value is represented by 100% (eg, 100% inhibition), the value is limited by the detection method. For example, 100% inhibition is understood to be inhibition to a level below the detection level of the assay.

[0085] Unless the context indicates otherwise, the term "about" encompasses values ​​of ±5% of the stated value. In certain embodiments, the term "about" should be understood to encompass variations or errors that are tolerated in the art, such as 2 standard deviations from the mean or the sensitivity of the method used to make the measurement, or a percentage of a value that is tolerated in the art, such as changes with age. When "about" is present before the first value in a series, it can be understood to modify each value in the series.

[0086] The term "and / or" refers to and encompasses any and all possible combinations of one or more of the associated listed items as well as the lack of a combination when interpreted in the alternative ("or").

[0087] The term "or" refers to any one member of a particular list and also includes any combination of members of that list.

[0088] As used herein, the singular forms "a", "an" and "the" include plural referents unless the context clearly dictates otherwise. For example, the term "a protein" or "at least one protein" may include a plurality of proteins, including mixtures thereof.

[0089] Statistically significant means p≤0.05.

[0090] In the event of a conflict between a sequence in this application and a designated accession number or position in an accession number, the sequence in this application controls. DETAILED DESCRIPTION

[0091] 1. Overview

[0092] Sense and antisense repeat expansion of C9orf72 RNA detected as cytoplasmic and nuclear foci by fluorescence in situ hybridization (FISH) can sequester RNA-binding proteins, leading to cytotoxicity. In addition, it is proposed that dipeptide repeat (DPR) proteins are generated from sense and antisense RNA expansion of C9orf72 GGGGCC (G4C2) repeats by an atypical process called repeat-associated non-AUG (RAN) translation, and there is strong evidence that DPR proteins are cytotoxic. DPR proteins can be translated from all sense and antisense reading frames. Sense DPR proteins include glycine-alanine, glycine-arginine, and glycine-proline DPR proteins. Antisense DPR proteins include proline-arginine, proline-alanine, and glycine-proline. Because G4C2 repeat-containing RNAs, either by themselves or as templates for translation of dipeptide repeat proteins, appear to be pathogenic, a general therapeutic strategy is to inhibit their synthesis or promote their destruction.

[0093] Transcription of the C9orf72 gene initiates at two alternative noncoding exons: exon 1A (upstream) and exon 1B (downstream). A G4C2 repeat sequence is located between exons 1A and 1B. Exons 1A and 1B can be spliced ​​to exon 2, the first protein-coding exon, resulting in mRNA with an alternative 5'-untranslated region. In healthy individuals with short G4C2 repeat expansions, transcription initiates primarily at exon 1B; RNA including exon 1A is rare, and repeat-containing RNA is undetectable. Individuals with C9orf72 ALS or FTLD accumulate transcripts in which exon 1A is spliced ​​to exon 2, and both sense and antisense repeat-containing RNAs, as well as the DPR proteins translated from them, can be detected by in situ hybridization and immunohistochemistry. See Figure 1 These pathological findings suggest that longer disease-associated G4C2 repeat expansions promote the use of the upstream exon 1A transcription start site, which is the only way that repeat-containing RNAs and their DPR proteins can be produced. This also suggests that the production of antisense repeat-containing RNAs that is dependent on long repeat expansions is associated with increased use of the upstream transcription start site.

[0094] Therefore, a possible therapeutic strategy for C9orf72 repeat expansion disease would be to inhibit or eliminate transcription that initiates upstream of the G4C2 repeat sequence at exon 1A, while retaining transcription that initiates at exon 1B downstream of the repeat sequence, which would retain the production of mRNA for C9orf72 protein synthesis. CRISPR interference (CRISPRi) technology uses catalytically dead Cas proteins (dCas proteins) that lack endonuclease activity to regulate genes in an RNA-guided manner. CRISPRi can spatially inhibit transcription by blocking transcription initiation or elongation. This is achieved by designing guide RNAs that are complementary to promoters or coding sequences, respectively. One advantage of CRISPRi over conventional Cas9 is that double-strand breaks in DNA are not induced, so there is less chance of off-target DNA breaks and DNA damage, which can be very harmful to cells and the entire organism.

[0095] Disclosed herein are guide RNAs and CRISPR / Cas systems targeting the C9orf72 gene, lipid nanoparticles or viral vectors comprising such CRISPR / Cas systems, and cells or animals comprising such CRISPR / Cas systems. Also provided are methods for inhibiting transcription of the C9orf72 exon 1A transcription start site in the C9orf72 gene and / or inhibiting transcription of sense and / or antisense transcripts comprising a hexanucleotide repeat expansion sequence using the CRISPR / Cas system, and uses of the CRISPR / Cas system in preventive and therapeutic applications for treating and / or preventing diseases associated with C9orf72 hexanucleotide repeat expansion and / or for ameliorating at least one symptom associated with such diseases. The CRISPR / Cas system disclosed herein can target promoter elements upstream or near exon 1A, or can target the C9orf72 hexanucleotide repeat expansion sequence between the first non-coding endogenous exon and exon 2 of the C9orf72 gene, selectively or preferentially reducing or eliminating transcripts starting at exon 1A or sense or antisense transcripts comprising the hexanucleotide repeat expansion sequence, while retaining transcripts starting at exon 1B.

[0096] The CRISPR / Cas systems disclosed herein can, for example, reduce or eliminate the expression of transcripts that initiate at C9orf72 exon 1A. The CRISPR / Cas systems disclosed herein can also, for example, reduce or eliminate the expression of transcripts containing C9orf72 hexanucleotide repeats. The CRISPR / Cas systems disclosed herein can also, for example, reduce or eliminate the expression of sense transcripts containing C9orf72 hexanucleotide repeats. The CRISPR / Cas systems disclosed herein can also, for example, reduce or eliminate the expression of antisense transcripts containing C9orf72 hexanucleotide repeats. The CRISPR / Cas systems disclosed herein can also, for example, reduce or eliminate the expression of both sense and antisense transcripts containing C9orf72 hexanucleotide repeats. The CRISPR / Cas systems disclosed herein can, for example, selectively or preferentially reduce or eliminate the expression of transcripts starting at C9orf72 exon 1A relative to the effect on the expression of transcripts starting at C9orf72 exon 1B (i.e., the expression of transcripts starting at C9orf72 exon 1A is reduced to a greater extent than the expression of transcripts starting at C9orf72 exon 1B). The CRISPR / Cas systems disclosed herein can also, for example, selectively or preferentially reduce or eliminate the expression of transcripts containing C9orf72 hexanucleotide repeats relative to the effect on the expression of transcripts starting at C9orf72 exon 1B (i.e., the expression of transcripts containing C9orf72 hexanucleotide repeats is reduced to a greater extent than the expression of transcripts starting at C9orf72 exon 1B). The CRISPR / Cas systems disclosed herein may also, for example, selectively or preferentially reduce or eliminate the expression of sense transcripts containing the C9orf72 hexanucleotide repeat sequence relative to the effect on the expression of transcripts starting at C9orf72 exon 1B (e.g., the expression of sense transcripts containing the C9orf72 hexanucleotide repeat sequence is reduced to a greater extent than the expression of transcripts starting at C9orf72 exon 1B). The CRISPR / Cas systems disclosed herein may also, for example, selectively or preferentially reduce or eliminate the expression of antisense transcripts containing the C9orf72 hexanucleotide repeat sequence relative to the effect on the expression of transcripts starting at C9orf72 exon 1B (e.g., the expression of antisense transcripts containing the C9orf72 hexanucleotide repeat sequence is reduced to a greater extent than the expression of transcripts starting at C9orf72 exon 1B).The CRISPR / Cas systems disclosed herein can also, for example, selectively or preferentially reduce or eliminate the expression of both sense and antisense transcripts containing the C9orf72 hexanucleotide repeat relative to the effect on the expression of transcripts starting at C9orf72 exon 1B (e.g., reducing the expression of both sense and antisense transcripts containing the C9orf72 hexanucleotide repeat to a greater extent than reducing the expression of transcripts starting at C9orf72 exon 1B). In the CRISPR / Cas systems disclosed herein, the CRISPR / Cas system reduces or eliminates the expression of transcripts starting at C9orf72 exon 1A, but does not reduce or eliminate the expression of transcripts starting at C9orf72 exon 1B. In some CRISPR / Cas systems disclosed herein, the CRISPR / Cas system reduces or eliminates the expression of transcripts containing the C9orf72 hexanucleotide repeat, but does not reduce or eliminate the expression of transcripts starting at C9orf72 exon 1B. In some CRISPR / Cas systems disclosed herein, the CRISPR / Cas system reduces or eliminates expression of sense transcripts containing C9orf72 hexanucleotide repeats, but does not reduce or eliminate expression of transcripts starting at C9orf72 exon 1B. In some CRISPR / Cas systems disclosed herein, the CRISPR / Cas system reduces or eliminates expression of antisense transcripts containing C9orf72 hexanucleotide repeats, but does not reduce or eliminate expression of transcripts starting at C9orf72 exon 1B. In some CRISPR / Cas systems disclosed herein, the CRISPR / Cas system reduces or eliminates expression of both sense and antisense transcripts containing C9orf72 hexanucleotide repeats, but does not reduce or eliminate expression of transcripts starting at C9orf72 exon 1B. In some CRISPR / Cas systems disclosed herein, the CRISPR / Cas system reduces expression of polyGA dipeptide repeat proteins. In some CRISPR / Cas systems disclosed herein, the CRISPR / Cas system reduces the expression of polyGP dipeptide repeat proteins. In some CRISPR / Cas systems disclosed herein, the CRISPR / Cas system reduces the expression of both polyGA dipeptide repeat proteins and polyGP dipeptide repeat proteins.

[0097] II. CRISPR / Cas system targeting C9orf72 gene

[0098] The methods and compositions disclosed herein utilize clustered regularly interspaced short palindromic repeats (CRISPR) / CRISPR-associated (Cas) systems or components of such systems to inhibit transcription of the C9orf72 exon 1A transcription start site and / or inhibit transcription of sense and / or antisense transcripts comprising a hexanucleotide repeat expansion sequence in a C9orf72 gene within a cell. C9orf72 can be, for example, a human or mouse C9orf72 or a humanized C9orf72 gene. The cell can be, for example, within a subject such as a human (e.g., a neuron). The CRISPR / Cas system disclosed herein uses a nuclease-inactive Cas protein (i.e., a catalytically dead Cas protein) and can act via a CRISPR interference mechanism to spatially inhibit transcription. For example, a nuclease-inactive Cas protein can be a protein that is not fused to a heterologous transcription repressor domain, and a guide RNA can be an RNA that is not linked to a heterologous transcription repressor domain. CRISPR interference (CRISPRi) technology uses a catalytically dead Cas protein (dCas protein) that lacks endonuclease activity to regulate genes in an RNA-guided manner. CRISPRi can inhibit transcription sterically by blocking transcription initiation or elongation. This is achieved by designing guide RNAs complementary to promoter or coding sequences, respectively.

[0099] A. C9orf72, hexanucleotide repeat expansion sequences, and associated diseases

[0100] Amyotrophic lateral sclerosis (ALS), also known as Lou Gehrig's disease, is the most common adult-onset paralytic disorder characterized by the loss of upper motor neurons and / or lower motor neurons. In the United States, ALS occurs in up to 20,000 individuals, with approximately 5,000 new cases occurring each year. Frontotemporal dementia (FTD; also known as Pick's disease, frontotemporal lobar degeneration, or FTLD) is a group of disorders caused by progressive cell degeneration in the frontal or temporal lobes of the brain. FTD is reported to account for 10%-15% of all dementia cases. A hexanucleotide repeat expansion sequence between exons 1A and 1B (two non-coding exons of the human C9orf72 gene) has been associated with both ALS and FTD. It is estimated that the G4C2 hexanucleotide repeat expansion accounts for approximately 50% of familial and many non-familial ALS cases. It is present in approximately 25% of familial FTD cases and approximately 8% of sporadic FTD cases.

[0101] Many pathological aspects associated with the hexanucleotide repeat expansion sequence in C9orf72 have been reported, such as the repeat length-dependent formation of RNA foci, sequestration by specific RNA-binding proteins, and accumulation and aggregation of dipeptide repeat proteins (e.g., poly(glycine-alanine), poly(glycine-proline), poly(glycine-arginine), poly(alanine-proline), and poly(proline-arginine)) generated by its repeat-associated non-AUG (AUG) translation in neurons.

[0102] Although C9orf72 has been reported to regulate endosomal trafficking, many cellular functions of C9orf72 remain unknown. In fact, C9orf72 is a gene encoding an uncharacterized protein with unknown function.

[0103] It is not known how the C9orf72 hexanucleotide repeat expansion causes motor neuron disease and dementia, but two common postmortem pathological findings in C9orf72 ALS and FTD patients are associated with the repeat expansion: (1) RNA containing the sense and antisense repeats can be visualized as distinct foci in neurons and other cells; and (2) the dipeptide repeat proteins poly(glycine-alanine), poly(glycine-proline), poly(glycine-arginine), poly(alanine-proline), and poly(proline-arginine) can be detected in cells, synthesized by repeat-associated AUG-independent translation from the sense and antisense repeat-containing RNAs. One disease hypothesis proposes that the repeat-containing RNAs that appear as foci disrupt cellular RNA metabolism by sequestering RNA-binding proteins. Another disease hypothesis proposes that the dipeptide repeat proteins exert broad toxic effects on RNA metabolism, protein homeostasis, and nucleocytoplasmic transport. If C9orf72 repeat-containing RNA transcripts contribute to the pathogenesis of ALS and FTD either by themselves or as templates for translation of dipeptide repeat proteins, then a general therapeutic strategy would be to inhibit the synthesis of hexanucleotide repeat-containing RNAs.

[0104] The C9orf72 gene produces transcripts from two transcription start sites. The upstream site initiates transcription from the alternative noncoding exon 1A, while the downstream site initiates transcription from the alternative exon 1B. Both exons 1A and 1B can be spliced ​​into exon 2, which contains the start of the protein coding sequence. The pathogenic hexanucleotide repeat expansion is located between exons 1A and 1B. Therefore, transcription initiated from exon 1A can produce RNA containing the repeat sequence, while transcription initiated from exon 1B cannot.

[0105] Mouse C9orf72 transcript variants have been reported. See, for example, Koppers et al., (2015) Ann. Neurol. 78:426-438 and Atkinson et al., (2015) Acta Neuropathologica Communications 3:59, each of which is incorporated herein by reference in its entirety for all purposes. Genomic information for the three reported mouse C9orf72 transcript variants is also available on the Ensembl website under the names ENSMUST00000108127 (V1), ENSMUST00000108126 (V2), and ENSMUST00000084724 (V3). Exemplary non-human (e.g., rodent) C9orf72 mRNA and amino acid sequences are shown in SEQ ID NOs: 22-25. The mRNA and amino acid sequences of mouse C9orf72 can be found at GenBank Accession Nos. NM_001081343 and NP_001074812, respectively, and are hereby incorporated by reference in their entirety for all purposes. The sequences of NM_001081343.1 and NP_001074812.1 are shown in SEQ ID NOs: 22 and 23, respectively. The mRNA and amino acid sequences of rat C9orf72 can be found at GenBank Accession Nos. NM_001007702 and NP_001007703, respectively, and are hereby incorporated by reference in their entirety for all purposes. The sequences of NM_001007702.1 and NP_001007703.1 are shown in SEQ ID NOs: 24 and 25, respectively.

[0106] Human C9orf72 transcript variants are also known. One human C9orf72 transcript variant lacks multiple exons in the central and 3' coding regions, and its 3' end exon extends beyond the splice site used in variant 3 (see below), which produces a new 3' untranslated region (UTR) compared to variant 3. This variant encodes a significantly shorter polypeptide, and its C-terminal amino acid is different from the amino acids encoded by the two other variants. The mRNA and amino acid sequences of this variant can be found in GenBank Accession Nos. NM_145005.6 and NP_659442.2, respectively, and are hereby incorporated by reference in their entirety for all purposes. The sequences of NM_145005.6 and NP_659442.2 are shown in SEQ ID NO:26 and SEQ ID NO:27, respectively. Compared to variant 3, the second human C9orf72 transcript variant (2) differs in the 5' untranslated region (UTR). The mRNA and amino acid sequences of this variant can be found in GenBank Accession Nos. NM_018325.4 and NP_060795.1, respectively, and are hereby incorporated by reference in their entirety for all purposes. The sequences of NM_018325.4 and NP_060795.1 are shown in SEQ ID NO: 28 and SEQ ID NO: 29, respectively. The third human C9orf72 transcript variant (3) contains the longest sequence of the three reported variants and encodes a longer isoform. The mRNA and amino acid sequences of this variant can be found in GenBank Accession Nos. NM_001256054.2 and NP_001242983.1, respectively, and are hereby incorporated by reference in their entirety for all purposes. The sequences of NM_001256054.2 and NP_001242983.1 are shown in SEQ ID NO: 30 and SEQ ID NO: 31, respectively. Variants 2 and 3 encode the same protein.

[0107] B. CRISPR / Cas system

[0108] The methods and compositions disclosed herein utilize clustered regularly interspaced short palindromic repeats (CRISPR) / CRISPR-associated (Cas) systems or components of such systems to inhibit transcription of the C9orf72 exon 1A transcription start site and / or inhibit transcription of sense and / or antisense transcripts comprising a hexanucleotide repeat expansion sequence in the C9orf72 gene in a cell. The CRISPR / Cas system disclosed herein uses a nuclease-inactive Cas protein (i.e., a catalytically dead Cas protein) and can act via a CRISPR interference mechanism to spatially inhibit transcription. For example, a nuclease-inactive Cas protein can be a protein that is not fused to a heterologous transcription repressor domain, and a guide RNA can be an RNA that is not connected to a heterologous transcription repressor domain. CRISPR interference (CRISPRi) technology uses a catalytically dead Cas protein (dCas protein) that lacks endonuclease activity to regulate genes in an RNA-guided manner. CRISPRi can spatially inhibit transcription by blocking transcription initiation or elongation. This is achieved by designing a guide RNA that is complementary to a promoter or coding sequence, respectively.

[0109] The CRISPR / Cas system comprises transcripts and other elements involved in the expression of the Cas gene or guiding its activity. The CRISPR / Cas system can be, for example, a type I, type II, type III system, or a type V system (e.g., subtype VA or subtype VB). The methods and compositions disclosed herein can employ the CRISPR / Cas system by utilizing a CRISPR complex (including a guide RNA (gRNA) complexed with a Cas protein) for site-directed binding of nucleic acids. The CRISPR / Cas system targeting the C9orf72 gene comprises a Cas protein (or a nucleic acid encoding a Cas protein) and one or more guide RNAs (or DNA encoding one or more guide RNAs), wherein each of the one or more guide RNAs targets a different guide RNA target sequence in a target genomic locus.

[0110] The CRISPR / Cas systems used in the compositions and methods disclosed herein can be non-naturally occurring. A "non-naturally occurring" system includes anything that indicates artificiality, such as one or more components of the system being altered or mutated from their naturally occurring state, being at least substantially free of at least one other component with which it is naturally associated in nature, or being associated with at least one other component with which it is not naturally associated. For example, some CRISPR / Cas systems employ non-naturally occurring CRISPR complexes including gRNA and Cas proteins that do not occur together naturally, employ non-naturally occurring Cas proteins, or employ non-naturally occurring gRNAs.

[0111] (1) Target genomic loci

[0112] The guide RNA and CRISPR / Cas systems described in the compositions and methods disclosed herein target guide RNA target sequences in the C9orf72 gene. The C9orf72 gene can be, for example, a mammalian C9orf72 gene. In a specific example, the C9orf72 gene comprises a human C9orf72 promoter. In a specific example, the C9orf72 gene is a human C9orf72 gene. In another specific example, the C9orf72 gene is a humanized C9orf72 gene. For example, the C9orf72 gene can be a non-human animal (e.g., a non-human mammal, a rodent, a rat, or a mouse) C9orf72 gene, wherein a human hexanucleotide repeat amplification sequence and a flanking human sequence are inserted into an endogenous C9orf72 locus to replace the corresponding endogenous sequence. See, for example, US2020-0196581 and WO 2020 / 131632, each of which is incorporated herein by reference in its entirety for all purposes.

[0113] Optionally, the C9orf72 gene comprises a C9orf72 hexanucleotide repeat amplification sequence between the first non-coding endogenous exon and exon 2 of the C9orf72 gene. The C9orf72 hexanucleotide repeat amplification sequence is typically a nucleotide sequence comprising at least two tandem repeats (i.e., consecutive repeats adjacent to each other without intervening sequences) of the hexanucleotide sequence G4C2. The hexanucleotide repeat amplification sequence may have any number of repeats. Optionally, the hexanucleotide repeat amplification sequence has more than about 30 repeats. In some embodiments, the hexanucleotide repeat amplification sequence has more than about 100 repeats, more than about 200 repeats, more than about 300 repeats, more than about 400 repeats, more than about 500 repeats, more than about 600 repeats, more than about 700 repeats, more than about 800 repeats, more than about 900 repeats, or more than about 1000 repeats.

[0114] The guide RNA target sequence can be upstream or near the C9orf72 exon 1A transcription start site and / or can be within the C9orf72 hexanucleotide repeat expansion sequence between the first non-coding endogenous exon and exon 2 of C9orf72. Transcription of the C9orf72 gene initiates at two alternative non-coding exons: exon 1A (upstream) and exon 1B (downstream). The G4C2 repeat sequence is located between exons 1A and 1B. Exons 1A and 1B can be spliced ​​to exon 2 (the first protein-coding exon), thereby generating mRNA with an alternative 5'-untranslated region. In healthy people with a short G4C2 repeat sequence expansion, transcription is mainly initiated at exon 1B; RNA including exon 1A is rare, and RNA containing the repeat sequence is undetectable. People with C9orf72 ALS or FTLD accumulate transcripts in which exon 1A is spliced ​​to exon 2, and both sense and antisense repeat-containing RNAs and the DPR proteins translated from them can be detected by in situ hybridization and immunohistochemistry.

[0115] In one example, the guide RNA target sequence can be within about 250, about 225, about 200, about 175, about 150, about 125, about 100, about 75, about 50, about 25, about 20, or about 10 nucleotides of the C9orf72 exon 1A transcription start site. In another example, the guide RNA target sequence can be within about 100, within about 75, within about 50, within about 25, within about 20, or within about 10 of the C9orf72 exon 1A transcription start site.

[0116] In one example, the guide RNA target sequence can be within the C9orf72 hexanucleotide repeat expansion sequence between the first non-coding endogenous exon and exon 2 of the C9orf72 gene.

[0117] In some compositions and methods disclosed herein, two or more guide RNAs or CRISPR / Cas systems are used to target two or more guide RNA target sequences in the C9orf72 gene. In one example, each of the two or more guide RNA target sequences is upstream or near the C9orf72 exon 1A transcription start site as described above. In another example, each of the two or more guide RNA target sequences is within the C9orf72 hexanucleotide repeat expansion sequence between the first non-coding endogenous exon and exon 2 of the C9orf72 gene. In some compositions and methods disclosed herein, three or more guide RNAs or CRISPR / Cas systems are used to target three or more guide RNA target sequences in the C9orf72 gene. In one example, each of the three or more guide RNA target sequences is upstream or near the C9orf72 exon 1A transcription start site as described above. In another example, each of the three or more guide RNA target sequences is within the C9orf72 hexanucleotide repeat expansion sequence between the first non-coding endogenous exon and exon 2 of the C9orf72 gene. In another example, at least one guide RNA target sequence is upstream or near the C9orf72 exon 1A transcription start site as described above, and at least one guide RNA target sequence is within the C9orf72 hexanucleotide repeat expansion sequence between the first non-coding endogenous exon and exon 2 of C9orf72.

[0118] Some compositions or CRISPR / Cas systems include a first guide RNA that includes a first DNA targeting segment that targets a first guide RNA target sequence upstream or near the C9orf72 exon 1A transcription start site. For example, the first guide RNA target sequence can be within about 250, about 225, about 200, about 175, about 150, about 125, about 100, about 75, or about 50 nucleotides of the C9orf72 exon 1A transcription start site. Alternatively, the first guide RNA target sequence can be within about 100, about 75, or about 50 nucleotides of the C9orf72 exon 1A transcription start site or any other position disclosed herein. Some compositions or CRISPR / Cas systems include at least two guide RNAs, wherein each different guide RNA targets a different guide RNA target sequence upstream or near the C9orf72 exon 1A transcription start site. Some compositions or CRISPR / Cas systems comprise at least three guide RNAs, wherein each different guide RNA targets a different guide RNA target sequence upstream or near the C9orf72 exon 1A transcription start site. For example, each guide RNA target sequence can be within about 250, about 225, about 200, about 175, about 150, about 125, about 100, about 75, or about 50 nucleotides of the C9orf72 exon 1A transcription start site. Alternatively, each guide RNA target sequence can be within about 100, about 75, or about 50 nucleotides of the C9orf72 exon 1A transcription start site or any other position disclosed herein.

[0119] Some compositions or CRISPR / Cas systems include a guide RNA comprising a DNA targeting segment that targets a guide RNA target sequence within an expanded sequence of the C9orf72 hexanucleotide repeat between the first non-coding endogenous exon and exon 2 of the C9orf72 gene. Some compositions or CRISPR / Cas systems include at least two guide RNAs, wherein each different guide RNA targets a different guide RNA target sequence within an expanded sequence of the C9orf72 hexanucleotide repeat between the first non-coding endogenous exon and exon 2 of the C9orf72 gene. Some compositions or CRISPR / Cas systems include at least three guide RNAs, wherein each different guide RNA targets a different guide RNA target sequence within an expanded sequence of the C9orf72 hexanucleotide repeat between the first non-coding endogenous exon and exon 2 of the C9orf72 gene.

[0120] Some compositions or CRISPR / Cas systems include: (a) a first guide RNA comprising a first DNA targeting segment that targets a first guide RNA target sequence upstream or near the C9orf72 exon 1A transcription start site; and (b) a second guide RNA comprising a second DNA targeting segment that targets a second guide RNA target sequence within a C9orf72 hexanucleotide repeat expansion sequence between a first non-coding endogenous exon and exon 2 of the C9orf72 gene. In some compositions or CRISPR / Cas systems, portion (a) may comprise at least two guide RNAs, wherein each different guide RNA targets a different guide RNA target sequence upstream or near the C9orf72 exon 1A transcription start site. In some compositions or CRISPR / Cas systems, portion (a) may comprise at least three guide RNAs, wherein each different guide RNA targets a different guide RNA target sequence upstream or near the C9orf72 exon 1A transcription start site. In some compositions or CRISPR / Cas systems, portion (b) may comprise at least two guide RNAs, wherein each different guide RNA targets a different guide RNA target sequence within the expanded sequence of the C9orf72 hexanucleotide repeat between the first non-coding endogenous exon and exon 2 of the C9orf72 gene. In some compositions or CRISPR / Cas systems, portion (b) may comprise at least three guide RNAs, wherein each different guide RNA targets a different guide RNA target sequence within the expanded sequence of the C9orf72 hexanucleotide repeat between the first non-coding endogenous exon and exon 2 of the C9orf72 gene.

[0121] (2) Cas proteins

[0122] Cas proteins generally include at least one RNA recognition or binding domain that can interact with guide RNA. Cas proteins can also include nuclease domains (e.g., DNase domains or RNase domains), DNA binding domains, helicase domains, protein-protein interaction domains, dimerization domains and other domains. Some such domains (e.g., DNase domains) can be from natural Cas proteins. Other such domains can be added to prepare modified Cas proteins. The nuclease domain has catalytic activity for nucleic acid cutting, which comprises the breaking of covalent bonds of nucleic acid molecules. Cutting can produce blunt ends or staggered ends, and cutting can be single-stranded or double-stranded. For example, wild-type Cas9 proteins usually form blunt-end cutting products. Alternatively, wild-type Cpf1 proteins (e.g., FnCpf1) can obtain cutting products with 5-nucleotide 5' overhangs, wherein cutting occurs after the 18th base pair of the PAM sequence on the non-targeting chain and after the 23rd base on the targeting chain. The Cas protein may have full cleavage activity to form double-strand breaks (e.g., double-strand breaks with blunt ends) at the target genomic locus, or it may be a nickase that forms single-strand breaks at the target genomic locus. The Cas protein used in the CRISPR / Cas systems and methods disclosed herein is a nuclease-inactive Cas protein (i.e., a catalytically dead Cas protein).

[0123] Examples of Cas proteins include Cas1, Cas1B, Cas2, Cas3, Cas4, Cas5, Cas5e (CasD), Cas6, Cas6e, Cas6f, Cas7, Cas8a1, Cas8a2, Cas8b, Cas8c, Cas9 (Csn1 or Csx12), Cas10, Cas10d, CasF, CasG, CasH, Csy1, Csy2, Csy3, Cse1 (CasA), Cse2 (CasB), Cse3 (Csn1), and Csx2. asE), Cse4 (CasC), Csc1, Csc2, Csa5, Csn2, Csm2, Csm3, Csm4, Csm5, Csm6, Cmr1, Cmr3, Cmr4, Cmr5, Cmr6, Csb1, Csb2, Csb3, Csx17, Csx14, Csx10, Csx16, CsaX, Csx3, Csx1, Csx15, Csf1, Csf2, Csf3, Csf4 and Cu1966, and homologs or modified versions thereof.

[0124] An exemplary Cas protein is a Cas9 protein or a protein derived from a Cas9 protein. The Cas9 protein is from a type II CRISPR / Cas system and generally shares four key motifs with a conserved architecture. Motifs 1, 2, and 4 are RuvC-like motifs, and motif 3 is a HNH motif. Exemplary Cas9 proteins are from Streptococcus pyogenes, Streptococcus thermophilus, Streptococcus sp., Staphylococcus aureus, Nocardiopsis dassonvillei, Streptomyces pristinaespiralis, Streptomyces viridochromogenes, Streptomyces viridochromogenes, Streptosporangium roseum, Streptosporangium roseum, Alicyclobacillus acidocaldarius, Bacillus pseudomycoides, Bacillus selenitireducens, Exiguobacterium sibiricum, Lactobacillus delbrueckii, Lactobacillus salivarius. salivarius), Microscilla marina, Burkholderiales bacterium, Polaromonas naphthalenivorans, Polaromonas sp., Crocosphaera watsonii, Cyanothece sp., Microcystis aeruginosa, Synechococcus sp.), Acetohalobiumarabaticum, Ammonifex degensii, Caldicelulosiruptor becscii, Candidatus Desulforudis, Clostridium botulinum, Clostridium difficile, Finegoldia magna, Natranaerobius thermophilus, Pelotomaculumthermopropionicum, Acidithiobacillus caldus, Acidithiobacillus ferrooxidans, Allochromatium vinosum, Marinobacter sp., Nitrosococcus halophilus), Nitrosococcus watsoni, Pseudoalteromonas haloplanktis, Ktedonobacter racemijer, Methanohalobium evestigatum, Anabaena variabilis, Nodularia spumigena, Nostoc sp., Arthrospira maxima, Arthrospira platensis, Arthrospira sp., Lyngbya sp., Microcoleuschthonoplastes, Oscillatoria sp.), Petrotoga mobilis, Thermosipho africanus, Acaryochloris marina, Neisseria meningitidis, or Campylobacter jejuni. Additional examples of Cas9 family members are described in WO 2014 / 131833, which is incorporated herein by reference in its entirety for all purposes. Cas9 (SpCas9) from Streptococcus pyogenes (e.g., assigned UniProt accession number Q99ZW2) is an exemplary Cas9 protein. An exemplary SpCas9 protein sequence is shown in SEQ ID NO: 1 (encoded by the DNA sequence shown in SEQ ID NO: 2). Smaller Cas9 proteins (e.g., Cas9 proteins whose coding sequences are compatible with maximum AAV packaging capacity when combined with guide RNA coding sequences and regulatory elements of Cas9 and guide RNA, such as SaCas9 and CjCas9 and Nme2Cas9) are other exemplary Cas9 proteins. For example, Cas9 (SaCas9) from Staphylococcus aureus (assigned UniProt accession number J7RUA5) is another exemplary Cas9 protein. Similarly, Cas9 (CjCas9) from Campylobacter jejuni (e.g., assigned UniProt accession number Q0P897) is another exemplary Cas9 protein. See, e.g., Kim et al., (2017) Nat. Commun. 8: 14500, which is incorporated herein by reference in its entirety for all purposes. SaCas9 is smaller than SpCas9, and CjCas9 is smaller than both SaCas9 and SpCas9. Cas9 (Nme2Cas9) from Neisseria meningitidis is another exemplary Cas9 protein. See, e.g., Edraki et al., (2019) Mol.Cell 73 (4): 714-726, which is incorporated herein by reference in its entirety for all purposes. Cas9 proteins from Streptococcus thermophilus (e.g., Streptococcus thermophilus LMD-9Cas9 (St1Cas9) encoded by the CRISPR1 locus or Streptococcus thermophilus Cas9 (St3Cas9) from the CRISPR3 locus) are other exemplary Cas9 proteins. Cas9 from Francisella novicida (FnCas9) or RHA Francisella novicida Cas9 variants that recognize alternative PAMs (E1369R / E1449H / R1556A substitutions) are other exemplary Cas9 proteins. These and other exemplary Cas9 proteins are reviewed in, for example, Cebrian-Serrano and Davies (2017) Mamm. Genome 28 (7): 247-261, which is incorporated herein by reference in its entirety for all purposes. Examples of Cas9 coding sequences, Cas9 mRNAs, and Cas9 protein sequences are provided in WO 2013 / 176772, WO 2014 / 065596, WO 2016 / 106121, WO2019 / 067910, WO 2020 / 082042, US2020 / 0270617, WO 2020 / 082041, US2020 / 0268906, WO2020 / 082046, and US2020 / 0289628, each of which is incorporated herein by reference in its entirety for all purposes. Specific examples of ORFs and Cas9 amino acid sequences are provided in Table 30 of paragraph

[0449] of WO 2019 / 067910, and specific examples of Cas9 mRNAs and ORFs are provided in paragraphs

[0214] -

[0234] of WO 2019 / 067910. See also Table 24 in WO 2020 / 082046A2 (pp. 84-85) and WO 2020 / 069296, each of which is incorporated herein by reference in its entirety for all purposes. .

[0125] Another example of a Cas protein is the Cpf1 (CRISPR from Prevotella and Francisella 1; Cas12a) protein. Cpf1 is a large protein (about 1300 amino acids) containing a RuvC-like nuclease domain homologous to the corresponding domain of Cas9 and a counterpart to the characteristic arginine-rich Cas9 cluster. However, Cpf1 lacks the HNH nuclease domain present in the Cas9 protein, and the RuvC-like domain is continuous in the Cpf1 sequence, unlike Cas9, which contains a long insert containing the HNH domain. See, e.g., Zetsche et al., (2015) Cell 163(3):759-771, which is incorporated herein by reference in its entirety for all purposes. Exemplary Cpf1 proteins are from Francisella tularensis 1, Francisella tularensis subsp. novicida, Prevotella albensis, Lachnospiraceae bacterium MC20171, Butyrivibrio proteoclasticus, Peregrinibacteria bacterium GW2011_GWA2_33_10, Parcubacteria bacterium GW2011_GWC2_4417, Smithella sp. SCADC, Acidaminococcus sp.) BV3L6, Lachnospiraceae bacterium MA2020, Candidates Methanoplasma termitum, Eubacterium eligens, Moraxella bovoculi 237, Leptospira inadai, Lachnospiraceae bacterium ND2006, Porphyromonas crevioricanis 3, Prevotella disiens, and Porphyromonas macacae.Cpf1 from Francisella novicida U112 (FnCpf1; assigned UniProt accession number A0Q7Q2) is an exemplary Cpf1 protein.

[0126] Another example of a Cas protein is CasX (Cas12e). CasX is an RNA-guided DNA endonuclease that generates staggered double-strand breaks in DNA. The size of CasX is less than 1000 amino acids. Exemplary CasX proteins are from Deltaproteobacteria (DpbCasX or DpbCas12e) and Planctomycetes (PlmCasX or PlmCas12e). Similar to Cpf1, CasX uses a single RuvC active site for DNA cutting. See, for example, Liu et al., (2019) Nature 566 (7743): 218-223, which is incorporated herein by reference in its entirety for all purposes.

[0127] Another example of a Cas protein is CasΦ (CasPhi or Cas12j), which is uniquely present in bacteriophages. The size of CasΦ is less than 1000 amino acids (e.g., 700-800 amino acids). CasΦ cleavage generates staggered 5' overhangs. The single RuvC active site in CasΦ is capable of crRNA processing and DNA cleavage. See, for example, Pausch et al., (2020) Science 369 (6501): 333-337, which is incorporated herein by reference in its entirety for all purposes.

[0128] The Cas protein can be a modified Cas protein (i.e., a Cas protein variant) or a fragment of a wild-type or modified Cas protein.

[0129] An example of a modified Cas protein is a modified SpCas9-HF1 protein, which is a high-fidelity variant of Streptococcus pyogenes Cas9 with changes (N497A / R661A / Q695A / Q926A) designed to reduce non-specific DNA contacts. See, for example, Kleinstiver et al., (2016) Nature 529(7587):490-495, which is incorporated herein by reference in its entirety for all purposes. Another example of a modified Cas protein is a modified eSpCas9 variant (K848A / K1003A / R1060A) designed to reduce off-target effects. See, for example, Slaymaker et al., (2016) Science 351(6268):84-88, which is incorporated herein by reference in its entirety for all purposes. Other SpCas9 variants include K855A and K810A / K1003A / R1060A. These and other modified Cas proteins are reviewed in, for example, Cebrian-Serrano and Davies (2017) Mamm. Genome 28 (7): 247-261, which is incorporated herein by reference in its entirety for all purposes. Another example of a modified Cas9 protein is xCas9, which is a SpCas9 variant that can recognize an expanded range of PAM sequences. See, for example, Hu et al., (2018) Nature 556: 57-63, which is incorporated herein by reference in its entirety for all purposes.

[0130] The Cas protein can be modified to increase or decrease one or more of nucleic acid binding affinity, nucleic acid binding specificity, and enzymatic activity. The Cas protein can also be modified to change any other activity or property of the protein, such as stability. For example, one or more nuclease domains of the Cas protein can be modified, deleted, or inactivated, or the Cas protein can be truncated to remove domains that are unnecessary for protein function or to optimize (e.g., enhance or reduce) the activity or property of the Cas protein.

[0131] Cas proteins can include at least one nuclease domain, such as a DNase domain. For example, wild-type Cpf1 proteins typically include a RuvC-like domain that cuts two chains of target DNA, which may be in a dimer configuration. Similarly, CasX and CasΦ typically include a single RuvC-like domain that cuts two chains of target DNA. Cas proteins can also include at least two nuclease domains, such as DNase domains. For example, wild-type Cas9 proteins typically include a RuvC-like nuclease domain and an HNH-like nuclease domain. The RuvC domain and the HNH domain can each cut different chains of double-stranded DNA to form double-strand breaks in DNA. See, for example, Jinek et al., (2012) Science 337 (6096): 816-821, which is incorporated herein by reference in its entirety for all purposes.

[0132] One or more nuclease domains in the nuclease domain can be missing or mutated so that it no longer has function or has reduced nuclease activity. For example, if one of the nuclease domains in the Cas9 protein is missing or mutated, the resulting Cas9 protein can be referred to as a nickase, and single-strand breaks can be generated in double-stranded target DNA but double-strand breaks will not be generated (i.e., it can cut complementary strands or non-complementary strands, but cannot cut both at the same time). If there is no missing or mutation of any nuclease domain in the Cas9 protein, the Cas9 protein will retain double-strand break inducing activity. The example of a mutation that converts Cas9 into a nickase is a D10A (aspartic acid to alanine at position 10 of Cas9) mutation in the RuvC domain of Cas9 from Streptococcus pyogenes. Similarly, H939A (histidine to alanine at amino acid position 839), H840A (histidine to alanine at amino acid position 840), or N863A (asparagine to alanine at amino acid position N863) in the HNH domain of Cas9 from Streptococcus pyogenes can convert Cas9 into a nickase. Other examples of mutations that convert Cas9 into a nickase include corresponding mutations of Cas9 from Streptococcus thermophilus. See, for example, Sapranauskas et al., (2011) Nucleic Acids Res. 39 (21): 9275-9282 and WO2013 / 141680, each of which is incorporated herein by reference in its entirety for all purposes. Such mutations can be generated using methods such as site-directed mutagenesis, PCR-mediated mutagenesis, or total gene synthesis. Examples of other mutations that form nickases can be found, for example, in WO 2013 / 176772 and WO 2013 / 142578, each of which is herein incorporated by reference in its entirety for all purposes.

[0133] Examples of inactivating mutations in the catalytic domain of xCas9 are the same as those described above for SpCas9. Examples of inactivating mutations in the catalytic domain of Staphylococcus aureus Cas9 protein are also known. For example, Staphylococcus aureus Cas9 enzyme (SaCas9) may include a substitution at position N580 (e.g., N580A substitution) and a substitution at position D10 (e.g., D10A substitution) to generate a Cas nickase. See, for example, WO 2016 / 106236, which is incorporated herein by reference as a whole for all purposes. Examples of inactivating mutations in the catalytic domain of Nme2Cas9 are also known (e.g., D16A or H588A). Examples of inactivating mutations in the catalytic domain of St1Cas9 are also known (e.g., D9A, D598A, H599A or N622A). Examples of inactivating mutations in the catalytic domain of St3Cas9 are also known (e.g., D10A or N870A). Examples of inactivating mutations in the catalytic domain of CjCas9 are also known (e.g., a combination of D8A or H559A). Examples of inactivating mutations in the catalytic domain of FnCas9 and RHA FnCas9 are also known (e.g., N995A).

[0134] Examples of inactivating mutations in the catalytic domain of Cpf1 proteins are also known. With reference to Cpf1 proteins from Francisella novicida U112 (FnCpf1), Acidaminococcus sp. BV3L6 (AsCpf1), Lachnospiraceae sp. ND2006 (LbCpf1), and Moraxella bovis 237 (MbCpf1 Cpf1), such mutations may include mutations at positions 908, 993, or 1263 of AsCpf1, or at corresponding positions in Cpf1 orthologs, or at positions 832, 925, 947, or 1180 of LbCpf1, or at corresponding positions in Cpf1 orthologs. Such mutations may include, for example, one or more of the mutations D908A, E993A, and D1263A of AsCpf1 or corresponding mutations in Cpf1 orthologs, or D832A, E925A, D947A, and D1180A of LbCpf1 or corresponding mutations in Cpf1 orthologs. See, for example, US2016 / 0208243, which is incorporated herein by reference in its entirety for all purposes.

[0135] Examples of inactivating mutations in the catalytic domain of CasX proteins are also known. With reference to CasX proteins from deltaproteobacteria, D672A, E769A and D935A (alone or in combination) or corresponding positions in other CasX orthologs are inactivated. See, for example, Liu et al., (2019) Nature 566 (7743): 218-223, which is incorporated herein by reference in its entirety for all purposes.

[0136] Examples of inactivating mutations in the catalytic domain of CasΦ proteins are also known. For example, D371A and D394A, alone or in combination, are inactivating mutations. See, for example, Pausch et al., (2020) Science 369(6501):333-337, which is incorporated herein by reference in its entirety for all purposes.

[0137] Cas proteins can also be operably linked to heterologous polypeptides as fusion proteins. See WO2014 / 089290, which is incorporated herein by reference in its entirety for all purposes. Cas proteins can also be fused to heterologous polypeptides to provide increased or decreased stability. The fusion domain or heterologous polypeptide can be located at the N-terminus, C-terminus, or inside the Cas protein.

[0138] As an example, the Cas protein can be fused to one or more heterologous polypeptides that provide subcellular localization. Such heterologous polypeptides may include, for example, one or more nuclear localization signals (NLS), such as a single-point SV40 NLS for targeting the nucleus and / or a double-point α-import protein NLS, a mitochondrial localization signal for targeting mitochondria, an ER retention signal, etc. See, for example, Lange et al., (2007) J. Biol. Chem. 282 (8): 5101-5105, which is incorporated herein by reference in its entirety for all purposes. Such subcellular localization signals may be located at any position within the N-terminus, the C-terminus, or the Cas protein. The NLS may include a basic amino acid segment and may be a single-point sequence or a double-point sequence. Optionally, the Cas protein may include two or more NLSs, including an NLS at the N-terminus (e.g., an α-import protein NLS or a single-point NLS) and an NLS at the C-terminus (e.g., an SV40 NLS or a double-point NLS). The Cas protein may also include two or more NLSs at the N-terminus and / or two or more NLSs at the C-terminus.

[0139] For example, the Cas protein can be fused with 1-10 NLSs (e.g., fused with 1-5 NLSs or fused with one NLS). In the case of using one NLS, the NLS can be connected to the N-terminus or C-terminus of the Cas protein sequence. It can also be inserted into the Cas protein sequence. Alternatively, the Cas protein can be fused with more than one NLS. For example, the Cas protein can be fused with 2, 3, 4 or 5 NLSs. In a specific example, the Cas protein can be fused with two NLSs. In some cases, the two NLSs can be the same (e.g., two SV40 NLSs) or different. For example, the Cas protein can be fused with two SV40 NLS sequences connected at the carboxyl termini. Alternatively, the Cas protein can be fused with two NLSs, one connected to the N-terminus, and one connected to the C-terminus. In other examples, the Cas protein can be fused with 3 NLSs or not fused with NLSs. NLS can be a monopartite sequence, such as SV40NLS, PKKKRKV (SEQ ID NO: 3) or PKKKRRV (SEQ ID NO: 4). The NLS can be a bipartite sequence, such as the NLS of the nucleoplasmic protein, KRPAATKKAGQAKKKK (SEQ ID NO: 5). In a specific example, a single PKKKRKV (SEQ ID NO: 3) NLS can be attached to the C-terminus of the Cas protein. One or more linkers are optionally included at the fusion site.

[0140] Cas protein can also be operably connected to a cell penetration domain or a protein transduction domain. For example, the cell penetration domain can be derived from HIV-1TAT protein, TLM cell penetration motif from human hepatitis B virus, MPG, Pep-1, VP22, cell penetration peptides from herpes simplex virus or polyarginine peptide sequences. See, for example, WO 2014 / 089290 and WO2013 / 176772, each of which is incorporated herein by reference for all purposes. The cell penetration domain can be located at any position in the N-terminus, C-terminus or Cas protein.

[0141] Cas proteins can also be operably linked to heterologous polypeptides for tracking or purification, such as fluorescent proteins, purification tags or epitope tags. Examples of fluorescent proteins include green fluorescent proteins (e.g., GFP, GFP-2, tagGFP, turboGFP, eGFP, emerald, Azami green, monomeric Azami green, CopGFP, AceGFP, ZsGreenl), yellow fluorescent proteins (e.g., YFP, eYFP, lemon yellow, Venus, YPet, PhiYFP, ZsYellowl), blue fluorescent proteins (e.g., eBFP, eBFP2, azurite, mKalamal, GFPuv, sky blue, T-sky blue (T-sapphire)), cyan fluorescent proteins (e.g., eCFP, Cerulean, CyPet, AmCyanl, Midoriishi-Cyan), red fluorescent proteins (e.g., mKate, mKate2, mPlum, DsRed monomer, mCherry, mRFP1, DsRed-expressed, DsRed2, DsRed-monomer, HcRed-Tandem, HcRedl, AsRed2, eqFP611, mRaspberry, mStrawberry, Jred), orange fluorescent proteins (e.g., mOrange, mKO, Kusabira-Orange, monomeric Kusabira-Orange, mTangerine, tdTomato), and any other suitable fluorescent protein. Examples of tags include glutathione-S-transferase (GST), chitin binding protein (CBP), maltose binding protein, thioredoxin (TRX), poly(NANP), tandem affinity purification (TAP) tag, myc, AcV5, AU1, AU5, E, ECS, E2, FLAG, hemagglutinin (HA), nus, Softag 1, Softag 3, Strep, SBP, Glu-Glu, HSV, KT3, S, S1, T7, V5, VSV-G, histidine (His), biotin carboxyl carrier protein (BCCP), and calmodulin.

[0142] Cas proteins can also be tethered to labeled nucleic acids. This tethering (i.e., physical connection) can be achieved through covalent interactions or non-covalent interactions, and the tethering can be direct (e.g., by direct fusion or chemical conjugation, which can be achieved by modification of cysteine ​​or lysine residues on the protein or intron modification), or can be achieved through one or more intermediate joints or adapter molecules such as streptavidin or aptamers. See, e.g., Pierce et al., (2005) Mini Rev. Med. Chem. 5(1):41-55; Duckworth et al., (2007) Angew. Chem. Int. Ed. Engl. 46(46):8819-8822; Schaeffer and Dixon (2009) Australian J. Chem. 62(10):1328-1332; Goodman et al., (2009) Chembiochem. 10(9):1551-1557; and Khatwani et al., (2012) Bioorg. Med. Chem. 20(14):4532-4539, each of which is incorporated herein by reference in its entirety for all purposes. Non-covalent strategies for synthesizing protein-nucleic acid conjugates include biotin-streptavidin and nickel-histidine methods. Covalent protein-nucleic acid conjugates can be synthesized by connecting appropriately functionalized nucleic acids and proteins using a variety of chemical reactions. Some of these chemical reactions involve attaching oligonucleotides directly to amino acid residues (e.g., lysine amines or cysteine ​​thiols) on the surface of proteins, while other more complex schemes require the participation of post-translational modifications of proteins or catalytic or reactive protein domains. Methods for covalently linking proteins to nucleic acids may include, for example, chemical crosslinking of oligonucleotides with protein lysine or cysteine ​​residues, expressed protein connections, chemoenzymatic methods, and the use of photoaptamers. Labeled nucleic acids can be tethered to the C-terminal, N-terminal, or internal regions in Cas proteins. In one example, labeled nucleic acids are tethered to the C-terminal or N-terminal of Cas proteins. Similarly, Cas proteins can be tethered to the 5' end, 3' end, or internal regions in labeled nucleic acids. That is, labeled nucleic acids can be tethered in any orientation and polarity. For example, Cas proteins can be tethered to the 5' end or 3' end of labeled nucleic acids.

[0143] Cas protein can be provided in any form. For example, Cas protein can be provided in the form of protein, such as Cas protein complexed with gRNA. Alternatively, Cas protein can be provided in the form of nucleic acid encoding Cas protein, such as RNA (e.g., messenger RNA (mRNA)) or DNA. Optionally, the nucleic acid encoding Cas protein can be codon optimized to be effectively translated into protein in a specific cell or organism. For example, compared with the naturally occurring polynucleotide sequence, the nucleic acid encoding Cas protein can be modified to replace codons with higher usage frequencies in bacterial cells, yeast cells, human cells, non-human cells, mammalian cells, rodent cells, mouse cells, rat cells or any other host cells of interest. When the nucleic acid encoding Cas protein is introduced into a cell, the Cas protein can be expressed transiently, conditionally or constitutively in the cell.

[0144] The nucleic acid encoding the Cas protein can be stably integrated into the genome of the cell and operably connected to a promoter active in the cell. Alternatively, the nucleic acid encoding the Cas protein can be operably connected to a promoter in an expression construct. The expression construct comprises any nucleic acid construct that can guide the expression of a gene or other nucleic acid sequence of interest (e.g., Cas gene) and can transfer such nucleic acid sequence of interest to a target cell. For example, the nucleic acid encoding the Cas protein can be in a vector including a DNA encoding a gRNA. Alternatively, it can be in a vector or plasmid separated from a vector comprising a DNA encoding a gRNA. The promoter that can be used for the expression construct includes, for example, a promoter active in human neurons or human motor neurons. Such promoters can be, for example, conditional promoters, inducible promoters, constitutive promoters, or tissue-specific promoters. Optionally, the promoter can be a bidirectional promoter that drives the expression of the Cas protein in one direction and drives the expression of the guide RNA in another direction. Such bidirectional promoters may consist of: (1) a complete, conventional unidirectional Pol III promoter containing three external control elements: a distal sequence element (DSE), a proximal sequence element (PSE), and a TATA box; and (2) a second basic Pol III promoter comprising a PSE and a TATA box fused to the 5' end of the DSE in the opposite orientation. For example, in the H1 promoter, the DSE is adjacent to the PSE and the TATA box, and the promoter can be bidirectionalized by generating a hybrid promoter in which reverse transcription is controlled by an additional PSE and a TATA box derived from the U6 promoter. See, for example, US2016 / 0074535, which is incorporated herein by reference in its entirety for all purposes. The use of a bidirectional promoter to simultaneously express genes encoding Cas proteins and guide RNAs allows the generation of compact expression cassettes to facilitate delivery. In certain embodiments, the promoter is accepted by regulatory agencies for use in humans. In certain embodiments, the promoter drives expression in neurons.

[0145] Different promoters can be used to drive Cas expression or Cas9 expression. In some methods, a small promoter is used so that the Cas or Cas9 coding sequence can be adapted to an AAV construct. For example, Cas or Cas9 and one or more gRNAs (e.g., 1 gRNA or 2 gRNAs or 3 gRNAs or 4 gRNAs) can be delivered via LNP-mediated delivery (e.g., in the form of RNA) or adeno-associated virus (AAV)-mediated delivery (e.g., AAV8-mediated delivery). For example, the nuclease agent can be CRISPR / Cas9, and Cas9 mRNA and gRNA (e.g., targeting the C9orf72 gene upstream or near the exon 1A transcription start site (e.g., human C9orf72 gene)) can be delivered via LNP-mediated delivery or AAV-mediated delivery. Cas or Cas9 and gRNA can be delivered in a single AAV or via two separate AAVs. For example, the first AAV can carry a Cas or Cas9 expression cassette, and the second AAV can carry a gRNA expression cassette. Similarly, the first AAV can carry a Cas or Cas9 expression cassette, and the second AAV can carry two or more gRNA expression cassettes. Alternatively, a single AAV can carry a Cas or Cas9 expression cassette (e.g., a Cas or Cas9 coding sequence operably connected to a promoter) and a gRNA expression cassette (e.g., a gRNA coding sequence operably connected to a promoter). Similarly, a single AAV can carry a Cas or Cas9 expression cassette (e.g., a Cas or Cas9 coding sequence operably connected to a promoter) and two or more gRNA expression cassettes (e.g., a gRNA coding sequence operably connected to a promoter). Different promoters can be used to drive the expression of gRNA, such as U6 promoter or small tRNA Gln. Similarly, different promoters can be used to drive Cas9 expression. For example, a small promoter is used so that the Cas9 coding sequence can be adapted to an AAV construct. Similarly, a small Cas9 protein (e.g., SaCas9 or CjCas9 is used to maximize AAV packaging capacity).

[0146] The Cas protein provided as mRNA can be modified to improve stability and / or immunogenic properties. One or more nucleosides in the mRNA can be modified. The mRNA encoding the Cas protein can also be capped. The Cas mRNA can further include an adenylated (poly-A or poly(A) or poly-adenine) tail. For example, the Cas mRNA can include modifications to one or more nucleosides in the mRNA, the Cas mRNA can be capped, and the Cas mRNA can include a poly(A) tail.

[0147] (3) Guide RNA

[0148] "Guide RNA" or "gRNA" is an RNA molecule that binds to a Cas protein (e.g., Cas9 protein) and targets the Cas protein to a specific location within the target DNA. A guide RNA may comprise two segments: a "DNA targeting segment" (also referred to as a "guide sequence") and a "protein binding segment". A "fragment" includes a segment or region of a molecule, such as a continuous nucleotide segment in an RNA. Some gRNAs, such as those of Cas9, may comprise two separate RNA molecules: an "activator RNA" (e.g., tracrRNA) and a "targeting factor RNA" (e.g., CRISPR RNA or crRNA). Other gRNAs are single RNA molecules (single RNA polynucleotides), which may also be referred to as "single molecule gRNA", "single guide RNA" or "sgRNA". See, for example, WO 2013 / 176772, WO2014 / 065596, WO2014 / 089290, WO 2014 / 093622, WO 2014 / 099750, WO2013 / 142578, and WO 2014 / 131833, each of which is incorporated herein by reference in its entirety for all purposes. Guide RNA may refer to a combination of CRISPR RNA (crRNA) or crRNA and trans-activating CRISPR RNA (tracrRNA). CrRNA and tracrRNA may be associated as a single RNA molecule (single guide RNA or sgRNA) or in two separate RNA molecules (dual guide RNA or dgRNA). For example, for Cas9, a single guide RNA may include (e.g., via a linker) a crRNA fused to tracrRNA. For example, for Cpf1 and CasΦ, only crRNA is required to achieve binding to the target sequence. The terms "guide RNA" and "gRNA" include both bimolecular (ie, modular) gRNAs and unimolecular gRNAs. In some methods and compositions disclosed herein, the gRNA is a Streptococcus pyogenes Cas9 gRNA or its equivalent. In some methods and compositions disclosed herein, the gRNA is a Staphylococcus aureus Cas9 gRNA or its equivalent.

[0149] An exemplary bimolecular gRNA comprises a crRNA-like ("CRISPR RNA" or "targeting factor RNA" or "crRNA" or "crRNA repeat") molecule and a corresponding tracrRNA-like ("trans-activating CRISPR RNA" or "activating factor RNA" or "tracrRNA") molecule. The crRNA comprises a DNA targeting segment (single strand) of the gRNA and a nucleotide segment that forms half of the dsRNA duplex of the protein binding segment of the gRNA. Examples of crRNA tails (e.g., for Streptococcus pyogenes Cas9) located downstream (3') of the DNA targeting segment include, essentially consisting of, or consisting of GUUUUAGAGCUAUGCU (SEQ ID NO: 6) or GUUUUAGAGCUAUGCUGUUUUG (SEQ ID NO: 7). Any DNA targeting segment disclosed herein can be joined to the 5' end of SEQ ID NO: 6 or 7 to form a crRNA.

[0150] The corresponding tracrRNA (activator RNA) contains the nucleotide segment of the other half of the dsRNA duplex that forms the protein binding segment of the gRNA. The nucleotide segment of the crRNA is complementary to the nucleotide segment of the tracrRNA and hybridizes with it to form the dsRNA duplex of the protein binding domain of the gRNA. Therefore, each crRNA can be regarded as having a corresponding tracrRNA. Examples of tracrRNA sequences (e.g., for S. pyogenes Cas9) include, consist essentially of, or consist of any of AGCAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACC GAGUCGGUGCUUU (SEQ ID NO: 8), AAACAGCAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGG CACCGAGUCGGUGCUUUU (SEQ ID NO: 9), or GUUGGAACCAUUCAAAACAGCAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCA ACUUGAAAAAGUGGCACCGAGUCGGUGC (SEQ ID NO: 10).

[0151] In a system where both crRNA and tracrRNA are needed, crRNA and corresponding tracrRNA hybridize to form gRNA. In a system where only crRNA is needed, crRNA can be gRNA. CrRNA also provides a single-stranded DNA targeting segment hybridized with the complementary strand of the target DNA. If used for intracellular modification, the exact sequence of a given crRNA or tracrRNA molecule can be designed to be specific to the species in which the RNA molecule will be used. See, e.g., Mali et al., (2013) Science 339(6121):823-826; Jinek et al., (2012) Science 337(6096):816-821; Hwang et al., (2013) Nat. Biotechnol. 31(3):227-229; Jiang et al., (2013) Nat. Biotechnol. 31(3):233-239; and Cong et al., (2013) Science 339(6121):819-823, each of which is incorporated herein by reference in its entirety for all purposes.

[0152] The DNA targeting segment (crRNA) of a given gRNA comprises a nucleotide sequence complementary to the sequence on the complementary strand of the target DNA, as described in more detail below. The DNA targeting segment of gRNA interacts with the target DNA in a sequence-specific manner via hybridization (i.e., base pairing). Therefore, the nucleotide sequence of the DNA targeting segment can be different, and the position in the target DNA with which the gRNA and the target DNA will interact is determined. The DNA targeting segment of the subject's gRNA can be modified to hybridize with any desired sequence in the target DNA. Naturally occurring crRNA is different from CRISPR / Cas systems and organisms, but generally contains a targeting segment with a length between 21 and 72 nucleotides, which is flanked by two direct repeats (DR) with a length between 21 and 46 nucleotides (see, for example, WO 2014 / 131833, which is incorporated herein by reference as a whole for all purposes). For Streptococcus pyogenes, the length of DR is 36 nucleotides, and the length of the targeting segment is 30 nucleotides. The DR at 3' is complementary and hybridized with the corresponding tracrRNA, which in turn binds to the Cas protein.

[0153] The length of the DNA targeting segment can be, for example, at least about 12, at least about 15, at least about 17, at least about 18, at least about 19, at least about 20, at least about 25, at least about 30, at least about 35, or at least about 40 nucleotides. The length of such DNA targeting segments can be, for example, about 12 to about 100, about 12 to about 80, about 12 to about 50, about 12 to about 40, about 12 to about 30, about 12 to about 25, or about 12 to about 20 nucleotides. For example, the DNA targeting segment can be about 15 to about 25 nucleotides (e.g., about 17 to about 20 nucleotides or about 17, 18, 19, or 20 nucleotides). See, for example, US2016 / 0024523, which is incorporated herein by reference in its entirety for all purposes. For Cas9 from S. pyogenes, a typical DNA targeting segment is between 16 and 20 nucleotides or between 17 and 20 nucleotides in length. For Cas9 from S. aureus, a typical DNA targeting segment is between 21 and 23 nucleotides in length. For Cpf1, a typical DNA targeting segment is at least 16 nucleotides or at least 18 nucleotides in length.

[0154] In one example, the length of the DNA targeting segment can be about 20 nucleotides. However, shorter and longer sequences can also be used for the targeting segment (e.g., a length of 15-25 nucleotides, such as a length of 15, 16, 17, 18, 19, 20, 21, 22, 23, 24 or 25 nucleotides). The degree of identity between the DNA targeting segment and the corresponding guide RNA target sequence (or the degree of complementarity between the DNA targeting segment and the other strand of the guide RNA target sequence) can be, for example, about 75%, about 80%, about 85%, about 90%, about 95% or about 100%. The DNA targeting segment and the corresponding guide RNA target sequence can include one or more mismatches. For example, the DNA targeting segment of the guide RNA and the corresponding guide RNA target sequence can contain 1-4, 1-3, 1-2, 1, 2, 3 or 4 mismatches (e.g., wherein the total length of the guide RNA target sequence is at least 17, at least 18, at least 19 or at least 20 or more nucleotides). For example, the DNA targeting segment of the guide RNA and the corresponding guide RNA target sequence can contain 1-4, 1-3, 1-2, 1, 2, 3, or 4 mismatches, wherein the total length of the guide RNA target sequence is 20 nucleotides.

[0155] As an example, a guide RNA targeting a C9orf72 gene upstream or near the C9orf72 exon 1A transcription start site (e.g., a mouse C9orf72 guide RNA target sequence upstream or near the C9orf72 exon 1A transcription start site) can include a DNA targeting segment (i.e., a guide sequence) that includes, consists essentially of, or consists of a sequence as set forth in any one of SEQ ID NOs: 72-91 (DNA targeting segment). Alternatively, a guide RNA targeting a C9orf72 gene upstream or near the C9orf72 exon 1A transcription start site (e.g., a mouse C9orf72 guide RNA target sequence upstream or near the C9orf72 exon 1A transcription start site) can include a DNA targeting segment that includes, consists essentially of, or consists of at least 17, at least 18, at least 19, or at least 20 consecutive nucleotides of a sequence as set forth in any one of SEQ ID NOs: 72-91 (DNA targeting segment). Alternatively, a guide RNA targeting a C9orf72 gene upstream or near the C9orf72 exon 1A transcription start site (e.g., a mouse C9orf72 guide RNA target sequence upstream or near the C9orf72 exon 1A transcription start site) may comprise a DNA targeting segment that is at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% identical to a sequence (DNA targeting segment) as set forth in any one of SEQ ID NOs: 72-91. Alternatively, a guide RNA targeting a C9orf72 gene upstream or near the C9orf72 exon 1A transcription start site (e.g., a mouse C9orf72 guide RNA target sequence upstream or near the C9orf72 exon 1A transcription start site) may comprise a DNA targeting segment that is at least 90% or at least 95% identical to a sequence (DNA targeting segment) as set forth in any one of SEQ ID NOs: 72-91. Alternatively, a guide RNA targeting a C9orf72 gene upstream or near the C9orf72 exon 1A transcription start site (e.g., a mouse C9orf72 guide RNA target sequence upstream or near the C9orf72 exon 1A transcription start site) may comprise a DNA targeting segment that is at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% identical to at least 17, at least 18, at least 19, or at least 20 consecutive nucleotides of a sequence shown in any one of SEQ ID NOs: 72-91 (DNA targeting segment).Alternatively, a guide RNA targeting a C9orf72 gene upstream or near the C9orf72 exon 1A transcription start site (e.g., a mouse C9orf72 guide RNA target sequence upstream or near the C9orf72 exon 1A transcription start site) may comprise a DNA targeting segment that is at least 90% or at least 95% identical to at least 17, at least 18, at least 19, or at least 20 consecutive nucleotides of a sequence shown in any one of SEQ ID NOs: 72-91 (DNA targeting segment). Alternatively, a guide RNA targeting a C9orf72 gene upstream or near the C9orf72 exon 1A transcription start site (e.g., a mouse C9orf72 guide RNA target sequence upstream or near the C9orf72 exon 1A transcription start site) may comprise a DNA targeting segment comprising, consisting essentially of, or consisting of a sequence that differs from the sequence shown in any one of SEQ ID NOs: 72-91 (DNA targeting segment) by no more than 3, no more than 2, or no more than 1 nucleotides. Alternatively, a guide RNA targeting a C9orf72 gene upstream or near the C9orf72 exon 1A transcription start site (e.g., a mouse C9orf72 guide RNA target sequence upstream or near the C9orf72 exon 1A transcription start site) may comprise a DNA targeting segment comprising, consisting essentially of, or consisting of a sequence that differs from at least 17, at least 18, at least 19, or at least 20 consecutive nucleotides of the sequence shown in any one of SEQ ID NOs: 72-91 (DNA targeting segment) by no more than 3, no more than 2, or no more than 1 nucleotide.

[0156] As an example, a combination of guide RNAs targeting the C9orf72 gene upstream or near the C9orf72 exon 1A transcription start site (e.g., a mouse C9orf72 guide RNA target sequence upstream or near the C9orf72 exon 1A transcription start site) can include a DNA targeting segment (i.e., a guide sequence) that includes, consists essentially of, or consists of a sequence set forth in one or more or all of SEQ ID NOs: 72-91 (DNA targeting segment). Alternatively, a guide RNA targeting a C9orf72 gene upstream or near the C9orf72 exon 1A transcription start site (e.g., a mouse C9orf72 guide RNA target sequence upstream or near the C9orf72 exon 1A transcription start site) may comprise a DNA targeting segment comprising, consisting essentially of, or consisting of at least 17, at least 18, at least 19, or at least 20 consecutive nucleotides of a sequence set forth in one or more or all of SEQ ID NOs: 72-91 (DNA targeting segment). Alternatively, a guide RNA targeting a C9orf72 gene upstream or near the C9orf72 exon 1A transcription start site (e.g., a mouse C9orf72 guide RNA target sequence upstream or near the C9orf72 exon 1A transcription start site) may comprise a DNA targeting segment that is at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% identical to a sequence (DNA targeting segment) set forth in one or more or all of SEQ ID NOs: 72-91. Alternatively, a guide RNA targeting a C9orf72 gene upstream or near the C9orf72 exon 1A transcription start site (e.g., a mouse C9orf72 guide RNA target sequence upstream or near the C9orf72 exon 1A transcription start site) may comprise a DNA targeting segment that is at least 90% or at least 95% identical to a sequence (DNA targeting segment) set forth in one or more or all of SEQ ID NOs: 72-91. Alternatively, a guide RNA targeting a C9orf72 gene upstream or near the C9orf72 exon 1A transcription start site (e.g., a mouse C9orf72 guide RNA target sequence upstream or near the C9orf72 exon 1A transcription start site) may comprise a DNA targeting segment that is at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% identical to at least 17, at least 18, at least 19, or at least 20 consecutive nucleotides of a sequence set forth in one or more or all of SEQ ID NOs: 72-91 (DNA targeting segment).Alternatively, a guide RNA targeting a C9orf72 gene upstream or near the C9orf72 exon 1A transcription start site (e.g., a mouse C9orf72 guide RNA target sequence upstream or near the C9orf72 exon 1A transcription start site) may comprise a DNA targeting segment that is at least 90% or at least 95% identical to at least 17, at least 18, at least 19, or at least 20 consecutive nucleotides of a sequence set forth in one or more or all of SEQ ID NOs: 72-91 (DNA targeting segment). Alternatively, a guide RNA targeting a C9orf72 gene upstream or near the C9orf72 exon 1A transcription start site (e.g., a mouse C9orf72 guide RNA target sequence upstream or near the C9orf72 exon 1A transcription start site) may comprise a DNA targeting segment comprising, consisting essentially of, or consisting of a sequence that differs from the sequence shown in one or more or all of SEQ ID NOs:72-91 (DNA targeting segment) by no more than 3, no more than 2, or no more than 1 nucleotide. Alternatively, a guide RNA targeting a C9orf72 gene upstream or near the C9orf72 exon 1A transcription start site (e.g., a mouse C9orf72 guide RNA target sequence upstream or near the C9orf72 exon 1A transcription start site) may comprise a DNA targeting segment comprising, consisting essentially of, or consisting of a sequence that differs from at least 17, at least 18, at least 19, or at least 20 consecutive nucleotides of a sequence shown in one or more or all of SEQ ID NOs: 72-91 (DNA targeting segment) by no more than 3, no more than 2, or no more than 1 nucleotide.

[0157] As an example, a guide RNA targeting a C9orf72 gene upstream or near the C9orf72 exon 1A transcription start site (e.g., a mouse C9orf72 guide RNA target sequence upstream or near the C9orf72 exon 1A transcription start site) can include a DNA targeting segment (i.e., a guide sequence) that includes, consists essentially of, or consists of a sequence as set forth in SEQ ID NO: 74 (DNA targeting segment). Alternatively, a guide RNA targeting a C9orf72 gene upstream or near the C9orf72 exon 1A transcription start site (e.g., a mouse C9orf72 guide RNA target sequence upstream or near the C9orf72 exon 1A transcription start site) can include a DNA targeting segment that includes, consists essentially of, or consists of at least 17, at least 18, at least 19, or at least 20 consecutive nucleotides of a sequence as set forth in SEQ ID NO: 74 (DNA targeting segment). Alternatively, a guide RNA targeting a C9orf72 gene upstream or near the C9orf72 exon 1A transcription start site (e.g., a mouse C9orf72 guide RNA target sequence upstream or near the C9orf72 exon 1A transcription start site) may comprise a DNA targeting segment that is at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% identical to the sequence (DNA targeting segment) set forth in SEQ ID NO: 74. Alternatively, a guide RNA targeting a C9orf72 gene upstream or near the C9orf72 exon 1A transcription start site (e.g., a mouse C9orf72 guide RNA target sequence upstream or near the C9orf72 exon 1A transcription start site) may comprise a DNA targeting segment that is at least 90% or at least 95% identical to the sequence (DNA targeting segment) set forth in SEQ ID NO: 74. Alternatively, a guide RNA targeting a C9orf72 gene upstream or near the C9orf72 exon 1A transcription start site (e.g., a mouse C9orf72 guide RNA target sequence upstream or near the C9orf72 exon 1A transcription start site) may comprise a DNA targeting segment that is at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% identical to at least 17, at least 18, at least 19, or at least 20 consecutive nucleotides of the sequence shown in SEQ ID NO:74 (DNA targeting segment).Alternatively, a guide RNA targeting a C9orf72 gene upstream or near the C9orf72 exon 1A transcription start site (e.g., a mouse C9orf72 guide RNA target sequence upstream or near the C9orf72 exon 1A transcription start site) can comprise a DNA targeting segment that is at least 90% or at least 95% identical to at least 17, at least 18, at least 19, or at least 20 consecutive nucleotides of the sequence set forth in SEQ ID NO: 74 (DNA targeting segment). Alternatively, a guide RNA targeting a C9orf72 gene upstream or near the C9orf72 exon 1A transcription start site (e.g., a mouse C9orf72 guide RNA target sequence upstream or near the C9orf72 exon 1A transcription start site) can comprise a DNA targeting segment that comprises, consists essentially of, or consists of a sequence that differs from the sequence set forth in SEQ ID NO: 74 (DNA targeting segment) by no more than 3, no more than 2, or no more than 1 nucleotide. Alternatively, a guide RNA targeting a C9orf72 gene upstream or near the C9orf72 exon 1A transcription start site (e.g., a mouse C9orf72 guide RNA target sequence upstream or near the C9orf72 exon 1A transcription start site) may comprise a DNA targeting segment comprising, consisting essentially of, or consisting of a sequence that differs from at least 17, at least 18, at least 19, or at least 20 consecutive nucleotides of the sequence shown in SEQ ID NO: 74 (DNA targeting segment) by no more than 3, no more than 2, or no more than 1 nucleotide.

[0158] As an example, a guide RNA targeting a C9orf72 gene upstream or near the C9orf72 exon 1A transcription start site (e.g., a human C9orf72 guide RNA target sequence upstream or near the C9orf72 exon 1A transcription start site) can comprise a DNA targeting segment (i.e., a guide sequence) comprising, consisting essentially of, or consisting of a sequence shown in any one of SEQ ID NOs: 92-111 and 113 (DNA targeting segment). Alternatively, a guide RNA targeting a C9orf72 gene upstream or near the C9orf72 exon 1A transcription start site (e.g., a human C9orf72 guide RNA target sequence upstream or near the C9orf72 exon 1A transcription start site) may comprise a DNA targeting segment comprising, consisting essentially of, or consisting of at least 17, at least 18, at least 19, or at least 20 consecutive nucleotides of a sequence shown in any one of SEQ ID NOs: 92-111 and 113 (DNA targeting segment). Alternatively, a guide RNA targeting a C9orf72 gene upstream of the C9orf72 exon 1A transcription start site (e.g., a human C9orf72 guide RNA target sequence upstream or near the C9orf72 exon 1A transcription start site) may comprise a DNA targeting segment that is at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% identical to a sequence (DNA targeting segment) as shown in any one of SEQ ID NOs: 92-111 and 113. Alternatively, a guide RNA targeting a C9orf72 gene upstream or near the C9orf72 exon 1A transcription start site (e.g., a human C9orf72 guide RNA target sequence upstream or near the C9orf72 exon 1A transcription start site) may comprise a DNA targeting segment that is at least 90% or at least 95% identical to a sequence (DNA targeting segment) as shown in any one of SEQ ID NOs: 92-111 and 113. Alternatively, a guide RNA targeting a C9orf72 gene upstream or near the C9orf72 exon 1A transcription start site (e.g., a human C9orf72 guide RNA target sequence upstream or near the C9orf72 exon 1A transcription start site) may comprise a DNA targeting segment that is at least 75%, at least 80%, at least 85%, at least 90% or at least 95% identical to at least 17, at least 18, at least 19 or at least 20 consecutive nucleotides of the sequence shown in any one of SEQ ID NOs: 92-111 and 113 (DNA targeting segment).Alternatively, a guide RNA targeting a C9orf72 gene upstream or near the C9orf72 exon 1A transcription start site (e.g., a human C9orf72 guide RNA target sequence upstream or near the C9orf72 exon 1A transcription start site) may comprise a DNA targeting segment that is at least 90% or at least 95% identical to at least 17, at least 18, at least 19, or at least 20 consecutive nucleotides of the sequence shown in any one of SEQ ID NOs: 92-111 and 113 (DNA targeting segment). Alternatively, a guide RNA targeting a C9orf72 gene upstream or near the C9orf72 exon 1A transcription start site (e.g., a human C9orf72 guide RNA target sequence upstream or near the C9orf72 exon 1A transcription start site) may comprise a DNA targeting segment comprising, consisting essentially of, or consisting of a sequence that differs from the sequence shown in any one of SEQ ID NOs: 92-111 and 113 (DNA targeting segment) by no more than 3, no more than 2, or no more than 1 nucleotides. Alternatively, a guide RNA targeting a C9orf72 gene upstream or near the C9orf72 exon 1A transcription start site (e.g., a human C9orf72 guide RNA target sequence upstream or near the C9orf72 exon 1A transcription start site) may comprise a DNA targeting segment comprising, consisting essentially of, or consisting of a sequence that differs from at least 17, at least 18, at least 19, or at least 20 consecutive nucleotides of the sequence shown in any one of SEQ ID NOs: 92-111 and 113 (DNA targeting segment) by no more than 3, no more than 2, or no more than 1 nucleotide.

[0159] As an example, a combination of guide RNAs targeting the C9orf72 gene upstream or near the C9orf72 exon 1A transcription start site (e.g., a human C9orf72 guide RNA target sequence upstream or near the C9orf72 exon 1A transcription start site) can include a DNA targeting segment (i.e., a guide sequence) that includes, consists essentially of, or consists of a sequence shown in one or more or all of SEQ ID NOs: 92-111 and 113 (DNA targeting segment). Alternatively, a guide RNA targeting a C9orf72 gene upstream or near the C9orf72 exon 1A transcription start site (e.g., a human C9orf72 guide RNA target sequence upstream or near the C9orf72 exon 1A transcription start site) may comprise a DNA targeting segment comprising, consisting essentially of, or consisting of at least 17, at least 18, at least 19, or at least 20 consecutive nucleotides of a sequence shown in one or more or all of SEQ ID NOs: 92-111 and 113 (DNA targeting segment). Alternatively, a guide RNA targeting a C9orf72 gene upstream of the C9orf72 exon 1A transcription start site (e.g., a human C9orf72 guide RNA target sequence upstream or near the C9orf72 exon 1A transcription start site) may comprise a DNA targeting segment that is at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% identical to a sequence (DNA targeting segment) as set forth in one or more or all of SEQ ID NOs: 92-111 and 113. Alternatively, a guide RNA targeting a C9orf72 gene upstream or near the C9orf72 exon 1A transcription start site (e.g., a human C9orf72 guide RNA target sequence upstream or near the C9orf72 exon 1A transcription start site) may comprise a DNA targeting segment that is at least 90% or at least 95% identical to a sequence (DNA targeting segment) as set forth in one or more or all of SEQ ID NOs: 92-111 and 113. Alternatively, a guide RNA targeting a C9orf72 gene upstream or near the C9orf72 exon 1A transcription start site (e.g., a human C9orf72 guide RNA target sequence upstream or near the C9orf72 exon 1A transcription start site) may comprise a DNA targeting segment that is at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% identical to at least 17, at least 18, at least 19, or at least 20 consecutive nucleotides of a sequence shown in one or more or all of SEQ ID NOs: 92-111 and 113 (DNA targeting segment).Alternatively, a guide RNA targeting a C9orf72 gene upstream or near the C9orf72 exon 1A transcription start site (e.g., a human C9orf72 guide RNA target sequence upstream or near the C9orf72 exon 1A transcription start site) may comprise a DNA targeting segment that is at least 90% or at least 95% identical to at least 17, at least 18, at least 19, or at least 20 consecutive nucleotides of a sequence shown in one or more or all of SEQ ID NOs: 92-111 and 113 (DNA targeting segment). Alternatively, a guide RNA targeting a C9orf72 gene upstream or near the C9orf72 exon 1A transcription start site (e.g., a human C9orf72 guide RNA target sequence upstream or near the C9orf72 exon 1A transcription start site) may comprise a DNA targeting segment comprising, consisting essentially of, or consisting of a sequence that differs from the sequence shown in one or more or all of SEQ ID NOs: 92-111 and 113 (DNA targeting segment) by no more than 3, no more than 2, or no more than 1 nucleotide. Alternatively, a guide RNA targeting a C9orf72 gene upstream or near the C9orf72 exon 1A transcription start site (e.g., a human C9orf72 guide RNA target sequence upstream or near the C9orf72 exon 1A transcription start site) may comprise a DNA targeting segment comprising, consisting essentially of, or consisting of a sequence that differs from at least 17, at least 18, at least 19, or at least 20 consecutive nucleotides of a sequence shown in one or more or all of SEQ ID NOs: 92-111 and 113 (DNA targeting segment) by no more than 3, no more than 2, or no more than 1 nucleotide.

[0160] As an example, a guide RNA targeting a C9orf72 gene upstream or near the C9orf72 exon 1A transcription start site (e.g., a human C9orf72 guide RNA target sequence upstream or near the C9orf72 exon 1A transcription start site) can include a DNA targeting segment (i.e., a guide sequence) that includes, consists essentially of, or consists of a sequence as set forth in any one of SEQ ID NOs: 93-95 (DNA targeting segment). Alternatively, a guide RNA targeting a C9orf72 gene upstream or near the C9orf72 exon 1A transcription start site (e.g., a human C9orf72 guide RNA target sequence upstream or near the C9orf72 exon 1A transcription start site) can include a DNA targeting segment that includes, consists essentially of, or consists of at least 17, at least 18, at least 19, or at least 20 consecutive nucleotides of a sequence as set forth in any one of SEQ ID NOs: 93-95 (DNA targeting segment). Alternatively, a guide RNA targeting a C9orf72 gene upstream of the C9orf72 exon 1A transcription start site (e.g., a human C9orf72 guide RNA target sequence upstream or near the C9orf72 exon 1A transcription start site) may comprise a DNA targeting segment that is at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% identical to a sequence (DNA targeting segment) as shown in any one of SEQ ID NOs: 93-95. Alternatively, a guide RNA targeting a C9orf72 gene upstream or near the C9orf72 exon 1A transcription start site (e.g., a human C9orf72 guide RNA target sequence upstream or near the C9orf72 exon 1A transcription start site) may comprise a DNA targeting segment that is at least 90% or at least 95% identical to a sequence (DNA targeting segment) as shown in any one of SEQ ID NOs: 93-95. Alternatively, a guide RNA targeting a C9orf72 gene upstream or near the C9orf72 exon 1A transcription start site (e.g., a human C9orf72 guide RNA target sequence upstream or near the C9orf72 exon 1A transcription start site) may comprise a DNA targeting segment that is at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% identical to at least 17, at least 18, at least 19, or at least 20 consecutive nucleotides of a sequence shown in any one of SEQ ID NOs: 93-95 (DNA targeting segment).Alternatively, a guide RNA targeting a C9orf72 gene upstream or near the C9orf72 exon 1A transcription start site (e.g., a human C9orf72 guide RNA target sequence upstream or near the C9orf72 exon 1A transcription start site) may comprise a DNA targeting segment that is at least 90% or at least 95% identical to at least 17, at least 18, at least 19, or at least 20 consecutive nucleotides of a sequence shown in any one of SEQ ID NOs: 93-95 (DNA targeting segment). Alternatively, a guide RNA targeting the C9orf72 gene upstream or near the C9orf72 exon 1A transcription start site (e.g., a human C9orf72 guide RNA target sequence upstream or near the C9orf72 exon 1A transcription start site) may comprise a DNA targeting segment comprising, consisting essentially of, or consisting of a sequence that differs from the sequence shown in any one of SEQ ID NOs: 93-95 (DNA targeting segment) by no more than 3, no more than 2, or no more than 1 nucleotides. Alternatively, a guide RNA targeting a C9orf72 gene upstream or near the C9orf72 exon 1A transcription start site (e.g., a human C9orf72 guide RNA target sequence upstream or near the C9orf72 exon 1A transcription start site) may comprise a DNA targeting segment comprising, consisting essentially of, or consisting of a sequence that differs from at least 17, at least 18, at least 19, or at least 20 consecutive nucleotides of the sequence shown in any one of SEQ ID NOs: 93-95 (DNA targeting segment) by no more than 3, no more than 2, or no more than 1 nucleotide.

[0161] As an example, a combination of guide RNAs targeting the C9orf72 gene upstream or near the C9orf72 exon 1A transcription start site (e.g., a human C9orf72 guide RNA target sequence upstream or near the C9orf72 exon 1A transcription start site) can include a DNA targeting segment (i.e., a guide sequence) that includes, consists essentially of, or consists of a sequence shown in one or more or all of SEQ ID NOs: 93-95 (DNA targeting segment). Alternatively, a guide RNA targeting a C9orf72 gene upstream or near the C9orf72 exon 1A transcription start site (e.g., a human C9orf72 guide RNA target sequence upstream or near the C9orf72 exon 1A transcription start site) may comprise a DNA targeting segment comprising, consisting essentially of, or consisting of at least 17, at least 18, at least 19, or at least 20 consecutive nucleotides of a sequence shown in one or more or all of SEQ ID NOs: 93-95 (DNA targeting segment). Alternatively, a guide RNA targeting a C9orf72 gene upstream of the C9orf72 exon 1A transcription start site (e.g., a human C9orf72 guide RNA target sequence upstream or near the C9orf72 exon 1A transcription start site) may comprise a DNA targeting segment that is at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% identical to a sequence (DNA targeting segment) as set forth in one or more or all of SEQ ID NOs: 93-95. Alternatively, a guide RNA targeting a C9orf72 gene upstream or near the C9orf72 exon 1A transcription start site (e.g., a human C9orf72 guide RNA target sequence upstream or near the C9orf72 exon 1A transcription start site) may comprise a DNA targeting segment that is at least 90% or at least 95% identical to a sequence (DNA targeting segment) as set forth in one or more or all of SEQ ID NOs: 93-95. Alternatively, a guide RNA targeting a C9orf72 gene upstream or near the C9orf72 exon 1A transcription start site (e.g., a human C9orf72 guide RNA target sequence upstream or near the C9orf72 exon 1A transcription start site) may comprise a DNA targeting segment that is at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% identical to at least 17, at least 18, at least 19, or at least 20 consecutive nucleotides of a sequence shown in one or more or all of SEQ ID NOs: 93-95 (DNA targeting segment).Alternatively, a guide RNA targeting a C9orf72 gene upstream or near the C9orf72 exon 1A transcription start site (e.g., a human C9orf72 guide RNA target sequence upstream or near the C9orf72 exon 1A transcription start site) may comprise a DNA targeting segment that is at least 90% or at least 95% identical to at least 17, at least 18, at least 19, or at least 20 consecutive nucleotides of a sequence shown in one or more or all of SEQ ID NOs: 93-95 (DNA targeting segment). Alternatively, a guide RNA targeting a C9orf72 gene upstream or near the C9orf72 exon 1A transcription start site (e.g., a human C9orf72 guide RNA target sequence upstream or near the C9orf72 exon 1A transcription start site) may comprise a DNA targeting segment comprising, consisting essentially of, or consisting of a sequence that differs from the sequence shown in one or more or all of SEQ ID NOs: 93-95 (DNA targeting segment) by no more than 3, no more than 2, or no more than 1 nucleotide. Alternatively, a guide RNA targeting a C9orf72 gene upstream or near the C9orf72 exon 1A transcription start site (e.g., a human C9orf72 guide RNA target sequence upstream or near the C9orf72 exon 1A transcription start site) may comprise a DNA targeting segment comprising, consisting essentially of, or consisting of a sequence that differs from at least 17, at least 18, at least 19, or at least 20 consecutive nucleotides of a sequence shown in one or more or all of SEQ ID NOs: 93-95 (DNA targeting segment) by no more than 3, no more than 2, or no more than 1 nucleotide.

[0162] As an example, a guide RNA targeting a C9orf72 gene upstream or near the C9orf72 exon 1A transcription start site (e.g., a human C9orf72 guide RNA target sequence upstream or near the C9orf72 exon 1A transcription start site) can include a DNA targeting segment (i.e., a guide sequence) that includes, consists essentially of, or consists of a sequence as set forth in SEQ ID NO: 93 (DNA targeting segment). Alternatively, a guide RNA targeting a C9orf72 gene upstream or near the C9orf72 exon 1A transcription start site (e.g., a human C9orf72 guide RNA target sequence upstream or near the C9orf72 exon 1A transcription start site) can include a DNA targeting segment that includes, consists essentially of, or consists of at least 17, at least 18, at least 19, or at least 20 consecutive nucleotides of the sequence as set forth in SEQ ID NO: 93 (DNA targeting segment). Alternatively, a guide RNA targeting a C9orf72 gene upstream of the C9orf72 exon 1A transcription start site (e.g., a human C9orf72 guide RNA target sequence upstream or near the C9orf72 exon 1A transcription start site) may comprise a DNA targeting segment that is at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% identical to the sequence (DNA targeting segment) shown in SEQ ID NO: 93. Alternatively, a guide RNA targeting a C9orf72 gene upstream or near the C9orf72 exon 1A transcription start site (e.g., a human C9orf72 guide RNA target sequence upstream or near the C9orf72 exon 1A transcription start site) may comprise a DNA targeting segment that is at least 90% or at least 95% identical to the sequence (DNA targeting segment) shown in SEQ ID NO: 93. Alternatively, a guide RNA targeting the C9orf72 gene upstream or near the C9orf72 exon 1A transcription start site (e.g., a human C9orf72 guide RNA target sequence upstream or near the C9orf72 exon 1A transcription start site) may comprise a DNA targeting segment that is at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% identical to at least 17, at least 18, at least 19, or at least 20 consecutive nucleotides of the sequence shown in SEQ ID NO:93 (DNA targeting segment). Alternatively, a guide RNA targeting the C9orf72 gene upstream or near the C9orf72 exon 1A transcription start site (e.g., a human C9orf72 guide RNA target sequence upstream or near the C9orf72 exon 1A transcription start site) may comprise a DNA targeting segment that is at least 90% or at least 95% identical to at least 17, at least 18, at least 19, or at least 20 consecutive nucleotides of the sequence shown in SEQ ID NO:93 (DNA targeting segment).Alternatively, a guide RNA targeting the C9orf72 gene upstream or near the C9orf72 exon 1A transcription start site (e.g., a human C9orf72 guide RNA target sequence upstream or near the C9orf72 exon 1A transcription start site) may comprise a DNA targeting segment comprising, consisting essentially of, or consisting of a sequence that differs from the sequence shown in SEQ ID NO: 93 (DNA targeting segment) by no more than 3, no more than 2, or no more than 1 nucleotides. Alternatively, a guide RNA targeting a C9orf72 gene upstream or near the C9orf72 exon 1A transcription start site (e.g., a human C9orf72 guide RNA target sequence upstream or near the C9orf72 exon 1A transcription start site) may comprise a DNA targeting segment comprising, consisting essentially of, or consisting of a sequence that differs from at least 17, at least 18, at least 19, or at least 20 consecutive nucleotides of the sequence shown in SEQ ID NO: 93 (DNA targeting segment) by no more than 3, no more than 2, or no more than 1 nucleotide.

[0163] As an example, a guide RNA targeting a C9orf72 gene upstream or near the C9orf72 exon 1A transcription start site (e.g., a human C9orf72 guide RNA target sequence upstream or near the C9orf72 exon 1A transcription start site) can include a DNA targeting segment (i.e., a guide sequence) that includes, consists essentially of, or consists of the sequence shown in SEQ ID NO: 94 (DNA targeting segment). Alternatively, a guide RNA targeting a C9orf72 gene upstream or near the C9orf72 exon 1A transcription start site (e.g., a human C9orf72 guide RNA target sequence upstream or near the C9orf72 exon 1A transcription start site) can include a DNA targeting segment that includes, consists essentially of, or consists of at least 17, at least 18, at least 19, or at least 20 consecutive nucleotides of the sequence shown in SEQ ID NO: 94 (DNA targeting segment). Alternatively, a guide RNA targeting a C9orf72 gene upstream of the C9orf72 exon 1A transcription start site (e.g., a human C9orf72 guide RNA target sequence upstream or near the C9orf72 exon 1A transcription start site) may comprise a DNA targeting segment that is at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% identical to the sequence (DNA targeting segment) shown in SEQ ID NO: 94. Alternatively, a guide RNA targeting a C9orf72 gene upstream or near the C9orf72 exon 1A transcription start site (e.g., a human C9orf72 guide RNA target sequence upstream or near the C9orf72 exon 1A transcription start site) may comprise a DNA targeting segment that is at least 90% or at least 95% identical to the sequence (DNA targeting segment) shown in SEQ ID NO: 94. Alternatively, a guide RNA targeting the C9orf72 gene upstream or near the C9orf72 exon 1A transcription start site (e.g., a human C9orf72 guide RNA target sequence upstream or near the C9orf72 exon 1A transcription start site) may comprise a DNA targeting segment that is at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% identical to at least 17, at least 18, at least 19, or at least 20 consecutive nucleotides of the sequence shown in SEQ ID NO:94 (DNA targeting segment). Alternatively, a guide RNA targeting the C9orf72 gene upstream or near the C9orf72 exon 1A transcription start site (e.g., a human C9orf72 guide RNA target sequence upstream or near the C9orf72 exon 1A transcription start site) may comprise a DNA targeting segment that is at least 90% or at least 95% identical to at least 17, at least 18, at least 19, or at least 20 consecutive nucleotides of the sequence shown in SEQ ID NO:94 (DNA targeting segment).Alternatively, a guide RNA targeting the C9orf72 gene upstream or near the C9orf72 exon 1A transcription start site (e.g., a human C9orf72 guide RNA target sequence upstream or near the C9orf72 exon 1A transcription start site) may comprise a DNA targeting segment comprising, consisting essentially of, or consisting of a sequence that differs from the sequence shown in SEQ ID NO: 94 (DNA targeting segment) by no more than 3, no more than 2, or no more than 1 nucleotides. Alternatively, a guide RNA targeting a C9orf72 gene upstream or near the C9orf72 exon 1A transcription start site (e.g., a human C9orf72 guide RNA target sequence upstream or near the C9orf72 exon 1A transcription start site) may comprise a DNA targeting segment comprising, consisting essentially of, or consisting of a sequence that differs from at least 17, at least 18, at least 19, or at least 20 consecutive nucleotides of the sequence shown in SEQ ID NO: 94 (DNA targeting segment) by no more than 3, no more than 2, or no more than 1 nucleotide.

[0164] As an example, a guide RNA targeting a C9orf72 gene upstream or near the C9orf72 exon 1A transcription start site (e.g., a human C9orf72 guide RNA target sequence upstream or near the C9orf72 exon 1A transcription start site) can include a DNA targeting segment (i.e., a guide sequence) that includes, consists essentially of, or consists of a sequence as set forth in SEQ ID NO: 95 (DNA targeting segment). Alternatively, a guide RNA targeting a C9orf72 gene upstream or near the C9orf72 exon 1A transcription start site (e.g., a human C9orf72 guide RNA target sequence upstream or near the C9orf72 exon 1A transcription start site) can include a DNA targeting segment that includes, consists essentially of, or consists of at least 17, at least 18, at least 19, or at least 20 consecutive nucleotides of a sequence as set forth in SEQ ID NO: 95 (DNA targeting segment). Alternatively, a guide RNA targeting a C9orf72 gene upstream of the C9orf72 exon 1A transcription start site (e.g., a human C9orf72 guide RNA target sequence upstream or near the C9orf72 exon 1A transcription start site) may comprise a DNA targeting segment that is at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% identical to the sequence (DNA targeting segment) shown in SEQ ID NO: 95. Alternatively, a guide RNA targeting a C9orf72 gene upstream or near the C9orf72 exon 1A transcription start site (e.g., a human C9orf72 guide RNA target sequence upstream or near the C9orf72 exon 1A transcription start site) may comprise a DNA targeting segment that is at least 90% or at least 95% identical to the sequence (DNA targeting segment) shown in SEQ ID NO: 95. Alternatively, a guide RNA targeting the C9orf72 gene upstream or near the C9orf72 exon 1A transcription start site (e.g., a human C9orf72 guide RNA target sequence upstream or near the C9orf72 exon 1A transcription start site) may comprise a DNA targeting segment that is at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% identical to at least 17, at least 18, at least 19, or at least 20 consecutive nucleotides of the sequence shown in SEQ ID NO:95 (DNA targeting segment). Alternatively, a guide RNA targeting the C9orf72 gene upstream or near the C9orf72 exon 1A transcription start site (e.g., a human C9orf72 guide RNA target sequence upstream or near the C9orf72 exon 1A transcription start site) may comprise a DNA targeting segment that is at least 90% or at least 95% identical to at least 17, at least 18, at least 19, or at least 20 consecutive nucleotides of the sequence shown in SEQ ID NO:95 (DNA targeting segment).Alternatively, a guide RNA targeting the C9orf72 gene upstream or near the C9orf72 exon 1A transcription start site (e.g., a human C9orf72 guide RNA target sequence upstream or near the C9orf72 exon 1A transcription start site) may comprise a DNA targeting segment comprising, consisting essentially of, or consisting of a sequence that differs from the sequence shown in SEQ ID NO: 95 (DNA targeting segment) by no more than 3, no more than 2, or no more than 1 nucleotides. Alternatively, a guide RNA targeting a C9orf72 gene upstream or near the C9orf72 exon 1A transcription start site (e.g., a human C9orf72 guide RNA target sequence upstream or near the C9orf72 exon 1A transcription start site) may comprise a DNA targeting segment comprising, consisting essentially of, or consisting of a sequence that differs from at least 17, at least 18, at least 19, or at least 20 consecutive nucleotides of the sequence shown in SEQ ID NO: 95 (DNA targeting segment) by no more than 3, no more than 2, or no more than 1 nucleotide.

[0165] As an example, a guide RNA targeting a C9orf72 hexanucleotide repeat expansion sequence may comprise a DNA targeting segment (i.e., a guide sequence) comprising, consisting essentially of, or consisting of a sequence as set forth in any one of SEQ ID NOs: 118-121 (DNA targeting segment). Alternatively, a guide RNA targeting a C9orf72 hexanucleotide repeat expansion sequence may comprise a DNA targeting segment comprising, consisting essentially of, or consisting of at least 17, at least 18, at least 19, or at least 20 consecutive nucleotides of a sequence as set forth in any one of SEQ ID NOs: 118-121 (DNA targeting segment). Alternatively, a guide RNA targeting a C9orf72 hexanucleotide repeat expansion sequence may comprise a DNA targeting segment that is at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% identical to a sequence as set forth in any one of SEQ ID NOs: 118-121 (DNA targeting segment). Alternatively, the guide RNA targeting the C9orf72 hexanucleotide repeat expansion sequence may comprise a DNA targeting segment that is at least 90% or at least 95% identical to the sequence (DNA targeting segment) set forth in any one of SEQ ID NOs: 118-121. Alternatively, the guide RNA targeting the C9orf72 hexanucleotide repeat expansion sequence may comprise a DNA targeting segment that is at least 75%, at least 80%, at least 85%, at least 90% or at least 95% identical to at least 17, at least 18, at least 19 or at least 20 consecutive nucleotides of the sequence (DNA targeting segment) set forth in any one of SEQ ID NOs: 118-121. Alternatively, the guide RNA targeting the C9orf72 hexanucleotide repeat expansion sequence may comprise a DNA targeting segment that is at least 90% or at least 95% identical to at least 17, at least 18, at least 19 or at least 20 consecutive nucleotides of the sequence (DNA targeting segment) set forth in any one of SEQ ID NOs: 118-121. Alternatively, a guide RNA targeting a C9orf72 hexanucleotide repeat expansion sequence may comprise a DNA targeting segment comprising, consisting essentially of, or consisting of a sequence that differs from any one of SEQ ID NOs: 118-121 (DNA targeting segment) by no more than 3, no more than 2, or no more than 1 nucleotide. Alternatively, a guide RNA targeting a C9orf72 hexanucleotide repeat expansion sequence may comprise a DNA targeting segment comprising, consisting essentially of, or consisting of a sequence that differs from any one of SEQ ID NOs: 118-121 (DNA targeting segment) by no more than 3, no more than 2, or no more than 1 nucleotide of at least 17, at least 18, at least 19, or at least 20 consecutive nucleotides.

[0166] As an example, a combination of guide RNAs targeting a C9orf72 hexanucleotide repeat expansion sequence may include a DNA targeting segment (i.e., a guide sequence) that includes, consists essentially of, or consists of a sequence shown in one or more or all of SEQ ID NOs: 118-121 (DNA targeting segment). Alternatively, a guide RNA targeting a C9orf72 hexanucleotide repeat expansion sequence may include a DNA targeting segment that includes, consists essentially of, or consists of at least 17, at least 18, at least 19, or at least 20 consecutive nucleotides of a sequence shown in one or more or all of SEQ ID NOs: 118-121 (DNA targeting segment). Alternatively, the guide RNA targeting the C9orf72 hexanucleotide repeat expansion sequence may comprise a DNA targeting segment that is at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% identical to a sequence (DNA targeting segment) set forth in one or more or all of SEQ ID NOs: 118-121. Alternatively, the guide RNA targeting the C9orf72 hexanucleotide repeat expansion sequence may comprise a DNA targeting segment that is at least 90% or at least 95% identical to a sequence (DNA targeting segment) set forth in one or more or all of SEQ ID NOs: 118-121. Alternatively, the guide RNA targeting a C9orf72 hexanucleotide repeat expansion sequence may comprise a DNA targeting segment that is at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% identical to at least 17, at least 18, at least 19, or at least 20 consecutive nucleotides of a sequence set forth in one or more or all of SEQ ID NOs: 118-121 (DNA targeting segment). Alternatively, the guide RNA targeting a C9orf72 hexanucleotide repeat expansion sequence may comprise a DNA targeting segment that is at least 90% or at least 95% identical to at least 17, at least 18, at least 19, or at least 20 consecutive nucleotides of a sequence set forth in one or more or all of SEQ ID NOs: 118-121 (DNA targeting segment). Alternatively, a guide RNA targeting a C9orf72 hexanucleotide repeat expansion sequence may comprise a DNA targeting segment comprising, consisting essentially of, or consisting of a sequence that differs from the sequence shown in any one of SEQ ID NOs: 118-121 (DNA targeting segment) by no more than 3, no more than 2, or no more than 1 nucleotides.Alternatively, a guide RNA targeting a C9orf72 hexanucleotide repeat expansion sequence may comprise a DNA targeting segment comprising, consisting essentially of, or consisting of a sequence that differs from at least 17, at least 18, at least 19, or at least 20 consecutive nucleotides of a sequence shown in one or more or all of SEQ ID NOs: 118-121 (DNA targeting segment) by no more than 3, no more than 2, or no more than 1 nucleotide.

[0167] As an example, a guide RNA targeting a C9orf72 hexanucleotide repeat expansion sequence may comprise a DNA targeting segment (i.e., a guide sequence) comprising, consisting essentially of, or consisting of a sequence set forth in SEQ ID NO: 118 (DNA targeting segment). Alternatively, a guide RNA targeting a C9orf72 hexanucleotide repeat expansion sequence may comprise a DNA targeting segment comprising, consisting essentially of, or consisting of at least 17, at least 18, at least 19, or at least 20 consecutive nucleotides of a sequence set forth in SEQ ID NO: 118 (DNA targeting segment). Alternatively, a guide RNA targeting a C9orf72 hexanucleotide repeat expansion sequence may comprise a DNA targeting segment that is at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% identical to a sequence set forth in SEQ ID NO: 118 (DNA targeting segment). Alternatively, the guide RNA targeting the C9orf72 hexanucleotide repeat expansion sequence may comprise a DNA targeting segment that is at least 90% or at least 95% identical to the sequence (DNA targeting segment) set forth in SEQ ID NO: 118. Alternatively, the guide RNA targeting the C9orf72 hexanucleotide repeat expansion sequence may comprise a DNA targeting segment that is at least 75%, at least 80%, at least 85%, at least 90% or at least 95% identical to at least 17, at least 18, at least 19 or at least 20 consecutive nucleotides of the sequence (DNA targeting segment) set forth in SEQ ID NO: 118. Alternatively, the guide RNA targeting the C9orf72 hexanucleotide repeat expansion sequence may comprise a DNA targeting segment that is at least 90% or at least 95% identical to at least 17, at least 18, at least 19 or at least 20 consecutive nucleotides of the sequence (DNA targeting segment) set forth in SEQ ID NO: 118. Alternatively, a guide RNA targeting a C9orf72 hexanucleotide repeat expansion sequence may comprise a DNA targeting segment comprising, consisting essentially of, or consisting of a sequence that differs from the sequence shown in SEQ ID NO: 118 (DNA targeting segment) by no more than 3, no more than 2, or no more than 1 nucleotide. Alternatively, a guide RNA targeting a C9orf72 hexanucleotide repeat expansion sequence may comprise a DNA targeting segment comprising, consisting essentially of, or consisting of a sequence that differs from the sequence shown in SEQ ID NO: 118 (DNA targeting segment) by no more than 3, no more than 2, or no more than 1 nucleotide of at least 17, at least 18, at least 19, or at least 20 consecutive nucleotides.

[0168] As an example, a guide RNA targeting a C9orf72 hexanucleotide repeat expansion sequence may comprise a DNA targeting segment (i.e., a guide sequence) comprising, consisting essentially of, or consisting of a sequence set forth in SEQ ID NO: 119 (DNA targeting segment). Alternatively, a guide RNA targeting a C9orf72 hexanucleotide repeat expansion sequence may comprise a DNA targeting segment comprising, consisting essentially of, or consisting of at least 17, at least 18, at least 19, or at least 20 consecutive nucleotides of a sequence set forth in SEQ ID NO: 119 (DNA targeting segment). Alternatively, a guide RNA targeting a C9orf72 hexanucleotide repeat expansion sequence may comprise a DNA targeting segment that is at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% identical to a sequence set forth in SEQ ID NO: 119 (DNA targeting segment). Alternatively, the guide RNA targeting the C9orf72 hexanucleotide repeat expansion sequence may comprise a DNA targeting segment that is at least 90% or at least 95% identical to the sequence (DNA targeting segment) set forth in SEQ ID NO: 119. Alternatively, the guide RNA targeting the C9orf72 hexanucleotide repeat expansion sequence may comprise a DNA targeting segment that is at least 75%, at least 80%, at least 85%, at least 90% or at least 95% identical to at least 17, at least 18, at least 19 or at least 20 consecutive nucleotides of the sequence set forth in SEQ ID NO: 119. Alternatively, the guide RNA targeting the C9orf72 hexanucleotide repeat expansion sequence may comprise a DNA targeting segment that is at least 90% or at least 95% identical to at least 17, at least 18, at least 19 or at least 20 consecutive nucleotides of the sequence set forth in SEQ ID NO: 119. Alternatively, a guide RNA targeting a C9orf72 hexanucleotide repeat expansion sequence may comprise a DNA targeting segment comprising, consisting essentially of, or consisting of a sequence that differs from the sequence shown in SEQ ID NO: 119 (DNA targeting segment) by no more than 3, no more than 2, or no more than 1 nucleotide. Alternatively, a guide RNA targeting a C9orf72 hexanucleotide repeat expansion sequence may comprise a DNA targeting segment comprising, consisting essentially of, or consisting of a sequence that differs from the sequence shown in SEQ ID NO: 119 (DNA targeting segment) by no more than 3, no more than 2, or no more than 1 nucleotide of at least 17, at least 18, at least 19, or at least 20 consecutive nucleotides.

[0169] As an example, a guide RNA targeting a C9orf72 hexanucleotide repeat expansion sequence may comprise a DNA targeting segment (i.e., a guide sequence) comprising, consisting essentially of, or consisting of a sequence set forth in SEQ ID NO: 120 (DNA targeting segment). Alternatively, a guide RNA targeting a C9orf72 hexanucleotide repeat expansion sequence may comprise a DNA targeting segment comprising, consisting essentially of, or consisting of at least 17, at least 18, at least 19, or at least 20 consecutive nucleotides of a sequence set forth in SEQ ID NO: 120 (DNA targeting segment). Alternatively, a guide RNA targeting a C9orf72 hexanucleotide repeat expansion sequence may comprise a DNA targeting segment that is at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% identical to a sequence set forth in SEQ ID NO: 120 (DNA targeting segment). Alternatively, the guide RNA targeting the C9orf72 hexanucleotide repeat expansion sequence may comprise a DNA targeting segment that is at least 90% or at least 95% identical to the sequence (DNA targeting segment) set forth in SEQ ID NO: 120. Alternatively, the guide RNA targeting the C9orf72 hexanucleotide repeat expansion sequence may comprise a DNA targeting segment that is at least 75%, at least 80%, at least 85%, at least 90% or at least 95% identical to at least 17, at least 18, at least 19 or at least 20 consecutive nucleotides of the sequence set forth in SEQ ID NO: 120. Alternatively, the guide RNA targeting the C9orf72 hexanucleotide repeat expansion sequence may comprise a DNA targeting segment that is at least 90% or at least 95% identical to at least 17, at least 18, at least 19 or at least 20 consecutive nucleotides of the sequence set forth in SEQ ID NO: 120. Alternatively, a guide RNA targeting a C9orf72 hexanucleotide repeat expansion sequence may comprise a DNA targeting segment comprising, consisting essentially of, or consisting of a sequence that differs from the sequence shown in SEQ ID NO: 120 (DNA targeting segment) by no more than 3, no more than 2, or no more than 1 nucleotide. Alternatively, a guide RNA targeting a C9orf72 hexanucleotide repeat expansion sequence may comprise a DNA targeting segment comprising, consisting essentially of, or consisting of a sequence that differs from the sequence shown in SEQ ID NO: 120 (DNA targeting segment) by no more than 3, no more than 2, or no more than 1 nucleotide of at least 17, at least 18, at least 19, or at least 20 consecutive nucleotides.

[0170] As an example, a guide RNA targeting a C9orf72 hexanucleotide repeat expansion sequence may comprise a DNA targeting segment (i.e., a guide sequence) comprising, consisting essentially of, or consisting of a sequence as set forth in SEQ ID NO: 121 (DNA targeting segment). Alternatively, a guide RNA targeting a C9orf72 hexanucleotide repeat expansion sequence may comprise a DNA targeting segment comprising, consisting essentially of, or consisting of at least 17, at least 18, at least 19, or at least 20 consecutive nucleotides of the sequence as set forth in SEQ ID NO: 121 (DNA targeting segment). Alternatively, a guide RNA targeting a C9orf72 hexanucleotide repeat expansion sequence may comprise a DNA targeting segment that is at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% identical to the sequence as set forth in SEQ ID NO: 121 (DNA targeting segment). Alternatively, the guide RNA targeting the C9orf72 hexanucleotide repeat expansion sequence may comprise a DNA targeting segment that is at least 90% or at least 95% identical to the sequence set forth in SEQ ID NO: 121 (DNA targeting segment). Alternatively, the guide RNA targeting the C9orf72 hexanucleotide repeat expansion sequence may comprise a DNA targeting segment that is at least 75%, at least 80%, at least 85%, at least 90% or at least 95% identical to at least 17, at least 18, at least 19 or at least 20 consecutive nucleotides of the sequence set forth in SEQ ID NO: 121 (DNA targeting segment). Alternatively, the guide RNA targeting the C9orf72 hexanucleotide repeat expansion sequence may comprise a DNA targeting segment that is at least 90% or at least 95% identical to at least 17, at least 18, at least 19 or at least 20 consecutive nucleotides of the sequence set forth in SEQ ID NO: 121 (DNA targeting segment). Alternatively, a guide RNA targeting a C9orf72 hexanucleotide repeat expansion sequence may comprise a DNA targeting segment comprising, consisting essentially of, or consisting of a sequence that differs from the sequence shown in SEQ ID NO: 121 (DNA targeting segment) by no more than 3, no more than 2, or no more than 1 nucleotide. Alternatively, a guide RNA targeting a C9orf72 hexanucleotide repeat expansion sequence may comprise a DNA targeting segment comprising, consisting essentially of, or consisting of a sequence that differs from the sequence shown in SEQ ID NO: 121 (DNA targeting segment) by no more than 3, no more than 2, or no more than 1 nucleotide of at least 17, at least 18, at least 19, or at least 20 consecutive nucleotides.

[0171] TracrRNA can be in any form (e.g., full-length tracrRNA or activated partial tracrRNA) and have different lengths. It can include primary transcripts or processed forms. For example, tracrRNA (as a part of a single guide RNA or as a separate molecule as a part of a bimolecular gRNA) can include all or part of a wild-type tracrRNA sequence (e.g., about or more than about 20, 26, 32, 45, 48, 54, 63, 67, 85 or more nucleotides of a wild-type tracrRNA sequence), consist essentially of it or consist of it. Examples of wild-type tracrRNA sequences from Streptococcus pyogenes include patterns of 171 nucleotides, 89 nucleotides, 75 nucleotides, and 65 nucleotides. See, for example, Deltcheva et al., (2011) Nature 471(7340):602-607; WO 2014 / 093661, each of which is incorporated herein by reference in its entirety for all purposes. Examples of tracrRNA within a single guide RNA (sgRNA) include tracrRNA segments present in sgRNAs of the +48, ​​+54, +67, and +85 types, where "+n" indicates that up to +n nucleotides of the wild-type tracrRNA are included in the sgRNA. See US 8,697,359, which is incorporated herein by reference in its entirety for all purposes.

[0172] The percentage of complementarity between the DNA targeting segment of the guide RNA and the complementary strand of the target DNA may be at least 60% (e.g., at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or 100%). The percentage of complementarity between the DNA targeting segment and the complementary strand of the target DNA may be at least 60% over about 20 consecutive nucleotides. As an example, the percentage of complementarity between the DNA targeting segment and the complementary strand of the target DNA may be 100% over 14 consecutive nucleotides at the 5' end of the complementary strand of the target DNA, and as low as 0% in the rest. In this case, the DNA targeting segment may be considered to be 14 nucleotides in length. As another example, the percentage of complementarity between the DNA targeting segment and the complementary strand of the target DNA may be 100% over seven consecutive nucleotides at the 5' end of the complementary strand of the target DNA, and as low as 0% in the rest. In this case, the DNA targeting segment may be considered to be 7 nucleotides in length. In some guide RNAs, at least 17 nucleotides within the DNA targeting segment are complementary to the complementary strand of the target DNA. For example, the DNA targeting segment can be 20 nucleotides in length and can contain 1, 2, or 3 mismatches with the complementary strand of the target DNA. In one example, the mismatch is not adjacent to the region of the complementary strand corresponding to the protospacer adjacent motif (PAM) sequence (i.e., the reverse complement of the PAM sequence) (e.g., the mismatch is located at the 5' end of the DNA targeting segment of the guide RNA, or the mismatch is at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, or 19 base pairs away from the region of the complementary strand corresponding to the PAM sequence).

[0173] The protein binding fragment of gRNA may include two nucleotide segments that are complementary to each other. The complementary nucleotides of the protein binding segment hybridize to form a double-stranded RNA duplex (dsRNA). The protein binding fragment of the subject's gRNA interacts with the Cas protein, and the gRNA guides the bound Cas protein to a specific nucleotide sequence in the target DNA via the DNA targeting segment.

[0174] A single guide RNA can include a DNA targeting segment and a scaffold sequence (i.e., a protein binding or Cas binding sequence of the guide RNA). For example, such a guide RNA can have a 5' DNA targeting segment joined to a 3' scaffold sequence. Exemplary scaffold sequences (e.g., for S. pyogenes Cas9) comprise, consist essentially of, or consist of:

[0175] GUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCU (Type 1; SEQ ID NO:11);

[0176] GUUGGAACCAUUCAAAACAGCAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGC (Type 2; SEQ ID NO:12);

[0177] GUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGC (Type 3; SEQ ID NO:13); and

[0178] GUUUAAGAGCUAUGCUGGAAACAGCAUAGCAAGUUUAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGC (Type 4; SEQ ID NO:14);

[0179] GUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUUUUU (Type 5; SEQ ID NO:15);

[0180] GUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUU (Type 6; SEQ ID NO:16);

[0181] GUUUAAGAGCUAUGCUGGAAACAGCAUAGCAAGUUUAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUUUU (Type 7; SEQ ID NO:17); or

[0182] GUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGGCACCGAGUCGGUGC (pattern 8; SEQ ID NO: 18). In some guide sgRNAs, the four terminal U residues of pattern 6 are absent. In some sgRNAs, only 1, 2, or 3 of the four terminal U residues of pattern 6 are present. A guide RNA targeting any guide RNA target sequence disclosed herein may include, for example, a DNA targeting segment at the 5' end of the guide RNA fused to any exemplary guide RNA scaffold sequence at the 3' end of the guide RNA. That is, any DNA targeting segment disclosed herein may be joined to the 5' end of any of the above scaffold sequences to form a single guide RNA (chimeric guide RNA).

[0183] The guide RNA may comprise modifications or sequences that provide additional desired features (e.g., modified or regulated stability; subcellular targeting; tracking with fluorescent markers; binding sites for proteins or protein complexes, etc.). That is, the guide RNA may comprise one or more modified nucleosides or nucleotides, or one or more non-natural and / or naturally occurring components or configurations that replace or supplement the typical A, G, C, and U residues. Examples of such modifications include, for example, a 5' cap (e.g., a 7-methylguanylate cap (m7G)); a 3' polyadenylation tail (i.e., a 3' poly (A) tail); a nuclear switch sequence (e.g., to allow regulated stability and / or regulated accessibility of proteins and / or protein complexes); a stability control sequence; a sequence that forms a dsRNA duplex (i.e., a hairpin); a modification or sequence that targets RNA to a subcellular location (e.g., nucleus, mitochondria, chloroplasts, etc.); a modification or sequence that provides tracking (e.g., direct conjugation with a fluorescent molecule, conjugation with a moiety that facilitates fluorescence detection, a sequence that allows fluorescence detection, etc.); a modification or sequence that provides a binding site for a protein (e.g., a protein that acts on DNA, including a transcriptional activator, a transcriptional repressor, a DNA methyltransferase, a DNA demethylase, a histone acetyltransferase, a histone deacetylase, etc.); and combinations thereof. Other examples of modifications include an engineered stem-loop duplex structure, an engineered bulge region, an engineered hairpin 3' of a stem-loop duplex structure, or any combination thereof. See, e.g., US2015 / 0376586, which is incorporated herein by reference in its entirety for all purposes. The protrusion may be an unpaired region of nucleotides within the duplex consisting of a crRNA-like region and a minimal tracrRNA-like region. The protrusion may comprise an unpaired 5'-XXXY-3' on one side of the duplex, wherein X is any purine, and Y may be a nucleotide that can form a wobble pair with a nucleotide on the opposite strand; and comprise an unpaired nucleotide region on the other side of the duplex.

[0184] The guide RNA may comprise modified nucleosides and modified nucleotides, including, for example, one or more of the following: (1) altering or replacing one or both non-linked phosphate oxygens and / or one or more linked phosphate oxygens in the phosphodiester backbone linkage (exemplary backbone modifications); (2) altering or replacing a component of the ribose, such as altering or replacing the 2' hydroxyl group on the ribose (exemplary sugar modifications); (3) replacing (e.g., bulk replacing) a phosphate moiety with a dephosphorylating linker (exemplary backbone modifications); (4) modifying or replacing naturally occurring nucleobases, including with atypical nucleobases (exemplary base modifications); (5) replacing or modifying the ribose-phosphate backbone (exemplary backbone modifications); (6) modifying the 3' or 5' end of the oligonucleotide (e.g., removal, modification or replacement of a terminal phosphate group or conjugation of a moiety, cap or linker (such 3' or 5' cap modifications may include sugar and / or backbone modifications)); and (7) modifying or replacing a sugar (exemplary sugar modifications). Other possible guide RNA modifications include modification or replacement of uracil or polyuracil tracts. See, for example, WO 2015 / 048577 and US 2016 / 0237455, each of which is incorporated herein by reference in its entirety for all purposes. Cas encoding nucleic acids such as Cas mRNA may be similarly modified. For example, Cas mRNA may be modified by depleting uridine using synonymous codons.

[0185] Chemical modifications (such as those listed above) can be combined to provide a modified gRNA and / or mRNA comprising residues (nucleosides and nucleotides) that may have two, three, four or more modifications. For example, the modified residue may have a modified sugar and a modified nucleobase. In one example, each base of the modified gRNA (e.g., all bases have a modified phosphate group, such as a thiophosphate group). For example, all or substantially all phosphate groups of the gRNA can be replaced with a thiophosphate group. Alternatively or in addition, the modified gRNA may include at least one modified residue at or near the 5' end. Alternatively or in addition, the modified gRNA may include at least one modified residue at or near the 3' end.

[0186] Some gRNAs include one, two, three or more modified residues. For example, at least 5%, at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95% or 100% of the positions in the modified gRNA can be modified nucleosides or nucleotides.

[0187] Unmodified nucleic acids may be susceptible to degradation. Exogenous nucleic acids may also induce an innate immune response. Modifications may help introduce stability and reduce immunogenicity. Some gRNAs described herein may include one or more modified nucleosides or nucleotides to introduce stability to intracellular or serum-based nucleases. When introduced into a cell population, some modified gRNAs described herein may exhibit a reduced innate immune response.

[0188] In dual guide RNA, each of crRNA and tracrRNA may contain modifications. Such modifications may be at one or both ends of crRNA and / or tracrRNA. In sgRNA, one or more residues at one or both ends of sgRNA may be chemically modified, and / or internal nucleosides may be modified, and / or the entire sgRNA may be chemically modified. Some gRNAs include 5' end modifications. Some gRNAs include 3' end modifications. Some gRNAs include 5' end modifications and 3' end modifications.

[0189] The guide RNA disclosed herein may include one of the modification patterns disclosed in WO 2018 / 107028 A1, which is incorporated herein by reference in its entirety for all purposes. The guide RNA disclosed herein may also include one of the structures / modification patterns disclosed in US2017 / 0114334, which is incorporated herein by reference in its entirety for all purposes. The guide RNA disclosed herein may also include one of the structures / modification patterns disclosed in WO2017 / 136794, WO 2017 / 004279, US2018 / 0187186, or US2019 / 0048338, each of which is incorporated herein by reference in its entirety for all purposes.

[0190] As an example, any guide RNA described herein may include at least one modification. In one example, the at least one modification includes nucleotides modified with 2'-O-methyl (2'-O-Me), phosphorothioate (PS) bonds between nucleotides, nucleotides modified with 2'-fluoro (2'-F), or a combination thereof. For example, at least one modification may include nucleotides modified with 2'-O-methyl (2'-O-Me). Alternatively or additionally, the at least one modification may include phosphorothioate (PS) bonds between nucleotides. Alternatively or additionally, the at least one modification may include nucleotides modified with 2'-fluoro (2'-F). In one example, the guide RNA described herein includes one or more nucleotides modified with 2'-O-methyl (2'-O-Me) and one or more phosphorothioate (PS) bonds between nucleotides.

[0191] The guide RNA can be provided in any form. For example, the gRNA can be provided in the form of RNA, as two molecules (individual crRNA and tracrRNA) or as one molecule (sgRNA), and optionally provided in the form of a complex with a Cas protein. The gRNA can also be provided in the form of a DNA encoding the gRNA. The DNA encoding the gRNA can encode a single RNA molecule (sgRNA) or a separate RNA molecule (e.g., a separate crRNA and tracrRNA). In the latter case, the DNA encoding the gRNA can be provided as a DNA molecule or as a separate DNA molecule encoding crRNA and tracrRNA, respectively.

[0192] When gRNA is provided in the form of DNA, gRNA can be expressed transiently, conditionally or constitutively in cells. The DNA encoding gRNA can be stably integrated into the genome of the cell and operably connected to a promoter active in the cell. Alternatively, the DNA encoding gRNA can be operably connected to a promoter in an expression construct. For example, the DNA encoding gRNA can be in a vector including a heterologous nucleic acid such as a nucleic acid encoding a Cas protein. Alternatively, it can be in a vector or plasmid separated from a vector comprising a nucleic acid encoding a Cas protein. Promoters that can be used for such expression constructs include, for example, promoters that are active in human neurons or human motor neurons. Such promoters can be, for example, conditional promoters, inducible promoters, constitutive promoters, or tissue-specific promoters. Such promoters can also be, for example, bidirectional promoters. Specific examples of suitable promoters include RNA polymerase III promoters, such as human U6 promoters, rat U6 polymerase III promoters, or mouse U6 polymerase III promoters.

[0193] Alternatively, gRNA can be prepared by various other methods. For example, gRNA can be prepared by in vitro transcription using, for example, T7 RNA polymerase (see, for example, WO 2014 / 089290 and WO 2014 / 065596, each of which is incorporated herein by reference for all purposes). Guide RNA can also be a synthetically produced molecule prepared by chemical synthesis.

[0194] The guide RNA (or nucleic acid encoding the guide RNA) can be in a composition comprising one or more guide RNAs (e.g., 1, 2, 3, 4 or more guide RNAs) and a carrier that increases the stability of the guide RNA (e.g., prolongs the time period during which the degradation product remains below a threshold value, such as less than 0.5% by weight of the starting nucleic acid or protein, under given storage conditions (e.g., -20°C, 4°C, or ambient temperature); or increases in vivo stability). Non-limiting examples of such carriers include poly(lactic acid) (PLA) microspheres, poly(D,L-lactic-co-glycolic acid) (PLGA) microspheres, liposomes, micelles, reverse micelles, lipid helices, and lipid microtubules. Such compositions may also include a Cas protein, such as a Cas9 protein, or a nucleic acid encoding a Cas protein.

[0195] (4) Guide RNA target sequence

[0196] The target DNA for guide RNA includes a nucleic acid sequence present in DNA, and the DNA targeting segment of gRNA will be combined with it, provided that there are sufficient binding conditions. Suitable DNA / RNA binding conditions include physiological conditions that are generally present in cells. Other suitable DNA / RNA binding conditions (e.g., conditions in cell-free systems) are known in the art (see, for example, Molecular Cloning: A Laboratory Manual, 3rd edition (Sambrook et al., Harbor Laboratory Press 2001), which is incorporated herein by reference as a whole for all purposes). The target DNA strand complementary to gRNA and hybridized may be referred to as a "complementary strand", and the target DNA strand complementary to a "complementary strand" (and therefore not complementary to a Cas protein or gRNA) may be referred to as a "non-complementary strand" or "template strand".

[0197] The target DNA comprises a sequence hybridized with the guide RNA on the complementary strand and a corresponding sequence on the non-complementary strand (e.g., adjacent to the protospacer adjacent motif (PAM)). The term "guide RNA target sequence" as used herein specifically refers to a sequence on the non-complementary strand corresponding to the sequence hybridized with the guide RNA on the complementary strand (i.e., its reverse complementary sequence). That is, the guide RNA target sequence refers to a sequence adjacent to the PAM on the non-complementary strand (e.g., in the case of Cas9, upstream or 5' of the PAM). The guide RNA target sequence is equivalent to the DNA targeting segment of the guide RNA, but has thymine instead of uracil. As an example, the guide RNA target sequence of the SpCas9 enzyme may refer to a sequence upstream of the 5'-NGG-3' PAM on the non-complementary strand. The guide RNA is designed to be complementary to the complementary strand of the target DNA, wherein the hybridization between the DNA targeting segment of the guide RNA and the complementary strand of the target DNA promotes the formation of the CRISPR complex. Complete complementarity is not necessarily required, provided that there is sufficient complementarity to cause hybridization and promote the formation of the CRISPR complex. If a guide RNA is referred to herein as targeting a guide RNA target sequence, it means that the guide RNA hybridizes to a complementary strand sequence of the target DNA that is the reverse complement of the guide RNA target sequence on the non-complementary strand.

[0198] The target DNA or guide RNA target sequence can comprise any polynucleotide and can be located, for example, in the nucleus or cytoplasm of a cell or in an organelle of a cell such as a mitochondria or chloroplast. The target DNA or guide RNA target sequence can be any nucleic acid sequence endogenous or exogenous to the cell. The guide RNA target sequence can be a sequence encoding a gene product (e.g., a protein) or a non-coding sequence (e.g., a regulatory sequence) or can comprise both.

[0199] Site-specific binding and cleavage of the target DNA by the Cas protein can occur at a position determined by (i) base pairing complementarity between the guide RNA and the complementary strand of the target DNA, and (ii) a short motif in the non-complementary strand of the target DNA (referred to as a protospacer adjacent motif (PAM)). The PAM can flank the guide RNA target sequence. Optionally, the guide RNA target sequence can be flanked by a PAM at the 3' end (e.g., for Cas9). Alternatively, the guide RNA target sequence can be flanked by a PAM at the 5' end (e.g., for Cpf1). For example, the cleavage site of the Cas protein can be about 1 to about 10 or about 2 to about 5 base pairs (e.g., 3 base pairs) upstream or downstream of the PAM sequence (e.g., within the guide RNA target sequence). For SpCas9, the PAM sequence (i.e., on the non-complementary strand) can be 5'-N1GG-3', where N1 is any DNA nucleotide, and where the PAM is adjacent to the 3' of the guide RNA target sequence on the non-complementary strand of the target DNA. Thus, the sequence corresponding to the PAM on the complementary strand (i.e., the reverse complementary sequence) will be 5'-CCN2-3', where N2 is any DNA nucleotide and is immediately 5' of the sequence to which the DNA targeting segment of the guide RNA hybridizes on the complementary strand of the target DNA. In some such cases, N1 and N2 may be complementary, and the N1-N2 base pair may be any base pair (e.g., N1=C and N2=G; N1=G and N2=C; N1=A and N2=T; N1=T and N2=A). For Cas9 from Staphylococcus aureus, the PAM may be NNGRRT or NNGRR, where N may be A, G, C, or T, and R may be G or A. For Cas9 from Campylobacter jejuni, the PAM may be, for example, NNNNACAC or NNNNRYAC, where N may be A, G, C, or T, and R may be G or A. In some cases (e.g., for FnCpf1), the PAM sequence may be located upstream of the 5' end and have the sequence 5'-TTN-3'. For DpbCasX, the PAM may have the sequence 5'-TTCN-3'. For CasΦ, the PAM may have the sequence 5'-TBN-3', where B is G, T, or C.

[0200] An example of a guide RNA target sequence is a 20 nucleotide DNA sequence immediately preceding the NGG motif recognized by the SpCas9 protein. For example, two examples of guide RNA target sequences plus PAM are GN 19 NGG (SEQ ID NO: 19) or N 20NGG (SEQ ID NO: 20). See, for example, WO2014 / 165825, which is incorporated herein by reference in its entirety for all purposes. The guanine at the 5' end can promote transcription by RNA polymerase in cells. Other examples of guide RNA target sequences plus PAMs may include two guanine nucleotides at the 5' end (e.g., GGN 20 NGG; SEQ ID NO: 21) to promote efficient in vitro transcription by T7 polymerase. See, e.g., WO 2014 / 065596, which is incorporated herein by reference in its entirety for all purposes. Other guide RNA target sequences plus PAMs may have SEQ ID NOs: 19-21 with a length between 4-22 nucleotides, including 5'G or GG and 3'GG or NGG. Other guide RNA target sequences plus PAMs may have SEQ ID NOs: 19-21 with a length between 14 and 20 nucleotides.

[0201] The formation of a CRISPR complex hybridized with a target DNA can result in the cutting of one or both strands of the target DNA in or near the region corresponding to the guide RNA target sequence (i.e., the guide RNA target sequence on the non-complementary strand of the target DNA and the reverse complementary sequence to which the guide RNA on the complementary strand hybridizes). For example, the cleavage site may be within the guide RNA target sequence (e.g., at a defined position relative to the PAM sequence). The "cleavage site" comprises the position of the target DNA where the Cas protein produces a single-strand break or a double-strand break. The cleavage site may be located on only one strand of the double-stranded DNA (e.g., when a nickase is used) or on both strands. The cleavage site may be located at the same position on both strands (producing a blunt end; e.g., Cas9) or may be located at different sites on each strand (producing staggered ends (i.e., overhangs); e.g., Cpf1). Staggered ends may be produced, for example, by using two Cas proteins, each of which produces a single-strand break at different cleavage sites on different strands, thereby producing a double-strand break. For example, a first nickase can form a single-strand break on a first strand of a double-stranded DNA (dsDNA), and a second nickase can form a single-strand break on a second strand of the dsDNA, such that an overhang sequence is formed. In some cases, the guide RNA target sequence or cleavage site for the nickase on the first strand is separated from the guide RNA target sequence or cleavage site for the nickase on the second strand by at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 40, 50, 75, 100, 250, 500, or 1,000 base pairs.

[0202] Guide RNA target sequences can also be selected to minimize off-target modifications or avoid off-target effects (e.g., by avoiding two or fewer mismatches with off-target genomic sequences).

[0203] As an example, a guide RNA targeting a C9orf72 gene upstream or near the transcription start site of C9orf72 exon 1A (e.g., a mouse C9orf72 guide RNA target sequence upstream or near the transcription start site of C9orf72 exon 1A) can target a guide RNA target sequence as set forth in any one of SEQ ID NOs: 32 to 51. As another example, a guide RNA targeting a C9orf72 gene upstream or near the transcription start site of C9orf72 exon 1A (e.g., a mouse C9orf72 guide RNA target sequence upstream or near the transcription start site of C9orf72 exon 1A) can target at least 17, at least 18, at least 19, or at least 20 consecutive nucleotides of a guide RNA target sequence as set forth in any one of SEQ ID NOs: 32 to 51.

[0204] As an example, a combination of guide RNAs targeting a C9orf72 gene upstream or near the C9orf72 exon 1A transcription start site (e.g., a mouse C9orf72 guide RNA target sequence upstream or near the C9orf72 exon 1A transcription start site) can target one or more or all of the guide RNA target sequences set forth in SEQ ID NOs: 32-51. As another example, a guide RNA targeting a C9orf72 gene upstream or near the C9orf72 exon 1A transcription start site (e.g., a mouse C9orf72 guide RNA target sequence upstream or near the C9orf72 exon 1A transcription start site) can target at least 17, at least 18, at least 19, or at least 20 consecutive nucleotides of the guide RNA target sequence set forth in one or more or all of SEQ ID NOs: 32-51.

[0205] As an example, a guide RNA targeting a C9orf72 gene upstream or near the transcription start site of C9orf72 exon 1A (e.g., a mouse C9orf72 guide RNA target sequence upstream or near the transcription start site of C9orf72 exon 1A) can target the guide RNA target sequence shown in SEQ ID NO: 34. As another example, a guide RNA targeting a C9orf72 gene upstream or near the transcription start site of C9orf72 exon 1A (e.g., a mouse C9orf72 guide RNA target sequence upstream or near the transcription start site of C9orf72 exon 1A) can target at least 17, at least 18, at least 19, or at least 20 consecutive nucleotides of the guide RNA target sequence shown in SEQ ID NO: 34.

[0206] As an example, a guide RNA targeting a C9orf72 gene upstream or near the transcription start site of C9orf72 exon 1A (e.g., a human C9orf72 guide RNA target sequence upstream or near the transcription start site of C9orf72 exon 1A) can target a guide RNA target sequence as set forth in any one of SEQ ID NOs: 52-71 and 112. As another example, a guide RNA targeting a C9orf72 gene upstream or near the transcription start site of C9orf72 exon 1A (e.g., a human C9orf72 guide RNA target sequence upstream or near the transcription start site of C9orf72 exon 1A) can target at least 17, at least 18, at least 19, or at least 20 consecutive nucleotides of the guide RNA target sequence as set forth in any one of SEQ ID NOs: 52-71 and 112.

[0207] As an example, a combination of guide RNAs targeting a C9orf72 gene upstream or near the transcription start site of C9orf72 exon 1A (e.g., a human C9orf72 guide RNA target sequence upstream or near the transcription start site of C9orf72 exon 1A) can target the guide RNA target sequences set forth in one or more or all of SEQ ID NOs: 52-71 and 112. As another example, a guide RNA targeting a C9orf72 gene upstream or near the transcription start site of C9orf72 exon 1A (e.g., a human C9orf72 guide RNA target sequence upstream or near the transcription start site of C9orf72 exon 1A) can target at least 17, at least 18, at least 19, or at least 20 consecutive nucleotides of the guide RNA target sequences set forth in one or more or all of SEQ ID NOs: 52-71 and 112.

[0208] As an example, a guide RNA targeting a C9orf72 gene upstream or near the transcription start site of C9orf72 exon 1A (e.g., a human C9orf72 guide RNA target sequence upstream or near the transcription start site of C9orf72 exon 1A) can target a guide RNA target sequence as set forth in any one of SEQ ID NOs: 53 to 55. As another example, a guide RNA targeting a C9orf72 gene upstream or near the transcription start site of C9orf72 exon 1A (e.g., a human C9orf72 guide RNA target sequence upstream or near the transcription start site of C9orf72 exon 1A) can target at least 17, at least 18, at least 19, or at least 20 consecutive nucleotides of a guide RNA target sequence as set forth in any one of SEQ ID NOs: 53 to 55.

[0209] As an example, a combination of guide RNAs targeting a C9orf72 gene upstream or near the C9orf72 exon 1A transcription start site (e.g., a human C9orf72 guide RNA target sequence upstream or near the C9orf72 exon 1A transcription start site) can target the guide RNA target sequences set forth in one or more or all of SEQ ID NOs: 53-55 and 112. As another example, a guide RNA targeting a C9orf72 gene upstream or near the C9orf72 exon 1A transcription start site (e.g., a human C9orf72 guide RNA target sequence upstream or near the C9orf72 exon 1A transcription start site) can target at least 17, at least 18, at least 19, or at least 20 consecutive nucleotides of the guide RNA target sequences set forth in one or more or all of SEQ ID NOs: 53-55.

[0210] As an example, a guide RNA targeting a C9orf72 gene upstream or near the transcription start site of C9orf72 exon 1A (e.g., a human C9orf72 guide RNA target sequence upstream or near the transcription start site of C9orf72 exon 1A) can target the guide RNA target sequence shown in SEQ ID NO: 53. As another example, a guide RNA targeting a C9orf72 gene upstream or near the transcription start site of C9orf72 exon 1A (e.g., a human C9orf72 guide RNA target sequence upstream or near the transcription start site of C9orf72 exon 1A) can target at least 17, at least 18, at least 19, or at least 20 consecutive nucleotides of the guide RNA target sequence shown in SEQ ID NO: 53.

[0211] As an example, a guide RNA targeting a C9orf72 gene upstream or near the transcription start site of C9orf72 exon 1A (e.g., a human C9orf72 guide RNA target sequence upstream or near the transcription start site of C9orf72 exon 1A) can target the guide RNA target sequence shown in SEQ ID NO: 54. As another example, a guide RNA targeting a C9orf72 gene upstream or near the transcription start site of C9orf72 exon 1A (e.g., a human C9orf72 guide RNA target sequence upstream or near the transcription start site of C9orf72 exon 1A) can target at least 17, at least 18, at least 19, or at least 20 consecutive nucleotides of the guide RNA target sequence shown in SEQ ID NO: 54.

[0212] As an example, a guide RNA targeting a C9orf72 gene upstream or near the transcription start site of C9orf72 exon 1A (e.g., a human C9orf72 guide RNA target sequence upstream or near the transcription start site of C9orf72 exon 1A) can target the guide RNA target sequence shown in SEQ ID NO: 55. As another example, a guide RNA targeting a C9orf72 gene upstream or near the transcription start site of C9orf72 exon 1A (e.g., a human C9orf72 guide RNA target sequence upstream or near the transcription start site of C9orf72 exon 1A) can target at least 17, at least 18, at least 19, or at least 20 consecutive nucleotides of the guide RNA target sequence shown in SEQ ID NO: 55.

[0213] As an example, a guide RNA targeting a C9orf72 hexanucleotide repeat expansion sequence can target a guide RNA target sequence set forth in any one of SEQ ID NOs: 114-117. As another example, a guide RNA targeting a C9orf72 hexanucleotide repeat expansion sequence can target at least 17, at least 18, at least 19, or at least 20 consecutive nucleotides of a guide RNA target sequence set forth in any one of SEQ ID NOs: 114-117.

[0214] As an example, a combination of guide RNAs targeting a C9orf72 hexanucleotide repeat expansion sequence can target a guide RNA target sequence set forth in one or more or all of SEQ ID NOs: 114-117. As another example, a guide RNA targeting a C9orf72 hexanucleotide repeat expansion sequence can target at least 17, at least 18, at least 19, or at least 20 consecutive nucleotides of a guide RNA target sequence set forth in one or more or all of SEQ ID NOs: 114-117.

[0215] As an example, a guide RNA targeting a C9orf72 hexanucleotide repeat expansion sequence can target a guide RNA target sequence as set forth in SEQ ID NO: 114. As another example, a guide RNA targeting a C9orf72 hexanucleotide repeat expansion sequence can target at least 17, at least 18, at least 19, or at least 20 consecutive nucleotides of the guide RNA target sequence as set forth in SEQ ID NO: 114.

[0216] As an example, a guide RNA targeting a C9orf72 hexanucleotide repeat expansion sequence can target a guide RNA target sequence as set forth in SEQ ID NO: 115. As another example, a guide RNA targeting a C9orf72 hexanucleotide repeat expansion sequence can target at least 17, at least 18, at least 19, or at least 20 consecutive nucleotides of the guide RNA target sequence as set forth in SEQ ID NO: 115.

[0217] As an example, a guide RNA targeting a C9orf72 hexanucleotide repeat expansion sequence can target a guide RNA target sequence as set forth in SEQ ID NO: 116. As another example, a guide RNA targeting a C9orf72 hexanucleotide repeat expansion sequence can target at least 17, at least 18, at least 19, or at least 20 consecutive nucleotides of the guide RNA target sequence as set forth in SEQ ID NO: 116.

[0218] As an example, a guide RNA targeting a C9orf72 hexanucleotide repeat expansion sequence can target a guide RNA target sequence as set forth in SEQ ID NO: 117. As another example, a guide RNA targeting a C9orf72 hexanucleotide repeat expansion sequence can target at least 17, at least 18, at least 19, or at least 20 consecutive nucleotides of the guide RNA target sequence as set forth in SEQ ID NO: 117.

[0219] (5) Lipid nanoparticles containing CRISPR / Cas systems or components

[0220] Also provided are lipid nanoparticles comprising a CRISPR / Cas system or a component thereof.Regarding the CRISPR / Cas system, the lipid nanoparticle may comprise any form of Cas protein (e.g., protein, DNA or mRNA) and / or may comprise any form of guide RNA (e.g., DNA or RNA).In one example, the lipid nanoparticle comprises a Cas protein in the form of mRNA (e.g., a modified RNA as described herein) and a guide RNA in the form of RNA (e.g., a modified guide RNA as disclosed herein).As another example, the lipid nanoparticle may comprise a Cas protein in the form of protein and a guide RNA in the form of RNA.In a specific example, the guide RNA and the Cas protein are each introduced into the same LNP in the form of RNA by LNP-mediated delivery.As discussed in more detail elsewhere herein, one or more RNAs may be modified.Delivery by such methods results in transient Cas expression and / or transient presence of guide RNA, and biodegradable lipids improve clearance, improve tolerance and reduce immunogenicity.Lipid formulations can protect biomolecules from degradation while improving their cellular uptake.Lipid nanoparticles are particles comprising a plurality of lipid molecules physically associated with each other by intermolecular forces. These particles include microspheres (including single-layer and multi-layer vesicles, for example, liposomes), dispersed phases in emulsions, micelles or internal phases in suspensions. Such lipid nanoparticles can be used to encapsulate one or more nucleic acids or proteins for delivery. Formulations containing cationic lipids can be used to deliver polyanions such as nucleic acids. Other lipids that can be included are neutral lipids (i.e., uncharged or zwitterionic lipids), anionic lipids, auxiliary lipids for enhancing transfection, and stealth lipids that increase the length of time that nanoparticles can exist in vivo. See, for example, WO 2016 / 010840 A1 and WO2017 / 173054A1, each of which is incorporated herein by reference in its entirety for all purposes. Exemplary lipid nanoparticles can include cationic lipids and one or more other components.

[0221] In some LNPs, the cargo may include Cas mRNA (e.g., Cas9 mRNA) and gRNA. The ratio of Cas mRNA to gRNA may be different.

[0222] Examples of suitable LNPs can be found in, for example, WO 2019 / 067992, WO 2020 / 082042, US2020 / 0270617, WO 2020 / 082041, US2020 / 0268906, WO 2020 / 082046 (see, e.g., pages 85-86), and US2020 / 0289628, each of which is incorporated herein by reference in its entirety for all purposes. Specific examples of using LNPs for delivery to the brain are disclosed in Nabhan et al., (2016) Sci. Rep. 6:20019, which is incorporated herein by reference in its entirety for all purposes.

[0223] (6) Vectors containing CRISPR / Cas systems or components

[0224] The CRISPR / Cas system or its components can be provided in a vector for expression. The vector can include additional sequences such as an origin of replication, a promoter, and genes encoding antibiotic resistance.

[0225] Some vectors can be circular. Alternatively, the vector can be linear. The vector can be packaged to be delivered by lipid nanoparticles, liposomes, non-lipid nanoparticles or viral capsids. Non-limiting exemplary vectors include plasmids, phagemids, cosmids, artificial chromosomes, minichromosomes, transposons, viral vectors and expression vectors.

[0226] The introduction of nucleic acid can also be completed by virus-mediated delivery, such as AAV-mediated delivery or slow virus-mediated delivery. The carrier can be, for example, a viral vector, such as an adeno-associated virus (AAV) vector. AAV can be any suitable serotype and can be single-stranded AAV (ssAAV) or self-complementary AAV (scAAV). Other exemplary viruses / viral vectors include retroviruses, slow viruses, adenoviruses, vaccinia viruses, poxviruses and herpes simplex viruses. The virus can infect both dividing cells, non-dividing cells, or both dividing cells and non-dividing cells. The virus can be integrated into the host genome, or alternatively not integrated into the host genome. Such viruses can also be engineered to have reduced immunity. The virus may have replication ability or may have replication defects (for example, defects in one or more genes necessary for replication and / or packaging of other rounds of virions). Viral vectors can be genetically modified from their wild-type counterparts. For example, a viral vector may include the insertion, deletion or substitution of one or more nucleotides to promote cloning or to change one or more characteristics of the vector. Such characteristics may include packaging capacity, transduction efficiency, immunogenicity, genome integration, replication, transcription and translation. In some examples, a part of the viral genome may be deleted so that the virus can package an exogenous sequence with a larger size. In some examples, the viral vector may have an enhanced transduction efficiency. In some examples, the immune response induced by the virus in the host can be reduced. In some examples, the viral gene (such as integrase) that promotes the integration of the viral sequence into the host genome can be mutated so that the virus becomes non-integrated. In some examples, the viral vector may be replication-deficient. In some examples, the viral vector may include an exogenous transcription or translation control sequence to drive the expression of the coding sequence on the vector. In some examples, the virus may be auxiliary-dependent. For example, the virus may need one or more auxiliary components to provide the amplification vector and the viral components (such as viral proteins) required for the vector to be packaged into the viral particles. In this case, one or more auxiliary components (including one or more vectors encoding viral components) can be introduced into the host cell or host cell colony together with the vector system described herein. In other examples, the virus may be without auxiliary components. For example, the virus can amplify and package the vector without an auxiliary virus. In some examples, the vector systems described herein may also encode viral components required for viral amplification and packaging.

[0227] Exemplary viral titers (e.g., AAV titers) include about 10 12 vg / mL to about 10 16 vg / mL. Other exemplary viral titers (e.g., AAV titers) include about 10 12 vg / kg body weight to about 10 16 vg / kg body weight.

[0228] Adeno-associated virus (AAV) is endemic in multiple species including humans and non-human primates (NHPs). To date, at least 12 natural serotypes and hundreds of natural variants have been isolated and characterized. See, for example, Li et al., (2020) Nat. Rev. Genet. 21: 255-272, which is incorporated herein by reference in its entirety for all purposes. AAV particles are naturally composed of non-enveloped icosahedral protein capsids containing a single-stranded DNA (ssDNA) genome. The DNA genome is flanked by two inverted terminal repeats (ITRs), which serve as viral replication origins and packaging signals. The rep gene encodes four proteins required for viral replication and packaging, while the cap gene encodes three structural capsid subunits that determine the AAV serotype and an assembly activation protein (AAP) that promotes virion assembly in some serotypes.

[0229] Recombinant AAV (rAAV) is one of the most commonly used viral vectors in gene therapy today, treating human diseases by delivering therapeutic transgenes to target cells in vivo. rAAV vectors consist of an icosahedral capsid similar to native AAV, but rAAV virions do not encapsulate AAV protein coding sequences or AAV replication sequences. These viral vectors are non-replicating. The only viral sequences required in rAAV vectors are two ITRs, which are required to direct genome replication and packaging during rAAV vector manufacturing. The rAAV genome lacks the AAV rep and cap genes, making them non-replicative in vivo. rAAV vectors are produced by trans-expressing the rep and cap genes, as well as additional viral accessory proteins, in combination with the intended transgene cassette flanked by AAV ITRs.

[0230] In the rAAV genome, the gene expression cassette can be placed between ITR sequences. Typically, the rAAV genome cassette contains a promoter that drives the expression of the transgene, followed by a polyadenylation sequence. The ITRs flanking the rAAV expression cassette are usually derived from AAV2, the first serotype to be isolated and converted into a recombinant viral vector. Since then, most rAAV preparation methods have relied on a packaging system based on AAV2 Rep. See, for example, Colella et al., (2017) Mol. Ther. Methods Clin. Dev. 8: 87-104, which is incorporated herein by reference in its entirety for all purposes.

[0231] The specific serotype of a recombinant AAV vector influences its in vivo tropism for specific tissues. The AAV capsid protein is responsible for mediating attachment and entry into target cells, followed by endosomal escape and trafficking to the nucleus. Therefore, the choice of serotype when developing rAAV vectors will influence the cell types and tissues that the vector is most likely to bind to and transduce when injected in vivo.

[0232] Once in the nucleus, the ssDNA genome is released from the virion, and a complementary DNA strand is synthesized to generate a double-stranded DNA (dsDNA) molecule. The double-stranded AAV genome is naturally cyclized via its ITR and becomes an episome, which will persist in the nucleus outside the chromosome. Therefore, for free gene therapy procedures, the rAAV episome delivered by rAAV provides long-term, promoter-driven gene expression in non-dividing cells. However, the free DNA delivered by this rAAV is diluted as the cell divides. In contrast, the gene therapy described herein is based on gene insertion to allow long-term gene expression.

[0233] The ssDNA AAV genome consists of two open reading frames, Rep and Cap, flanked by two reverse terminal repeats that allow synthesis of complementary DNA chains. When constructing the AAV transfer plasmid, the transgene is placed between the two ITRs, and Rep and Cap can be provided in trans. In addition to Rep and Cap, AAV may also require an auxiliary plasmid containing adenovirus genes. These genes (E4, E2a and VA) mediate AAV replication. For example, transfer plasmids, Rep / Cap and auxiliary plasmids can be transfected into HEK293 cells containing adenovirus gene E1+ to produce infectious AAV particles. Alternatively, Rep, Cap and adenovirus auxiliary genes can be combined into a single plasmid. Similar packaging cells and methods can be used for other viruses, such as retroviruses.

[0234] AAV has been identified in various serotypes. These serotypes are different in the cell types (i.e., their tropism) that they infect, allowing preferential transduction of specific cell types. The term AAV includes, for example, AAV1, AAV2, AAV3, AAV3B, AAV4, AAV5, AAV6, AAV6.2, AAV7, AAVrh.64R1, AAVhu.37, AAVrh.8, AAVrh.32.33, AAV8, AAV9, AAV-DJ, AAV2 / 8, AAVrh10, AAVLK03, AV10, AAV11, AAV12, rh10 and their hybrids, avian AAV, cattle AAV, dog AAV, horse AAV, primate AAV, non-primate AAV and sheep AAV. The genome sequences of the various serotypes of AAV and the sequences of natural terminal repeats (TR), Rep albumen and capsid subunits are known in the art. Such sequences can be found in the literature or in public databases such as GenBank. As used herein, "AAV vector" refers to an AAV vector comprising a heterologous sequence of non-AAV origin (i.e., a nucleic acid sequence heterologous to AAV), typically comprising a sequence encoding an exogenous polypeptide of interest. The construct may comprise AAV1, AAV2, AAV3, AAV3B, AAV4, AAV5, AAV6, AAV6.2, AAV7, AAVrh.64R1, AAVhu.37, AAVrh.8, AAVrh.32.33, AAV8, AAV9, AAV-DJ, AAV2 / 8, AAVrh10, AAVLK03, AV10, AAV11, AAV12, rh10 and hybrids thereof, avian AAV, bovine AAV, canine AAV, equine AAV, primate AAV, non-primate AAV and ovine AAV capsid sequences. In general, the heterologous nucleotide sequence (transgene) is flanked by at least one, usually two, AAV inverted terminal repeats (ITRs). AAV vectors can be single-stranded (ssAAV) or self-complementary (scAAV). The serotypes of CNS tissues include AAV1, AAV2, AAV4, AAV5, AAV8, and AAV9. For example, the selectivity of AAV serotypes for gene delivery in neurons is discussed in Hammond et al., (2017) PLoS One 12(12): e0188830, which is incorporated herein by reference in its entirety for all purposes. In a specific example, an AAV-PHP.eB vector is used. The AAV-PHP.eB vector exhibits a high ability to cross the blood-brain barrier, increasing its CNS transduction efficiency. In another specific example, an AAV9 vector is used.

[0235] Tropism can be further refined by pseudotypes, which are mixtures of capsids and genomes from different viral serotypes. For example, AAV2 / 5 indicates a virus containing a serotype 2 genome packaged in a capsid from serotype 5. The use of pseudotyped viruses can improve transduction efficiency as well as alter tropism. Hybrid capsids derived from different serotypes can also be used to alter viral tropism. For example, AAV-DJ contains hybrid capsids from eight serotypes and exhibits high infectivity in a wide range of in vivo cell types. AAV-DJ8 is another example showing the properties of AAV-DJ, but with enhanced brain uptake. AAV serotypes can also be modified by mutations. Examples of AAV2 mutation modifications include Y444F, Y500F, Y730F, and S662V. Examples of AAV3 mutation modifications include Y705F, Y731F, and T492V. Examples of AAV6 mutation modifications include S663V and T492V. Other pseudotyped / modified AAV variants include AAV2 / 1, AAV2 / 6, AAV2 / 7, AAV2 / 8, AAV2 / 9, AAV2.5, AAV8.2, and AAV / SASTG.

[0236] To accelerate transgene expression, self-complementary AAV (scAAV) variants can be used. Since AAV relies on the cell's DNA replication machinery to synthesize the complementary strand of the AAV single-stranded DNA genome, transgene expression may be delayed. To address this delay, scAAV containing complementary sequences that can spontaneously anneal after infection can be used, thereby eliminating the need for host cell DNA synthesis. However, single-stranded AAV (ssAAV) vectors can also be used.

[0237] To increase packaging capacity, a longer transgene can be split between two AAV transfer plasmids, the first with a 3' splice donor and the second with a 5' splice acceptor. Upon co-infection of the cells, these viruses form concatemers, splice together, and the full-length transgene can be expressed. While this allows for expression of longer transgenes, the expression efficiency is low. A similar approach for increasing capacity utilizes homologous recombination. For example, a transgene can be split between two transfer plasmids but with a large amount of sequence overlap so that co-expression induces homologous recombination and expression of the full-length transgene.

[0238] In some AAVs, the cargo may include a nucleic acid encoding one or more guide RNAs (e.g., DNA encoding a guide RNA, or DNA encoding two or more guide RNAs). In some AAVs, the cargo may include a nucleic acid encoding a Cas protein (such as Cas9) (e.g., DNA) and a DNA encoding one or more guide RNAs (e.g., DNA encoding a guide RNA, or DNA encoding two or more guide RNAs).

[0239] For example, Cas or Cas9 and one or more gRNA (e.g., 1 gRNA or 2 gRNA or 3 gRNA or 4 gRNA) can be delivered via LNP-mediated delivery (e.g., in the form of RNA) or adeno-associated virus (AAV)-mediated delivery. For example, Cas9 mRNA and gRNA can be delivered via LNP-mediated delivery, or DNA encoding Cas9 and DNA encoding gRNA can be delivered via AAV-mediated delivery. Cas or Cas9 and gRNA can be delivered in a single AAV or via two separate AAVs. For example, the first AAV can carry a Cas or Cas9 expression cassette, and the second AAV can carry a gRNA expression cassette. Similarly, the first AAV can carry a Cas or Cas9 expression cassette, and the second AAV can carry two or more gRNA expression cassettes. Alternatively, a single AAV can carry a Cas or Cas9 expression cassette (e.g., a Cas or Cas9 coding sequence operably connected to a promoter) and a gRNA expression cassette (e.g., a gRNA coding sequence operably connected to a promoter). Similarly, a single AAV can carry a Cas or Cas9 expression cassette (e.g., a Cas or Cas9 coding sequence operably linked to a promoter) and two or more gRNA expression cassettes (e.g., a gRNA coding sequence operably linked to a promoter). Different promoters can be used to drive the expression of gRNA, such as the U6 promoter or a small tRNA Gln. Similarly, different promoters can be used to drive Cas9 expression. For example, a small promoter is used so that the Cas9 coding sequence can be adapted to the AAV construct. Similarly, a small Cas9 protein (e.g., SaCas9 or CjCas9 is used to maximize AAV packaging capacity).

[0240] III. Methods and methods for inhibiting transcription of the C9orf72 exon 1A transcription start site in a cell or subject Method for preventing, treating or ameliorating at least one symptom or indication of a disease associated with C9orf72 hexanucleotide repeat sequence expansion

[0241] Also disclosed herein are methods of inhibiting transcription of the C9orf72 exon 1A transcription start site and / or inhibiting transcription of sense and / or antisense transcripts comprising a hexanucleotide repeat expansion sequence using the CRISPR / Cas system described herein, as well as the use of the CRISPR / Cas system in prophylactic and therapeutic applications for treating and / or preventing C9orf72 hexanucleotide repeat expansion-related diseases and / or for ameliorating at least one symptom associated with such diseases. Such methods may, for example, reduce or eliminate the expression of transcripts that initiate at C9orf72 exon 1A. Such methods may also, for example, reduce or eliminate the expression of transcripts containing C9orf72 hexanucleotide repeats. Such methods may also, for example, reduce or eliminate the expression of transcripts containing sense C9orf72 hexanucleotide repeats. Such methods may also, for example, reduce or eliminate the expression of transcripts containing antisense C9orf72 hexanucleotide repeats. Such methods may also, for example, reduce or eliminate the expression of both transcripts containing sense and antisense C9orf72 hexanucleotide repeats. Such methods may, for example, selectively or preferentially reduce or eliminate expression of transcripts starting at C9orf72 exon 1A relative to the effect on expression of transcripts starting at C9orf72 exon 1B (i.e., the expression of transcripts starting at C9orf72 exon 1A is reduced to a greater extent than the expression of transcripts starting at C9orf72 exon 1B). Such methods may also, for example, selectively or preferentially reduce or eliminate expression of transcripts containing C9orf72 hexanucleotide repeats relative to the effect on expression of transcripts starting at C9orf72 exon 1B (i.e., the expression of transcripts containing C9orf72 hexanucleotide repeats is reduced to a greater extent than the expression of transcripts starting at C9orf72 exon 1B). Such methods may also, for example, selectively or preferentially reduce or eliminate expression of transcripts containing sense C9orf72 hexanucleotide repeats relative to the effect on expression of transcripts starting at C9orf72 exon 1B (i.e., the expression of transcripts containing sense C9orf72 hexanucleotide repeats is reduced to a greater extent than the expression of transcripts starting at C9orf72 exon 1B). Such methods may also, for example, selectively or preferentially reduce or eliminate expression of transcripts containing antisense C9orf72 hexanucleotide repeats relative to the effect on expression of transcripts starting at C9orf72 exon 1B (i.e., the expression of transcripts containing antisense C9orf72 hexanucleotide repeats is reduced to a greater extent than the expression of transcripts starting at C9orf72 exon 1B).Such methods can also, for example, selectively or preferentially reduce or eliminate expression of both transcripts containing sense and antisense C9orf72 hexanucleotide repeats relative to the effect on expression of transcripts starting at C9orf72 exon 1B (i.e., reducing expression of both transcripts containing sense and antisense C9orf72 hexanucleotide repeats to a greater extent than reducing expression of transcripts starting at C9orf72 exon 1B). In some methods, the CRISPR / Cas system reduces or eliminates expression of transcripts starting at C9orf72 exon 1A, but does not reduce or eliminate expression of transcripts starting at C9orf72 exon 1B. In some methods, the CRISPR / Cas system reduces or eliminates expression of transcripts containing C9orf72 hexanucleotide repeats, but does not reduce or eliminate expression of transcripts starting at C9orf72 exon 1B. In some methods, the CRISPR / Cas system reduces or eliminates expression of transcripts containing sense C9orf72 hexanucleotide repeats, but does not reduce or eliminate expression of transcripts starting at C9orf72 exon 1B. In some methods, the CRISPR / Cas system reduces or eliminates expression of transcripts containing antisense C9orf72 hexanucleotide repeats, but does not reduce or eliminate expression of transcripts starting at C9orf72 exon 1B. In some methods disclosed herein, the CRISPR / Cas system reduces or eliminates expression of transcripts containing both sense and antisense C9orf72 hexanucleotide repeats, but does not reduce or eliminate expression of transcripts starting at C9orf72 exon 1B. In some methods disclosed herein, the CRISPR / Cas system reduces expression of a polyGA dipeptide repeat protein. In some methods disclosed herein, the CRISPR / Cas system reduces expression of a polyGP dipeptide repeat protein. In some methods disclosed herein, the CRISPR / Cas system reduces the expression of both polyGA dipeptide repeat proteins and polyGP dipeptide repeat proteins.

[0242] A. Methods of Inhibiting Transcription of the C9orf72 Exon 1A Transcription Start Site in a Cell or Subject

[0243] Various methods are provided for inhibiting transcription of the C9orf72 exon 1A transcription start site and / or inhibiting transcription of sense and / or antisense transcripts comprising a hexanucleotide repeat expansion sequence using the CRISPR / Cas system described elsewhere herein (e.g., a Cas protein or a nucleic acid encoding the same, and one or more C9orf72 targeting gRNAs or DNA encoding the same).

[0244] The C9orf72 gene can be in an animal or a cell, and the methods can be performed in vitro, ex vivo or in vivo. Animals include mammals, fish and birds. The mammal can be, for example, a non-human mammal, a human, a rodent, a rat, a mouse or a hamster. In one example, the animal is a human. Other non-human mammals include, for example, non-human primates (e.g., cynomolgus monkeys), monkeys, apes, cats, dogs, rabbits, horses, bulls, deer, bison, livestock (e.g., bovine species such as cattle, steers, etc.; ovine species such as sheep, goats, etc.; and porcine species such as pigs and wild boars). Birds include, for example, chickens, turkeys, ostriches, geese, ducks, etc. Domestic animals and agricultural animals are also included. The animals in the methods disclosed herein can be humans or they can be non-human animals. In a specific example, the C9orf72 gene is in a human or a human cell. The term "non-human" does not include humans. Specific examples of non-human animals include rodents such as mice and rats, or non-human primates such as cynomolgus monkeys.

[0245] The cell used in these methods can be from any type of animal, and they can be any type of undifferentiated or differentiated state.The cell can be in vitro, in vitro or in vivo.For example, the cell can be a non-human omnipotent cell, a pluripotent cell (for example, a human pluripotent cell or a non-human pluripotent cell, such as a mouse embryonic stem (ES) cell or a rat ES cell) or a non-pluripotent cell.Totipotent cells include undifferentiated cells that can produce any cell type, and pluripotent cells include undifferentiated cells with the ability to develop into more than a differentiated cell type.In some embodiments, human cells are not omnipotent cells.In some embodiments, human cells are not pluripotent cells.

[0246] The cell provided herein can also be a germ cell (e.g., sperm or oocyte) or a non-human germ cell. The cell can be a mitotic competent cell or a mitotic inactive cell, a meiotic competent cell or a meiotic inactive cell. Similarly, the cell can also be a primary somatic cell or a cell that is not a primary somatic cell. Somatic cells include any cell that is not a gamete, a germ cell, a gamete mother cell or an undifferentiated stem cell. For example, the cell can be a hepatocyte, a kidney cell, a hematopoietic cell, an endothelial cell, an epithelial cell, a fibroblast, a mesenchymal cell, a keratinocyte, a hemocyte, a melanocyte, a monocyte, a mononuclear cell, a mononuclear cell precursor, a B cell, an erythrocyte-megakaryocyte, an eosinophil, a macrophage, a T cell, a pancreatic islet beta cell, an exocrine cell, a pancreatic progenitor cell, an endocrine progenitor cell, a fat cell, a preadipocyte, a neuron, a glial cell, a neural stem cell, a neuron, a hepatoblast, a hepatocyte, a cardiomyocyte, a bone marrow cell, a basal ... Skeletal muscle cells, smooth muscle cells, ductal cells, acinar cells, alpha cells, beta cells, delta cells, PP cells, bile duct cells, white or brown fat cells or eye cells (e.g., trabecular meshwork cells, retinal pigment epithelial cells, retinal microvascular endothelial cells, retinal pericytes, conjunctival epithelial cells, conjunctival fibroblasts, iris pigment epithelial cells, corneal cells, lens epithelial cells, non-pigmented ciliary epithelial cells, choroidal fibroblasts, photoreceptor cells, ganglion cells, bipolar cells, horizontal cells or amacrine cells). For example, the cell can be a neuron, such as a motor neuron. The cells provided herein can be normal healthy cells, or can be diseased or mutant cells, such as cells comprising a six-nucleotide repeat expansion at the C9orf72 locus.

[0247] Non-human animals can be from any genetic background. For example, suitable mice can be from 129 strains, C57BL / 6 strains, a mixture of 129 and C57BL / 6, BALB / c strains or Swiss Webster strains. The example of 129 strains includes 129P1, 129P2, 129P3, 129X1, 129S1 (e.g., 129S1 / SV, 129S1 / Svlm), 129S2, 129S4, 129S5, 129S9 / SvEvH, 129S6 (129 / SvEvTac), 129S7, 129S8, 129T1 and 129T2. See, for example, Festing et al., (1999) Mamm. Genome 10 (8): 836, which is incorporated herein by reference in its entirety for all purposes. The example of C57BL strain includes C57BL / A, C57BL / An, C57BL / GrFa, C57BL / Kal_wN, C57BL / 6, C57BL / 6J, C57BL / 6ByJ, C57BL / 6NJ, C57BL / 10, C57BL / 10ScSn, C57BL / 10Cr and C57BL / Ola. Suitable mice can also be from the mixing of the above-mentioned 129 strain and the above-mentioned C57BL / 6 strain (for example, 50% 129 and 50% C57BL / 6). Similarly, suitable mice can be from the mixing of the above-mentioned 129 strain or the mixing of the above-mentioned BL / 6 strain (for example, 129S6 (129 / SvEvTac) strain).

[0248] Similarly, rats can be from any rat strain, including, for example, the ACI rat strain, the black spiny rat (DA) rat strain, the Wistar rat strain, the LEA rat strain, the Sprague Dawley (SD) rat strain, or the Fischer rat strain, such as the Fischer F344 or the Fischer F6. Rats can also be obtained from mixed strains derived from two or more of the above strains. For example, suitable rats can be from the DA strain or the ACI strain. The ACI rat strain is characterized by having a dark gray color, but a white abdomen and feet and RT1 av1 Haplotype. These strains are available from a variety of sources, including Harlan Laboratories. The Dark Agouti (DA) rat strain is characterized by a gray coat and RT1 av1 Haplotype. Such rats are available from a variety of sources, including Charles River and Harlan Laboratories. In some cases, suitable rats may be from inbred rat strains. See, for example, US2014 / 0235933, which is incorporated herein by reference in its entirety for all purposes.

[0249] CRISPR / Cas reagents can be introduced into cells or animals in any form and by any means as described elsewhere herein, and all or some of them can be introduced simultaneously or sequentially in any combination as described elsewhere herein.

[0250] In some methods, the method includes contacting a C9orf72 gene with a first CRISPR / Cas complex comprising a nuclease-inactive Cas protein and a first guide RNA comprising a first DNA targeting segment that targets a first guide RNA target sequence upstream or near a C9orf72 exon 1A transcription start site, wherein the first CRISPR / Cas complex binds to the first guide RNA target sequence. For example, the first guide RNA target sequence can be within about 250, about 225, about 200, about 175, about 150, about 125, about 100, about 75, or about 50 nucleotides of the C9orf72 exon 1A transcription start site. Alternatively, the first guide RNA target sequence can be within about 100, about 75, or about 50 nucleotides of the C9orf72 exon 1A transcription start site or any other position disclosed herein. In some methods, the method comprises contacting the C9orf72 gene with at least two CRISPR / Cas complexes, wherein each CRISPR / Cas complex comprises a nuclease-inactive Cas protein and a different guide RNA, wherein each different guide RNA targets a different guide RNA target sequence upstream or near the C9orf72 exon 1A transcription start site, and / or in another example, the method comprises contacting the C9orf72 gene with at least three CRISPR / Cas complexes, wherein each CRISPR / Cas complex comprises a nuclease-inactive Cas protein and a different guide RNA, wherein each different guide RNA targets a different guide RNA target sequence upstream or near the C9orf72 exon 1A transcription start site, and / or For example, each guide RNA target sequence can be within about 250, about 225, about 200, about 175, about 150, about 125, about 100, about 75, or about 50 nucleotides of the C9orf72 exon 1A transcription start site. Alternatively, each guide RNA target sequence can be within about 100, about 75, or about 50 nucleotides of the C9orf72 exon 1A transcription start site, or any other position disclosed herein.

[0251] In some methods, the method includes contacting the C9orf72 gene with a second CRISPR / Cas complex comprising a nuclease-inactive Cas protein and a second guide RNA comprising a second DNA targeting segment that targets a second guide RNA target sequence within a C9orf72 hexanucleotide repeat expansion sequence between a first non-coding endogenous exon and exon 2 of the C9orf72 gene, wherein the second CRISPR / Cas complex binds to the first guide RNA target sequence. In some methods, the method includes contacting the C9orf72 gene with at least two CRISPR / Cas complexes, wherein each CRISPR / Cas complex comprises a nuclease-inactive Cas protein and a different guide RNA, wherein each different guide RNA targets a different guide RNA target sequence within a C9orf72 hexanucleotide repeat expansion sequence between a first non-coding endogenous exon and exon 2 of the C9orf72 gene. In some methods, the method comprises contacting a C9orf72 gene with at least three or at least four CRISPR / Cas complexes, wherein each CRISPR / Cas complex comprises a nuclease-inactive Cas protein and a different guide RNA, wherein each different guide RNA targets a different guide RNA target sequence within a C9orf72 hexanucleotide repeat expansion sequence between a first noncoding endogenous exon and exon 2 of the C9orf72 gene.

[0252] In some methods, the method can include: (a) contacting the C9orf72 gene with a first CRISPR / Cas complex comprising a nuclease-inactive Cas protein and a first guide RNA comprising a first DNA targeting segment that targets a first guide RNA target sequence upstream or near the transcription start site of exon 1A of C9orf72, wherein the first CRISPR / Cas complex binds to the first guide RNA target sequence; and (b) contacting the C9orf72 gene with a second CRISPR / Cas complex comprising a nuclease-inactive Cas protein and a second guide RNA comprising a second DNA targeting segment that targets a second guide RNA target sequence within a C9orf72 hexanucleotide repeat expansion sequence between a first non-coding endogenous exon and exon 2 of the C9orf72 gene, wherein the second CRISPR / Cas complex binds to the first guide RNA target sequence. In some methods, part (a) may include contacting the C9orf72 gene with at least two CRISPR / Cas complexes, wherein each CRISPR / Cas complex comprises a nuclease-inactive Cas protein and a different guide RNA, wherein each different guide RNA targets a different guide RNA target sequence upstream or near the C9orf72 exon 1A transcription start site, and / or in some methods, part (a) may include contacting the C9orf72 gene with at least three CRISPR / Cas complexes, wherein each CRISPR / Cas complex comprises a nuclease-inactive Cas protein and a different guide RNA, wherein each different guide RNA targets a different guide RNA target sequence upstream or near the C9orf72 exon 1A transcription start site. guide RNA, wherein each different guide RNA targets a different guide RNA target sequence upstream or near the C9orf72 exon 1A transcription start site, and / or in some methods, part (b) may include contacting the C9orf72 gene with at least two CRISPR / Cas complexes, wherein each CRISPR / Cas complex comprises a nuclease-inactive Cas protein and a different guide RNA, wherein each different guide RNA targets a different guide RNA target sequence within the C9orf72 hexanucleotide repeat expansion sequence between the first non-coding endogenous exon and exon 2 of the C9orf72 gene. In some methods, part (b) may include contacting the C9orf72 gene with at least three or at least four CRISPR / Cas complexes, wherein each CRISPR / Cas complex comprises a nuclease-inactive Cas protein and a different guide RNA, wherein each different guide RNA targets a different guide RNA target sequence within the C9orf72 hexanucleotide repeat expansion sequence between the first non-coding endogenous exon and exon 2 of the C9orf72 gene.

[0253] Examples and variations of Cas proteins and guide RNAs that can be used in these methods are described elsewhere herein.

[0254] The guide RNA can be introduced into an animal or cell, for example, in the form of RNA (e.g., in vitro transcribed RNA, such as a modified guide RNA disclosed herein) or in the form of a DNA encoding the guide RNA. When introduced in the form of DNA, the DNA encoding the guide RNA can be operably linked to a promoter active in a cell or in a cell of an animal. For example, the guide RNA can be delivered via AAV and expressed in vivo under the U6 promoter. Such DNA can be in one or more expression constructs. For example, such expression constructs can be components of a single nucleic acid molecule. Alternatively, it can be separated in any combination between two or more nucleic acid molecules (i.e., DNA encoding one or more CRISPR RNAs and DNA encoding one or more tracrRNAs can be components of separate nucleic acid molecules).

[0255] Similarly, the Cas protein can be introduced into an animal or cell in any form. For example, the Cas protein can be provided in the form of a protein, such as a Cas protein complexed with a gRNA. Alternatively, the Cas protein can be provided in the form of a nucleic acid encoding the Cas protein, such as RNA (e.g., messenger RNA (mRNA)), such as a modified mRNA as disclosed herein, or DNA. Optionally, the nucleic acid encoding the Cas protein can be codon optimized to be effectively translated into a protein in a specific cell or organism. For example, the nucleic acid encoding the Cas protein can be modified to replace a codon with a higher frequency of use in mammalian cells, human cells, rodent cells, mouse cells, rat cells, or any other host cell of interest compared to a naturally occurring polynucleotide sequence. When the nucleic acid encoding the Cas protein is introduced into a cell or animal, the Cas protein can be expressed transiently, conditionally, or constitutively in a cell or in a cell of an animal.

[0256] In one example, the Cas protein is introduced in the form of mRNA (e.g., a modified mRNA as disclosed herein), and the guide RNA is introduced in the form of RNA (such as, a modified gRNA as disclosed herein) (e.g., together within the same lipid nanoparticle).

[0257] The guide RNA can be modified as disclosed elsewhere herein. Likewise, the Cas mRNA can be modified as disclosed elsewhere herein.

[0258] The guide RNA and CRISPR / Cas systems described in the compositions and methods disclosed herein target guide RNA target sequences in the C9orf72 gene. The C9orf72 gene can be, for example, a mammalian C9orf72 gene. In a specific example, the C9orf72 gene comprises a human C9orf72 promoter. In a specific example, the C9orf72 gene is a human C9orf72 gene. In another specific example, the C9orf72 gene is a humanized C9orf72 gene. For example, the C9orf72 gene can be a non-human animal (e.g., a non-human mammal, a rodent, a rat, or a mouse) C9orf72 gene, wherein a human hexanucleotide repeat amplification sequence and a flanking human sequence are inserted into an endogenous C9orf72 locus to replace the corresponding endogenous sequence. See, for example, US2020-0196581 and WO 2020 / 131632, each of which is incorporated herein by reference in its entirety for all purposes.

[0259] Optionally, the C9orf72 gene comprises a C9orf72 hexanucleotide repeat amplification sequence between the first non-coding endogenous exon and exon 2 of the C9orf72 gene. The C9orf72 hexanucleotide repeat amplification sequence is typically a nucleotide sequence comprising at least two tandem repeats (i.e., consecutive repeats adjacent to each other without intervening sequences) of the hexanucleotide sequence G4C2. The hexanucleotide repeat amplification sequence may have any number of repeats. Optionally, the hexanucleotide repeat amplification sequence has more than about 30 repeats. In some embodiments, the hexanucleotide repeat amplification sequence has more than about 100 repeats, more than about 200 repeats, more than about 300 repeats, more than about 400 repeats, more than about 500 repeats, more than about 600 repeats, more than about 700 repeats, more than about 800 repeats, more than about 900 repeats, or more than about 1000 repeats.

[0260] The guide RNA target sequence can be upstream or near the C9orf72 exon 1A transcription start site and / or can be within the C9orf72 hexanucleotide repeat expansion sequence between the first non-coding endogenous exon and exon 2 of C9orf72. Transcription of the C9orf72 gene initiates at two alternative non-coding exons: exon 1A (upstream) and exon 1B (downstream). The G4C2 repeat sequence is located between exons 1A and 1B. Exons 1A and 1B can be spliced ​​to exon 2 (the first protein-coding exon), thereby generating mRNA with an alternative 5'-untranslated region. In healthy people with a short G4C2 repeat sequence expansion, transcription is mainly initiated at exon 1B; RNA including exon 1A is rare, and RNA containing the repeat sequence is undetectable. People with C9orf72 ALS or FTLD accumulate transcripts in which exon 1A is spliced ​​to exon 2, and both sense and antisense repeat-containing RNAs and the DPR proteins translated from them can be detected by in situ hybridization and immunohistochemistry.

[0261] In one example, the guide RNA target sequence can be within about 250, about 225, about 200, about 175, about 150, about 125, about 100, about 75, about 50, about 25, about 20, or about 10 nucleotides of the C9orf72 exon 1A transcription start site. In another example, the guide RNA target sequence can be within about 100, within about 75, within about 50, within about 25, within about 20, or within about 10 of the C9orf72 exon 1A transcription start site.

[0262] In one example, the guide RNA target sequence can be within the C9orf72 hexanucleotide repeat expansion sequence between the first non-coding endogenous exon and exon 2 of the C9orf72 gene.

[0263] In some compositions and methods disclosed herein, two or more guide RNAs or CRISPR / Cas systems are used to target two or more guide RNA target sequences in the C9orf72 gene. In one example, each of the two or more guide RNA target sequences is upstream or near the C9orf72 exon 1A transcription start site as described above. In another example, each of the two or more guide RNA target sequences is within the C9orf72 hexanucleotide repeat expansion sequence between the first non-coding endogenous exon and exon 2 of the C9orf72 gene. In some compositions and methods disclosed herein, three or more guide RNAs or CRISPR / Cas systems are used to target three or more guide RNA target sequences in the C9orf72 gene. In one example, each of the three or more guide RNA target sequences is upstream or near the C9orf72 exon 1A transcription start site as described above. In another example, each of the three or more guide RNA target sequences is within the C9orf72 hexanucleotide repeat expansion sequence between the first non-coding endogenous exon and exon 2 of the C9orf72 gene. In another example, at least one guide RNA target sequence is upstream or near the C9orf72 exon 1A transcription start site as described above, and at least one guide RNA target sequence is within the C9orf72 hexanucleotide repeat expansion sequence between the first non-coding endogenous exon and exon 2 of C9orf72.

[0264] Guide RNA target sequences can also be selected to minimize or avoid off-target effects (e.g., by avoiding two or fewer mismatches with off-target genomic sequences).

[0265] Methods for measuring expression of transcripts starting at C9orf72 exon 1A, expression of transcripts starting at C9orf72 exon 1B, and expression of transcripts containing sense and antisense C9orf72 hexanucleotide repeats are known and described elsewhere herein. Expression assessment (or measuring RNA foci and dipeptide repeats as described elsewhere herein) can be performed in any cell type (e.g., neurons, such as motor neurons).

[0266] In some methods, the resulting expression percentage of the C9orf72 exon 1A transcription start site (i.e., expression of transcripts comprising exon 1A) in treated cells compared to control untreated cells or before administration (in vitro, ex vivo, or in vivo) can be less than about 90%, less than about 85%, less than about 80%, less than about 75%, less than about 70%, less than about 65%, less than about 60%, less than about 55%, less than about 50%, less than about 45%, less than about 40%, less than about 35%, less than about 30%, or less than about 25%. The resulting expression percentage can be, for example, 1 week after administration, 2 weeks after administration, 3 weeks after administration, or 4 weeks after administration, or any other suitable time.

[0267] In some methods, the percentage reduction in expression of the C9orf72 exon 1A transcription start site in treated cells compared to control untreated cells or before administration (in vitro, ex vivo or in vivo) can be at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, or at least about 75%. The percentage reduction can be, for example, 1 week after administration, 2 weeks after administration, 3 weeks after administration, or 4 weeks after administration, or any other suitable time.

[0268] In some methods, the resulting expression percentage of transcripts containing the C9orf72 hexanucleotide repeat sequence in treated cells (e.g., neurons, such as motor neurons) can be less than about 90%, less than about 85%, less than about 80%, less than about 75%, less than about 70%, less than about 65%, less than about 60%, less than about 55%, less than about 50%, less than about 45%, less than about 40%, less than about 35%, less than about 30%, or less than about 25%, compared to control untreated cells or before administration (in vitro, ex vivo, or in vivo). The resulting expression percentage can be, for example, 1 week after administration, 2 weeks after administration, 3 weeks after administration, or 4 weeks after administration, or any other suitable time.

[0269] In some methods, the percentage reduction in expression of transcripts containing the C9orf72 hexanucleotide repeat sequence in treated cells (e.g., neurons, such as motor neurons) can be at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, or at least about 75% compared to control untreated cells or before administration (in vitro, ex vivo, or in vivo). The percentage reduction can be, for example, 1 week after administration, 2 weeks after administration, 3 weeks after administration, or 4 weeks after administration, or any other suitable time.

[0270] In some methods, the resulting expression percentage of transcripts containing the sense C9orf72 hexanucleotide repeat sequence in treated cells (e.g., neurons, such as motor neurons) can be less than about 90%, less than about 85%, less than about 80%, less than about 75%, less than about 70%, less than about 65%, less than about 60%, less than about 55%, less than about 50%, less than about 45%, less than about 40%, less than about 35%, less than about 30%, or less than about 25%, compared to control untreated cells or before administration (in vitro, ex vivo, or in vivo). The resulting expression percentage can be, for example, 1 week after administration, 2 weeks after administration, 3 weeks after administration, or 4 weeks after administration, or any other suitable time.

[0271] In some methods, the percentage reduction in expression of transcripts containing the sense C9orf72 hexanucleotide repeat sequence in treated cells (e.g., neurons, such as motor neurons) can be at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, or at least about 75% compared to control untreated cells or before administration (in vitro, ex vivo, or in vivo). The percentage reduction can be, for example, 1 week after administration, 2 weeks after administration, 3 weeks after administration, or 4 weeks after administration, or any other suitable time.

[0272] In some methods, the resulting expression percentage of transcripts containing the antisense C9orf72 hexanucleotide repeat sequence in treated cells (e.g., neurons, such as motor neurons) can be less than about 90%, less than about 85%, less than about 80%, less than about 75%, less than about 70%, less than about 65%, less than about 60%, less than about 55%, less than about 50%, less than about 45%, less than about 40%, less than about 35%, less than about 30%, or less than about 25%, compared to control untreated cells or before administration (in vitro, ex vivo, or in vivo). The resulting expression percentage can be, for example, 1 week after administration, 2 weeks after administration, 3 weeks after administration, or 4 weeks after administration, or any other suitable time.

[0273] In some methods, the percentage reduction in expression of transcripts containing the antisense C9orf72 hexanucleotide repeat sequence in treated cells (e.g., neurons, such as motor neurons) can be at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, or at least about 75% compared to control untreated cells or before administration (in vitro, ex vivo, or in vivo). The percentage reduction can be, for example, 1 week after administration, 2 weeks after administration, 3 weeks after administration, or 4 weeks after administration, or any other suitable time.

[0274] In some methods, the resulting expression percentage of transcripts containing both sense and antisense C9orf72 hexanucleotide repeat sequences in treated cells (e.g., neurons, such as motor neurons) can be less than about 90%, less than about 85%, less than about 80%, less than about 75%, less than about 70%, less than about 65%, less than about 60%, less than about 55%, less than about 50%, less than about 45%, less than about 40%, less than about 35%, less than about 30%, or less than about 25% compared to control untreated cells or before administration (in vitro, ex vivo, or in vivo). The resulting expression percentage can be, for example, at 1 week after administration, 2 weeks after administration, 3 weeks after administration, or 4 weeks after administration, or any other suitable time.

[0275] In some methods, the percentage reduction in expression of transcripts containing both sense and antisense C9orf72 hexanucleotide repeat sequences in treated cells (e.g., neurons, such as motor neurons) can be at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, or at least about 75% compared to control untreated cells or before administration (in vitro, ex vivo, or in vivo). The percentage reduction can be, for example, 1 week after administration, 2 weeks after administration, 3 weeks after administration, or 4 weeks after administration, or any other suitable time.

[0276] In some methods, the percentage reduction in expression of a polyGA dipeptide repeat protein in treated cells (e.g., neurons, such as motor neurons) can be at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, or at least about 75%, compared to control untreated cells or before administration (in vitro, ex vivo, or in vivo). The percentage reduction can be, for example, 1 week after administration, 2 weeks after administration, 3 weeks after administration, or 4 weeks after administration, or any other suitable time.

[0277] In some methods, the percentage reduction in expression of a polyGP dipeptide repeat protein in treated cells (e.g., neurons, such as motor neurons) can be at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, or at least about 75%, compared to control untreated cells or before administration (in vitro, ex vivo, or in vivo). The percentage reduction can be, for example, 1 week after administration, 2 weeks after administration, 3 weeks after administration, or 4 weeks after administration, or any other suitable time.

[0278] In some methods, the percentage reduction in expression of polyGA and polyGP dipeptide repeat proteins in treated cells (e.g., neurons, such as motor neurons) can be at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, or at least about 75%, compared to control untreated cells or before administration (in vitro, ex vivo, or in vivo). The percentage reduction can be, for example, 1 week after administration, 2 weeks after administration, 3 weeks after administration, or 4 weeks after administration, or any other suitable time.

[0279] Such methods may, for example, reduce or eliminate the expression of transcripts that initiate at C9orf72 exon 1A. Such methods may also, for example, reduce or eliminate the expression of transcripts containing C9orf72 hexanucleotide repeats. Such methods may also, for example, reduce or eliminate the expression of transcripts containing sense C9orf72 hexanucleotide repeats. Such methods may also, for example, reduce or eliminate the expression of transcripts containing antisense C9orf72 hexanucleotide repeats. Such methods may also, for example, reduce or eliminate the expression of both transcripts containing sense and antisense C9orf72 hexanucleotide repeats. Such methods may, for example, selectively or preferentially reduce or eliminate the expression of transcripts that initiate at C9orf72 exon 1A relative to the effect on the expression of transcripts that initiate at C9orf72 exon 1B (i.e., the expression of transcripts that initiate at C9orf72 exon 1A is reduced to a greater extent than the expression of transcripts that initiate at C9orf72 exon 1B). Such methods may also, for example, selectively or preferentially reduce or eliminate expression of transcripts containing C9orf72 hexanucleotide repeats relative to the effect on expression of transcripts starting at C9orf72 exon 1B (i.e., the expression of transcripts containing C9orf72 hexanucleotide repeats is reduced to a greater extent than the expression of transcripts starting at C9orf72 exon 1B). Such methods may also, for example, selectively or preferentially reduce or eliminate expression of transcripts containing sense C9orf72 hexanucleotide repeats relative to the effect on expression of transcripts starting at C9orf72 exon 1B (i.e., the expression of transcripts containing sense C9orf72 hexanucleotide repeats is reduced to a greater extent than the expression of transcripts starting at C9orf72 exon 1B). Such methods may also, for example, selectively or preferentially reduce or eliminate the expression of transcripts containing antisense C9orf72 hexanucleotide repeats relative to the effect on the expression of transcripts starting at C9orf72 exon 1B (i.e., the expression of transcripts containing antisense C9orf72 hexanucleotide repeats is reduced to a greater extent than the expression of transcripts starting at C9orf72 exon 1B). Such methods may also, for example, selectively or preferentially reduce or eliminate the expression of transcripts containing both sense and antisense C9orf72 hexanucleotide repeats relative to the effect on the expression of transcripts starting at C9orf72 exon 1B (i.e., the expression of transcripts containing both sense and antisense C9orf72 hexanucleotide repeats is reduced to a greater extent than the expression of transcripts starting at C9orf72 exon 1B). In some methods, the CRISPR / Cas system reduces or eliminates expression of transcripts that initiate at C9orf72 exon 1A, but does not reduce or eliminate expression of transcripts that initiate at C9orf72 exon 1B.In some methods, the CRISPR / Cas system reduces or eliminates expression of transcripts containing C9orf72 hexanucleotide repeats, but does not reduce or eliminate expression of transcripts starting at C9orf72 exon 1B. In some methods, the CRISPR / Cas system reduces or eliminates expression of transcripts containing sense C9orf72 hexanucleotide repeats, but does not reduce or eliminate expression of transcripts starting at C9orf72 exon 1B. In some methods, the CRISPR / Cas system reduces or eliminates expression of transcripts containing antisense C9orf72 hexanucleotide repeats, but does not reduce or eliminate expression of transcripts starting at C9orf72 exon 1B. In some methods, the CRISPR / Cas system reduces or eliminates expression of transcripts containing both sense and antisense C9orf72 hexanucleotide repeats, but does not reduce or eliminate expression of transcripts starting at C9orf72 exon 1B.

[0280] Some methods result in a reduction in RNA aggregation points containing sense and / or antisense repeats in treated cells (e.g., neurons, such as motor neurons) compared to control untreated cells or before administration (in vitro, ex vivo or in vivo). Some methods result in a reduction in dipeptide repeat proteins (e.g., poly(glycine-alanine), poly(glycine-proline), poly(glycine-arginine), poly(alanine-proline) and / or poly(proline-arginine)) synthesized by repeat-related non-AUG-dependent translation of RNA containing sense and antisense repeats in treated cells (e.g., neurons, such as motor neurons) compared to control untreated cells or before administration (in vitro, ex vivo or in vivo).

[0281] B. Preventive or therapeutic use

[0282] The CRISPR / Cas system for targeting C9orf72 disclosed herein and methods for inhibiting transcription of the C9orf72 exon 1A transcription start site and / or inhibiting transcription of sense and / or antisense transcripts comprising a hexanucleotide repeat expansion sequence of C9orf72 in a cell can be used to treat and / or prevent C9orf72 hexanucleotide repeat expansion-related diseases and / or for improving at least one symptom or indication associated with such diseases. In a specific example, the disease is amyotrophic lateral sclerosis (ALS) or frontotemporal dementia (FTD). ALS (also known as Lou Gehrig's disease) is the most common adult-onset paralytic disorder characterized by the loss of upper motor neurons and / or lower motor neurons. In the United States, ALS occurs in up to 20,000 individuals, with approximately 5,000 new cases occurring each year. Frontotemporal dementia (also known as Pick's disease, frontotemporal lobar degeneration, or FTLD) is a group of disorders caused by progressive cell degeneration in the frontal or temporal lobes of the brain. FTD is reported to account for 10%-15% of all dementia cases. A hexanucleotide repeat expansion sequence between exons 1A and 1B (two non-coding exons of the human C9ORF72 gene) has been associated with both ALS and FTD. It is estimated that the G4C2 hexanucleotide repeat expansion accounts for about 50% of familial and many non-familial ALS cases. It is present in about 25% of familial FTD cases and about 8% of sporadic FTD cases.

[0283] Many signs or symptoms associated with the hexanucleotide repeat expansion sequence in C9ORF72 have been reported, such as repeat length-dependent formation of RNA foci, sequestration of specific RNA-binding proteins, and accumulation and aggregation of dipeptide repeat proteins (e.g., poly(glycine-alanine), poly(glycine-proline), poly(glycine-arginine), poly(alanine-proline), or poly(proline-arginine), dipeptide repeat proteins) generated by translation of repeat-associated non-AUG (AUG).

[0284] It is not known how the C9orf72 hexanucleotide repeat expansion causes motor neuron disease and dementia, but two common postmortem pathological findings in C9orf72 ALS and FTD patients are associated with the repeat expansion: (1) RNA containing the sense and antisense repeats can be visualized as distinct foci in neurons and other cells; and (2) the dipeptide repeat proteins poly(glycine-alanine), poly(glycine-proline), poly(glycine-arginine), poly(alanine-proline), and poly(proline-arginine) can be detected in cells, synthesized by repeat-associated AUG-independent translation from the sense and antisense repeat-containing RNAs. One disease hypothesis proposes that the repeat-containing RNAs that appear as foci disrupt cellular RNA metabolism by sequestering RNA-binding proteins. Another disease hypothesis proposes that the dipeptide repeat proteins exert broad toxic effects on RNA metabolism, protein homeostasis, and nucleocytoplasmic transport.

[0285] Another symptom or indication is the expression of RNA containing a repeat sequence from the C9orf72 gene. The C9orf72 gene produces transcripts from two transcription start sites. The upstream site initiates transcription with the alternative noncoding exon 1A, while the downstream site initiates transcription with the alternative exon 1B. Both exons 1A and 1B can be spliced ​​to exon 2, which contains the start of the protein coding sequence. The pathogenic hexanucleotide repeat sequence expansion is located between exons 1A and 1B. Therefore, transcription initiated from exon 1A can produce RNA containing the repeat sequence, while transcription initiated from exon 1B cannot.

[0286] In some methods, the CRISPR / Cas system for targeting the C9orf72 gene disclosed herein can be administered at a therapeutic dose to a subject suffering from a disease associated with a C9orf72 hexanucleotide repeat expansion. Such methods may include administering a therapeutically effective amount of the CRISPR / Cas system to the subject. The CRISPR / Cas system for targeting the C9orf72 gene disclosed herein can also be used to prepare a pharmaceutical composition or medicament for treating a patient suffering from a disease associated with a C9orf72 hexanucleotide repeat expansion. Therapeutic or pharmaceutical compositions comprising the CRISPR / Cas system for targeting the C9orf72 gene disclosed herein can be administered with suitable carriers, excipients, and other agents incorporated into the formulation to provide improved transfer, delivery, tolerance, and the like. A variety of suitable formulations can be found in formulas known to all pharmaceutical chemists: Remington's Pharmaceutical Sciences, Mack Publishing Company, Easton, PA. See also Powell et al., "Compendium of excipients for parenteral formulations," PDA (1998) J. Pharm. Sci. Technol. 52: 238-311.

[0287] Likewise, the methods disclosed herein for inhibiting transcription of the C9orf72 exon 1A transcription start site and / or inhibiting transcription of sense and / or antisense transcripts comprising a hexanucleotide repeat expansion sequence in the C9orf72 gene can be used to treat C9orf72 hexanucleotide repeat expansion-related diseases. Such treatment methods may include administering to a subject in need thereof a therapeutically effective amount of a pharmaceutical composition comprising a CRISPR / Cas system for targeting the C9orf72 gene disclosed herein. The C9orf72 hexanucleotide repeat expansion-related disease treated may be any disease or condition associated with C9orf72 hexanucleotide repeat expansion. Some such methods prevent, treat, or ameliorate at least one symptom of a C9orf72 hexanucleotide repeat expansion-related disease (as described above), the method comprising administering to a subject in need thereof a therapeutically effective amount of a CRISPR / Cas system for targeting the C9orf72 gene disclosed herein. In some methods, the CRISPR / Cas system for targeting the C9orf72 gene disclosed herein can be administered prophylactically or therapeutically to a subject having or at risk of a disease associated with a C9orf72 hexanucleotide repeat expansion. The CRISPR / Cas system for targeting C9orf72 disclosed herein can be administered by intracerebroventricular injection, intracranial injection, intrathecal injection, or by any other suitable means.

[0288] A therapeutically effective amount is an amount that produces the desired effect for which it is administered. The exact amount will depend on the purpose of the treatment and will be determined by one skilled in the art using known techniques. See, for example, Lloyd (1999) The Art, Science and Technology of Pharmaceutical Compounding.

[0289] The subject may be an animal, optionally a mammal, optionally a human, in need of improvement, prevention and / or treatment of a disease associated with C9orf72 hexanucleotide repeat expansion. The term includes human subjects who suffer from such a disease or are at risk of suffering from such a disease.

[0290] The terms "treat / treating / treatment" refer to reducing or ameliorating the severity of at least one symptom or indication of a C9orf72 hexanucleotide repeat expansion-related disease as a result of administering a therapeutic agent (such as a CRISPR / Cas system for targeting the C9orf72 gene disclosed herein) to a subject in need thereof. The term includes inhibiting the progression of the disease or worsening of the symptom / indication. The term also includes a positive prognosis for the disease (i.e., the subject may be free of the disease or may have reduced disease after administration of a therapeutic agent (such as a CRISPR / Cas system for targeting the C9orf72 gene disclosed herein). The therapeutic agent may be administered to the subject at a therapeutic dose. The terms "prevent / preventing / prevention" refer to inhibiting the manifestation of a C9orf72 hexanucleotide repeat expansion-related disease or any symptom or indication of such a disease after administration of a CRISPR / Cas system for targeting the C9orf72 gene disclosed herein.

[0291] In some methods, a single dose of the CRISPR / Cas system disclosed herein for targeting the C9orf72 gene may be administered to a subject in need thereof. In other methods, multiple doses of the CRISPR / Cas system disclosed herein for targeting the C9orf72 gene may be administered to a subject over a defined time course. Such methods may include sequentially administering multiple doses of the CRISPR / Cas system disclosed herein for targeting the C9orf72 gene to a subject. Sequential administration means that each dose of the CRISPR / Cas system is administered to a subject at different time points, such as different days separated by a predetermined interval (e.g., hours, days, weeks, or months). Some methods include sequentially administering to a patient a single initial dose of the CRISPR / Cas system disclosed herein for targeting the C9orf72 gene, followed by one or more second doses of the CRISPR / Cas system, and optionally followed by one or more third doses.

[0292] The initial dose, the second dose, and the third dose refer to the temporal order of administering the CRISPR / Cas system for targeting the C9orf72 gene disclosed herein. Thus, the initial dose is the dose administered at the beginning of the treatment regimen (also referred to as the baseline dose), the second dose is the dose administered after the initial dose, and the third dose is the dose administered after the second dose. The initial dose, the second dose, and the third dose may all contain the same amount of the CRISPR / Cas system, but may generally differ from each other in terms of the frequency of administration. However, in some methods, the amount of the CRISPR / Cas system contained in the initial dose, the second dose, and / or the third dose differs from each other during the course of treatment (e.g., appropriately upregulated or downregulated). In some methods, two or more (e.g., 2, 3, 4, or 5) doses are administered as loading doses at the beginning of the treatment regimen, followed by subsequent doses (e.g., maintenance doses) administered at a lower frequency.

[0293] Such methods may include administering to the patient any number of second doses and / or third doses of a CRISPR / Cas system for targeting the C9orf72 gene disclosed herein. In one example, only a single second dose is administered to the subject. In another example, two or more (e.g., 2, 3, 4, 5, 6, 7, 8, or more) second doses are administered to the subject. Similarly, in another example, only a single third dose is administered to the subject. In other examples, two or more (e.g., 2, 3, 4, 5, 6, 7, 8, or more) third doses are administered to the subject.

[0294] The frequency of the second dose and / or the third dose administered to the subject may vary over the course of the treatment regimen. The frequency of administration may also be adjusted during the course of treatment by the physician based on the needs of the individual subject after clinical examination.

[0295] In some methods, the resulting expression percentage of the C9orf72 exon 1A transcription start site in treated cells can be less than about 90%, less than about 85%, less than about 80%, less than about 75%, less than about 70%, less than about 65%, less than about 60%, less than about 55%, less than about 50%, less than about 45%, less than about 40%, less than about 35%, less than about 30%, or less than about 25% compared to control untreated cells or before administration (in vitro, ex vivo, or in vivo). The resulting expression percentage can be, for example, 1 week after administration, 2 weeks after administration, 3 weeks after administration, or 4 weeks after administration, or any other suitable time.

[0296] In some methods, the percentage reduction in expression of the C9orf72 exon 1A transcription start site in treated cells compared to control untreated cells or before administration (in vitro, ex vivo or in vivo) can be at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, or at least about 75%. The percentage reduction can be, for example, 1 week after administration, 2 weeks after administration, 3 weeks after administration, or 4 weeks after administration, or any other suitable time.

[0297] In some methods, the resulting expression percentage of transcripts containing the C9orf72 hexanucleotide repeat sequence in treated cells (e.g., neurons, such as motor neurons) can be less than about 90%, less than about 85%, less than about 80%, less than about 75%, less than about 70%, less than about 65%, less than about 60%, less than about 55%, less than about 50%, less than about 45%, less than about 40%, less than about 35%, less than about 30%, or less than about 25%, compared to control untreated cells or before administration (in vitro, ex vivo, or in vivo). The resulting expression percentage can be, for example, 1 week after administration, 2 weeks after administration, 3 weeks after administration, or 4 weeks after administration, or any other suitable time.

[0298] In some methods, the percentage reduction in expression of transcripts containing the C9orf72 hexanucleotide repeat sequence in treated cells (e.g., neurons, such as motor neurons) can be at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, or at least about 75% compared to control untreated cells or before administration (in vitro, ex vivo, or in vivo). The percentage reduction can be, for example, 1 week after administration, 2 weeks after administration, 3 weeks after administration, or 4 weeks after administration, or any other suitable time.

[0299] In some methods, the resulting expression percentage of transcripts containing the sense C9orf72 hexanucleotide repeat sequence in treated cells (e.g., neurons, such as motor neurons) can be less than about 90%, less than about 85%, less than about 80%, less than about 75%, less than about 70%, less than about 65%, less than about 60%, less than about 55%, less than about 50%, less than about 45%, less than about 40%, less than about 35%, less than about 30%, or less than about 25%, compared to control untreated cells or before administration (in vitro, ex vivo, or in vivo). The resulting expression percentage can be, for example, 1 week after administration, 2 weeks after administration, 3 weeks after administration, or 4 weeks after administration, or any other suitable time.

[0300] In some methods, the percentage reduction in expression of transcripts containing the sense C9orf72 hexanucleotide repeat sequence in treated cells (e.g., neurons, such as motor neurons) can be at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, or at least about 75% compared to control untreated cells or before administration (in vitro, ex vivo, or in vivo). The percentage reduction can be, for example, 1 week after administration, 2 weeks after administration, 3 weeks after administration, or 4 weeks after administration, or any other suitable time.

[0301] In some methods, the resulting expression percentage of transcripts containing the antisense C9orf72 hexanucleotide repeat sequence in treated cells (e.g., neurons, such as motor neurons) can be less than about 90%, less than about 85%, less than about 80%, less than about 75%, less than about 70%, less than about 65%, less than about 60%, less than about 55%, less than about 50%, less than about 45%, less than about 40%, less than about 35%, less than about 30%, or less than about 25%, compared to control untreated cells or before administration (in vitro, ex vivo, or in vivo). The resulting expression percentage can be, for example, 1 week after administration, 2 weeks after administration, 3 weeks after administration, or 4 weeks after administration, or any other suitable time.

[0302] In some methods, the percentage reduction in expression of transcripts containing the antisense C9orf72 hexanucleotide repeat sequence in treated cells (e.g., neurons, such as motor neurons) can be at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, or at least about 75% compared to control untreated cells or before administration (in vitro, ex vivo, or in vivo). The percentage reduction can be, for example, 1 week after administration, 2 weeks after administration, 3 weeks after administration, or 4 weeks after administration, or any other suitable time.

[0303] In some methods, the resulting expression percentage of transcripts containing both sense and antisense C9orf72 hexanucleotide repeat sequences in treated cells (e.g., neurons, such as motor neurons) can be less than about 90%, less than about 85%, less than about 80%, less than about 75%, less than about 70%, less than about 65%, less than about 60%, less than about 55%, less than about 50%, less than about 45%, less than about 40%, less than about 35%, less than about 30%, or less than about 25% compared to control untreated cells or before administration (in vitro, ex vivo, or in vivo). The resulting expression percentage can be, for example, at 1 week after administration, 2 weeks after administration, 3 weeks after administration, or 4 weeks after administration,...

Claims

1. A method for inhibiting transcription of a C9orf72 exon 1A transcription start site or inhibiting transcription of a sense or antisense transcript comprising a hexanucleotide repeat expansion sequence in a C9orf72 gene in a cell, the method comprising: (a) contacting the C9orf72 gene with a first CRISPR / Cas complex, wherein the first CRISPR / Cas complex comprises a nuclease-inactive Cas protein and a first guide RNA, The first guide RNA comprises a first DNA targeting segment that targets a first guide RNA target sequence upstream or near the C9orf72 exon 1A transcription start site, wherein the first CRISPR / Cas complex binds to the first guide RNA target sequence; and / or (b) contacting the C9orf72 gene with a second CRISPR / Cas complex comprising the nuclease-inactive Cas protein and a second guide RNA, the second guide RNA comprising a second DNA targeting segment that targets a second guide RNA target sequence within a C9orf72 hexanucleotide repeat expansion sequence between a first noncoding endogenous exon and exon 2 of the C9orf72 gene, wherein the second CRISPR / Cas complex binds to the second guide RNA target sequence.

2. The method of claim 1, wherein the method comprises option (a).

3. The method of claim 1, wherein the method includes option (b).

4. The method of claim 1, wherein the method comprises option (a) and option (b).

5. The method of any preceding claim, wherein option (a) comprises contacting the C9orf72 gene with at least two CRISPR / Cas complexes, wherein each CRISPR / Cas complex comprises the nuclease-inactive Cas protein and a different guide RNA, wherein each different guide RNA targets a different guide RNA target sequence upstream or near the C9orf72 exon 1A transcription start site, and / or Option (b) comprises contacting the C9orf72 gene with at least two CRISPR / Cas complexes, wherein each CRISPR / Cas complex comprises the nuclease-inactive Cas protein and a different guide RNA, wherein each different guide RNA targets a different guide RNA target sequence within the C9orf72 hexanucleotide repeat expansion sequence between the first non-coding endogenous exon and exon 2 of the C9orf72 gene.

6. The method of any preceding claim, wherein option (a) comprises contacting the C9orf72 gene with at least three CRISPR / Cas complexes, wherein each CRISPR / Cas complex comprises the nuclease-inactive Cas protein and a different guide RNA, wherein each different guide RNA targets a different guide RNA target sequence upstream or near the C9orf72 exon 1A transcription start site, and / or Option (b) comprises contacting the C9orf72 gene with at least three CRISPR / Cas complexes, wherein each CRISPR / Cas complex comprises the nuclease-inactive Cas protein and a different guide RNA, wherein each different guide RNA targets a different guide RNA target sequence within the C9orf72 hexanucleotide repeat expansion sequence between the first non-coding endogenous exon and exon 2 of the C9orf72 gene.

7. The method of any preceding claim, wherein the C9orf72 hexanucleotide repeat expansion sequence has more than 30, more than 100, more than 200, more than 300, more than 400 or more than 500 repeats of the hexanucleotide sequence G4C2.

8. The method of any preceding claim, wherein the first guide RNA target sequence is within 250 nucleotides, within 225 nucleotides, within 200 nucleotides, within 175 nucleotides, within 150 nucleotides, within 125 nucleotides, within 100 nucleotides, within 75 nucleotides, or within 50 nucleotides of the C9orf72 exon 1A transcription start site.

9. The method of any preceding claim, wherein the first guide RNA target sequence is within 100 nucleotides, within 75 nucleotides, or within 50 nucleotides of the C9orf72 exon 1A transcription start site.

10. The method of any preceding claim, wherein the nuclease-inactive Cas protein is not fused to a heterologous transcriptional repressor domain and the guide RNA is not linked to a heterologous transcriptional repressor domain.

11. The method of any preceding claim, wherein the binding reduces or eliminates expression of a transcript initiating at C9orf72 exon 1A.

12. The method of any preceding claim, wherein the binding reduces or eliminates expression of transcripts initiating at C9orf72 exon 1A but does not reduce or eliminate expression of transcripts initiating at C9orf72 exon 1B.

13. The method of any preceding claim, wherein the binding reduces or eliminates expression of a transcript comprising a C9orf72 hexanucleotide repeat sequence.

14. The method of any preceding claim, wherein the binding reduces or eliminates expression of transcripts containing the C9orf72 hexanucleotide repeat sequence, but does not reduce or eliminate expression of transcripts initiating at C9orf72 exon 1B.

15. The method of any preceding claim, wherein the binding reduces or eliminates expression of both sense and antisense transcripts containing the C9orf72 hexanucleotide repeat sequence.

16. The method of any preceding claim, wherein the binding reduces or eliminates expression of both sense and antisense transcripts containing the C9orf72 hexanucleotide repeat sequence, but does not reduce or eliminate expression of transcripts initiating at C9orf72 exon 1B.

17. A method according to any preceding claim, wherein the method comprises: (a) introducing the nuclease-inactive Cas protein or the nucleic acid encoding the nuclease-inactive Cas protein and the first guide RNA or one or more DNAs encoding the first guide RNA into the cell; and / or (b) introducing the nuclease-inactive Cas protein or the nucleic acid encoding the nuclease-inactive Cas protein and the second guide RNA or one or more DNAs encoding the second guide RNA into the cell.

18. The method according to any preceding claim, wherein the first guide RNA is a single guide RNA (sgRNA).

19. The method according to any preceding claim, wherein the nuclease-inactive Cas protein is a nuclease-inactive Cas9 protein.

20. The method of claim 19, wherein the nuclease-inactive Cas9 protein is derived from a Streptococcus pyogenes Cas9 protein, a Staphylococcus aureus Cas9 protein, a Campylobacter jejuni Cas9 protein, a Streptococcus thermophilus Cas9 protein, or a Neisseria meningitidis Cas9 protein.

21. The method of claim 19, wherein the nuclease-inactive Cas protein is derived from the Streptococcus pyogenes Cas9 protein.

22. A method according to any preceding claim, wherein the nucleic acid encoding the nuclease-inactive Cas protein is codon-optimized for expression in mammalian cells or human cells.

23. A method according to any preceding claim, wherein the method comprises: (a) introducing the first guide RNA in RNA form, optionally wherein the first guide RNA comprises at least one modification; and / or (b) introducing said second guide RNA in the form of RNA, optionally wherein said second guide RNA comprises at least one modification.

24. The method of claim 23, wherein the at least one modification comprises 2'-O-methyl modified nucleotides and / or phosphorothioate bonds between nucleotides.

25. A method according to any preceding claim, wherein the method comprises introducing the nucleic acid encoding the nuclease-inactive Cas protein, wherein the nucleic acid comprises an mRNA encoding the nuclease-inactive Cas protein, optionally wherein the mRNA encoding the nuclease-inactive Cas protein comprises at least one modification.

26. The method according to any one of claims 1 to 22, wherein the method comprises: (a) introducing the nucleic acid encoding the nuclease-inactive Cas protein and the one or more DNAs encoding the first guide RNA, wherein the nucleic acid encoding the nuclease-inactive Cas protein comprises DNA; and / or (b) introducing the nucleic acid encoding the nuclease-inactive Cas protein and the one or more DNAs encoding the second guide RNA, wherein the nucleic acid encoding the nuclease-inactive Cas protein comprises DNA.

27. The method of claim 26, wherein: (a) the DNA encoding the nuclease-inactive Cas protein and the one or more DNAs encoding the first guide RNA are in one or more vectors; and / or (b) the DNA encoding the nuclease-inactive Cas protein and the one or more DNAs encoding the second guide RNA are in one or more vectors.

28. The method of claim 27, wherein the one or more vectors are one or more viral vectors.

29. The method of claim 28, wherein the one or more viral vectors are one or more adeno-associated viral (AAV) vectors.

30. A method according to any preceding claim, wherein: (a) the nuclease-inactive Cas protein or the nucleic acid encoding the nuclease-inactive Cas protein and the first guide RNA or the one or more DNAs encoding the first guide RNA are associated with a lipid nanoparticle; and / or (b) the nuclease-inactive Cas protein or the nucleic acid encoding the nuclease-inactive Cas protein and the second guide RNA or the one or more DNAs encoding the second guide RNA are associated with lipid nanoparticles.

31. A method according to any preceding claim, wherein: (I) the first DNA targeting segment comprises at least 17, at least 18, at least 19 or at least 20 consecutive nucleotides of the sequence shown in any one of SEQ ID NOs: 72-111 and 113; and / or (II) the first DNA targeting segment is at least 90% or at least 95% identical to the sequence shown in any one of SEQ ID NOs: 72-111 and 113; and / or (III) The first guide RNA target sequence comprises at least 17, at least 18, at least 19 or at least 20 consecutive nucleotides of the sequence shown in any one of SEQ ID NOs: 32-71 and 112.

32. A method according to any preceding claim, wherein: (I) the first DNA targeting segment comprises at least 17, at least 18, at least 19 or at least 20 consecutive nucleotides of the sequence shown in any one of SEQ ID NOs: 93-95; and / or (II) the first DNA targeting segment is at least 90% or at least 95% identical to the sequence shown in any one of SEQ ID NOs: 93-95; and / or (III) The first guide RNA target sequence comprises at least 17, at least 18, at least 19 or at least 20 consecutive nucleotides of the sequence shown in any one of SEQ ID NOs: 53-55.

33. The method according to any one of claims 1 to 31, wherein: (I) the first DNA targeting segment comprises at least 17, at least 18, at least 19 or at least 20 consecutive nucleotides of the sequence shown in SEQ ID NO:74; and / or (II) the first DNA targeting segment is at least 90% or at least 95% identical to the sequence shown in SEQ ID NO:74; and / or (III) The first guide RNA target sequence comprises at least 17, at least 18, at least 19 or at least 20 consecutive nucleotides of the sequence shown in SEQ ID NO:

34.

34. A method according to any preceding claim, wherein: (I) the second DNA targeting segment comprises at least 17, at least 18, at least 19 or at least 20 consecutive nucleotides of the sequence shown in any one of SEQ ID NOs: 118-121; and / or (II) the second DNA targeting segment is at least 90% or at least 95% identical to the sequence shown in any one of SEQ ID NOs: 118-121; and / or (III) The second guide RNA target sequence comprises at least 17, at least 18, at least 19 or at least 20 consecutive nucleotides of the sequence shown in any one of SEQ ID NOs: 114-117.

35. A method according to any preceding claim, wherein the cell is a neuron, optionally wherein the neuron is a motor neuron.

36. A method according to any preceding claim, wherein the cell is in vitro or ex vivo.

37. The method of any one of claims 1 to 35, wherein the cell is in a subject, optionally wherein the subject is a human.

38. The method of claim 37, wherein the cell is a neuron in the subject's brain.

39. The method of claim 37 or 38, wherein the subject has or is at risk of developing a C9orf72 hexanucleotide repeat expansion-associated disease.

40. The method of claim 39, wherein the C9orf72 hexanucleotide repeat expansion-associated disease is amyotrophic lateral sclerosis (ALS) or frontotemporal dementia (FTD).

41. A method according to any one of claims 37 to 40, wherein: (a) administering the nuclease-inactive Cas protein or a nucleic acid encoding the nuclease-inactive Cas protein and the first guide RNA or one or more DNAs encoding the first guide RNA to the subject by intraventricular injection, intracranial injection or intrathecal injection; and / or (b) administering the nuclease-inactive Cas protein or a nucleic acid encoding the nuclease-inactive Cas protein and the second guide RNA or one or more DNAs encoding the second guide RNA to the subject by intracerebroventricular injection, intracranial injection or intrathecal injection.

42. The method of any preceding claim, wherein the cell is a mammalian cell and the C9orf72 gene is a mammalian C9orf72 gene.

43. A method according to any preceding claim, wherein the cell is a human cell.

44. The method of any one of claims 1 to 42, wherein the cell is a mouse cell.

45. The method of any preceding claim, wherein the C9orf72 gene comprises a human C9orf72 promoter.

46. ​​The method of any preceding claim, wherein the C9orf72 gene is a human C9orf72 gene or a humanized C9orf72 gene.

47. A method of inhibiting transcription of a C9orf72 exon 1A transcription start site or inhibiting transcription of a sense or antisense transcript comprising a hexanucleotide repeat expansion sequence in a C9orf72 gene in a subject, the method comprising: (a) administering to the subject a nuclease-inactive Cas protein or a nucleic acid encoding the nuclease-inactive Cas protein and a first guide RNA or one or more DNAs encoding the first guide RNA, wherein the first guide RNA comprises a first DNA targeting segment that targets a first guide RNA target sequence upstream or near the C9orf72 exon 1A transcription start site, wherein the first guide RNA and the nuclease-inactive Cas protein form a first CRISPR / Cas complex that binds to the first guide RNA target sequence; and / or (b) administering to the subject the nuclease-inactive Cas protein or the nucleic acid encoding the nuclease-inactive Cas protein and a second guide RNA or one or more DNAs encoding the second guide RNA, wherein the second guide RNA comprises a second DNA targeting segment that targets a second guide RNA target sequence within a C9orf72 hexanucleotide repeat expansion sequence between a first non-coding endogenous exon and exon 2 of the C9orf72 gene, wherein the second guide RNA and the nuclease-inactive Cas protein form a second CRISPR / Cas complex that binds to the second guide RNA target sequence.

48. A method for preventing, treating or ameliorating at least one symptom or indication of a disease associated with a C9orf72 hexanucleotide repeat expansion, the method comprising: (a) administering to a subject in need thereof a first pharmaceutical composition comprising a therapeutically effective amount of a nuclease-inactive Cas protein or a nucleic acid encoding the nuclease-inactive Cas protein and a first guide RNA or one or more DNAs encoding the first guide RNA, wherein the first guide RNA comprises a first DNA targeting segment targeting a first guide RNA target sequence upstream or near the transcription start site of C9orf72 exon 1A, wherein the first guide RNA and the nuclease-inactive Cas protein form a first CRISPR / Cas complex that binds to the first guide RNA target sequence; and / or (b) administering to the subject in need thereof a second pharmaceutical composition comprising a therapeutically effective amount of the nuclease-inactive Cas protein or the nucleic acid encoding the nuclease-inactive Cas protein and a second guide RNA or one or more DNAs encoding the second guide RNA, wherein the second guide RNA comprises a second DNA targeting segment that targets a second guide RNA target sequence within a C9orf72 hexanucleotide repeat expansion sequence between a first non-coding endogenous exon and exon 2 of the C9orf72 gene, wherein the second guide RNA and the nuclease-inactive Cas protein form a second CRISPR / Cas complex that binds to the second guide RNA target sequence.

49. The method of claim 48, wherein the C9orf72 hexanucleotide repeat expansion-associated disease is amyotrophic lateral sclerosis (ALS) or frontotemporal dementia (FTD).

50. A method according to any one of claims 47 to 49, wherein the method comprises option (a).

51. A method according to any one of claims 47 to 49, wherein the method comprises option (b).

52. A method according to any one of claims 47 to 49, wherein the method comprises option (a) and option (b).

53. The method of any one of claims 47 to 52, wherein option (a) comprises administering to the subject at least two guide RNAs, wherein each guide RNA targets a different guide RNA target sequence upstream or near the C9orf72 exon 1A transcription start site, and / or Wherein option (b) comprises administering to the subject at least two guide RNAs, wherein each guide RNA targets a different guide RNA target sequence within the C9orf72 hexanucleotide repeat expansion sequence between the first non-coding endogenous exon and exon 2 of the C9orf72 gene.

54. The method of any one of claims 47 to 53, wherein option (a) comprises administering to the subject at least three guide RNAs, wherein each guide RNA targets a different guide RNA target sequence upstream or near the C9orf72 exon 1A transcription start site, and / or Wherein option (b) comprises administering at least three guide RNAs to the subject, wherein each guide RNA targets a different guide RNA target sequence within the C9orf72 hexanucleotide repeat expansion sequence between the first non-coding endogenous exon and exon 2 of the C9orf72 gene.

55. The method of any one of claims 47 to 54, wherein the C9orf72 hexanucleotide repeat expansion sequence has greater than 30, greater than 100, greater than 200, greater than 300, greater than 400 or greater than 500 repeats of the hexanucleotide sequence G4C2.

56. The method of any one of claims 47 to 55, wherein the administration is intracerebroventricular, intracranial or intrathecal injection.

57. The method of any one of claims 47 to 56, wherein the first guide RNA target sequence is within 250 nucleotides, within 225 nucleotides, within 200 nucleotides, within 175 nucleotides, within 150 nucleotides, within 125 nucleotides, within 100 nucleotides, within 75 nucleotides, or within 50 nucleotides of the C9orf72 exon 1A transcription start site.

58. The method of any one of claims 47 to 57, wherein the first guide RNA target sequence is within 100 nucleotides, within 75 nucleotides, or within 50 nucleotides of the C9orf72 exon 1A transcription start site.

59. The method of any one of claims 47 to 58, wherein the nuclease-inactive Cas protein is not fused to a heterologous transcriptional repressor domain and the guide RNA is not linked to a heterologous transcriptional repressor domain.

60. The method of any one of claims 47 to 59, wherein the binding reduces or eliminates expression of a transcript that initiates at C9orf72 exon 1A.

61. The method of any one of claims 47 to 60, wherein the binding reduces or eliminates expression of transcripts that initiate at C9orf72 exon 1A but does not reduce or eliminate expression of transcripts that initiate at C9orf72 exon 1B.

62. The method of any one of claims 47 to 61, wherein the binding reduces or eliminates expression of a transcript comprising a C9orf72 hexanucleotide repeat sequence.

63. The method of any one of claims 47 to 62, wherein the binding reduces or eliminates expression of transcripts containing the C9orf72 hexanucleotide repeat sequence, but does not reduce or eliminate expression of transcripts that initiate at C9orf72 exon 1B.

64. The method of any one of claims 47 to 63, wherein the binding reduces or eliminates expression of both sense and antisense transcripts containing the C9orf72 hexanucleotide repeat sequence.

65. The method of any one of claims 47 to 64, wherein the binding reduces or eliminates expression of both sense and antisense transcripts containing the C9orf72 hexanucleotide repeat sequence, but does not reduce or eliminate expression of transcripts that initiate at C9orf72 exon 1B.

66. The method of any one of claims 47 to 65, wherein the first guide RNA is a single guide RNA (sgRNA).

67. The method of any one of claims 47 to 66, wherein the nuclease-inactive Cas protein is a nuclease-inactive Cas9 protein.

68. The method of claim 67, wherein the nuclease-inactive Cas9 protein is derived from a Streptococcus pyogenes Cas9 protein, a Staphylococcus aureus Cas9 protein, a Campylobacter jejuni Cas9 protein, a Streptococcus thermophilus Cas9 protein, or a Neisseria meningitidis Cas9 protein.

69. The method of claim 67, wherein the nuclease-inactive Cas protein is derived from a Streptococcus pyogenes Cas9 protein.

70. The method of any one of claims 47 to 69, wherein the nucleic acid encoding the nuclease-inactive Cas protein is codon-optimized for expression in mammalian cells or human cells.

71. The method of any one of claims 47 to 70, wherein the method comprises: (a) administering the first guide RNA in RNA form, optionally wherein the first guide RNA comprises at least one modification; and / or (b) administering the second guide RNA in the form of RNA, optionally wherein the second guide RNA comprises at least one modification.

72. The method of claim 71, wherein the at least one modification comprises 2'-O-methyl modified nucleotides and / or phosphorothioate bonds between nucleotides.

73. The method of any one of claims 47 to 72, wherein the method comprises administering the nucleic acid encoding the nuclease-inactive Cas protein, wherein the nucleic acid comprises an mRNA encoding the nuclease-inactive Cas protein, optionally wherein the mRNA encoding the nuclease-inactive Cas protein comprises at least one modification.

74. The method of any one of claims 47 to 70, wherein the method comprises: (a) administering the nucleic acid encoding the nuclease-inactive Cas protein and the one or more DNAs encoding the first guide RNA, wherein the nucleic acid encoding the nuclease-inactive Cas protein comprises DNA; and / or (b) administering the nucleic acid encoding the nuclease-inactive Cas protein and the one or more DNAs encoding the second guide RNA, wherein the nucleic acid encoding the nuclease-inactive Cas protein comprises DNA.

75. The method of claim 74, wherein: (a) the DNA encoding the nuclease-inactive Cas protein and the one or more DNAs encoding the first guide RNA are in one or more vectors; and / or (b) the DNA encoding the nuclease-inactive Cas protein and the one or more DNAs encoding the second guide RNA are in one or more vectors.

76. The method of claim 75, wherein the one or more vectors are one or more viral vectors.

77. The method of claim 76, wherein the one or more viral vectors are one or more adeno-associated viral (AAV) vectors.

78. The method of any one of claims 47 to 77, wherein: (a) the nuclease-inactive Cas protein or the nucleic acid encoding the nuclease-inactive Cas protein and the first guide RNA or the one or more DNAs encoding the first guide RNA are associated with a lipid nanoparticle; and / or (b) the nuclease-inactive Cas protein or the nucleic acid encoding the nuclease-inactive Cas protein and the second guide RNA or the one or more DNAs encoding the second guide RNA are associated with lipid nanoparticles.

79. The method of any one of claims 47 to 78, wherein: (I) the first DNA targeting segment comprises at least 17, at least 18, at least 19 or at least 20 consecutive nucleotides of the sequence shown in any one of SEQ ID NOs: 72-111 and 113; and / or (II) the first DNA targeting segment is at least 90% or at least 95% identical to the sequence shown in any one of SEQ ID NOs: 72-111 and 113; and / or (III) The first guide RNA target sequence comprises at least 17, at least 18, at least 19 or at least 20 consecutive nucleotides of the sequence shown in any one of SEQ ID NOs: 32-71 and 112.

80. The method of any one of claims 47 to 79, wherein: (I) the first DNA targeting segment comprises at least 17, at least 18, at least 19 or at least 20 consecutive nucleotides of the sequence shown in any one of SEQ ID NOs: 93-95; and / or (II) the first DNA targeting segment is at least 90% or at least 95% identical to the sequence shown in any one of SEQ ID NOs: 93-95; and / or (III) The first guide RNA target sequence comprises at least 17, at least 18, at least 19 or at least 20 consecutive nucleotides of the sequence shown in any one of SEQ ID NOs: 53-55.

81. The method of any one of claims 47 to 79, wherein: (I) the first DNA targeting segment comprises at least 17, at least 18, at least 19 or at least 20 consecutive nucleotides of the sequence shown in SEQ ID NO:74; and / or (II) the first DNA targeting segment is at least 90% or at least 95% identical to the sequence shown in SEQ ID NO:74; and / or (III) The first guide RNA target sequence comprises at least 17, at least 18, at least 19 or at least 20 consecutive nucleotides of the sequence shown in SEQ ID NO:

34.

82. The method of any one of claims 47 to 81, wherein: (I) the second DNA targeting segment comprises at least 17, at least 18, at least 19 or at least 20 consecutive nucleotides of the sequence shown in any one of SEQ ID NOs: 118-121; and / or (II) the second DNA targeting segment is at least 90% or at least 95% identical to the sequence shown in any one of SEQ ID NOs: 118-121; and / or (III) The second guide RNA target sequence comprises at least 17, at least 18, at least 19 or at least 20 consecutive nucleotides of the sequence shown in any one of SEQ ID NOs: 114-117.

83. The method of any one of claims 47 to 82, wherein the binding is in a neuron of the subject, optionally wherein the neuron is a motor neuron.

84. The method of claim 83, wherein the neuron is located in the brain of the subject.

85. The method of any one of claims 47 to 84, wherein the subject is a mammalian subject and the C9orf72 gene is a mammalian C9orf72 gene.

86. The method of any one of claims 47 to 85, wherein the subject is a human subject.

87. The method of any one of claims 47 to 85, wherein the subject is a mouse subject.

88. The method of any one of claims 47 to 87, wherein the C9orf72 gene comprises a human C9orf72 promoter.

89. The method of any one of claims 47 to 88, wherein the C9orf72 gene is a human C9orf72 gene or a humanized C9orf72 gene.

90. A CRISPR / Cas system, comprising: (a) a nuclease-inactive Cas protein or a nucleic acid encoding the nuclease-inactive Cas protein and a first guide RNA or one or more DNAs encoding the first guide RNA, wherein the first guide RNA comprises a first DNA targeting segment targeting a first guide RNA target sequence upstream or near the transcription start site of C9orf72 exon 1A, wherein the first guide RNA and the nuclease-inactive Cas protein form a first CRISPR / Cas complex that binds to the first guide RNA target sequence; and / or (b) the nuclease-inactive Cas protein or the nucleic acid encoding the nuclease-inactive Cas protein and a second guide RNA or one or more DNAs encoding the second guide RNA, wherein the second guide RNA comprises a second DNA targeting segment that targets a second guide RNA target sequence within a C9orf72 hexanucleotide repeat expansion sequence between a first non-coding endogenous exon and exon 2 of a C9orf72 gene, wherein the second guide RNA and the nuclease-inactive Cas protein form a second CRISPR / Cas complex that binds to the second guide RNA target sequence.

91. The CRISPR / Cas system of claim 90, wherein the CRISPR / Cas system comprises option (a).

92. The CRISPR / Cas system of claim 90, wherein the CRISPR / Cas system comprises option (b).

93. The CRISPR / Cas system of claim 90, wherein the CRISPR / Cas system comprises option (a) and option (b).

94. The CRISPR / Cas system of any one of claims 90 to 93, wherein option (a) comprises at least two guide RNAs, wherein each guide RNA targets a different guide RNA target sequence upstream or near the C9orf72 exon 1A transcription start site, and / or Option (b) comprises at least two guide RNAs, wherein each guide RNA targets a different guide RNA target sequence within the C9orf72 hexanucleotide repeat expansion sequence between the first non-coding endogenous exon and exon 2 of the C9orf72 gene.

95. The CRISPR / Cas system of any one of claims 90 to 94, wherein option (a) comprises at least three guide RNAs, wherein each guide RNA targets a different guide RNA target sequence upstream or near the C9orf72 exon 1A transcription start site, and / or Option (b) comprises at least three guide RNAs, wherein each guide RNA targets a different guide RNA target sequence within the C9orf72 hexanucleotide repeat expansion sequence between the first non-coding endogenous exon and exon 2 of the C9orf72 gene.

96. The CRISPR / Cas system of any one of claims 90 to 95, wherein the first guide RNA target sequence is within 250 nucleotides, within 225 nucleotides, within 200 nucleotides, within 175 nucleotides, within 150 nucleotides, within 125 nucleotides, within 100 nucleotides, within 75 nucleotides, or within 50 nucleotides of the C9orf72 exon 1A transcription start site.

97. The CRISPR / Cas system of any one of claims 90 to 96, wherein the first guide RNA target sequence is within 100 nucleotides, within 75 nucleotides, or within 50 nucleotides of the C9orf72 exon 1A transcription start site.

98. The CRISPR / Cas system of any one of claims 90 to 97, wherein the nuclease-inactive Cas protein is not fused to a heterologous transcriptional repressor domain, and the guide RNA is not linked to a heterologous transcriptional repressor domain.

99. The CRISPR / Cas system of any one of claims 90 to 98, wherein the binding reduces or eliminates expression of a transcript that initiates at C9orf72 exon 1A.

100. The CRISPR / Cas system of any one of claims 90 to 99, wherein the binding reduces or eliminates expression of transcripts that initiate at C9orf72 exon 1A, but does not reduce or eliminate expression of transcripts that initiate at C9orf72 exon 1B.

101. The CRISPR / Cas system of any one of claims 90 to 100, wherein the binding reduces or eliminates expression of transcripts containing the C9orf72 hexanucleotide repeat sequence.

102. The CRISPR / Cas system of any one of claims 90 to 101, wherein the binding reduces or eliminates expression of transcripts containing the C9orf72 hexanucleotide repeat sequence, but does not reduce or eliminate expression of transcripts starting at C9orf72 exon 1B.

103. The CRISPR / Cas system of any one of claims 90 to 102, wherein the binding reduces or eliminates expression of both sense and antisense transcripts containing the C9orf72 hexanucleotide repeat sequence.

104. The CRISPR / Cas system of any one of claims 90 to 103, wherein the binding reduces or eliminates expression of both sense and antisense transcripts containing the C9orf72 hexanucleotide repeat sequence, but does not reduce or eliminate expression of transcripts starting at C9orf72 exon 1B.

105. The CRISPR / Cas system of any one of claims 90 to 104, wherein the first guide RNA is a single guide RNA (sgRNA).

106. The CRISPR / Cas system of any one of claims 90 to 105, wherein the nuclease-inactive Cas protein is a nuclease-inactive Cas9 protein.

107. The CRISPR / Cas system of claim 106, wherein the nuclease-inactive Cas9 protein is derived from a Streptococcus pyogenes Cas9 protein, a Staphylococcus aureus Cas9 protein, a Campylobacter jejuni Cas9 protein, a Streptococcus thermophilus Cas9 protein, or a Neisseria meningitidis Cas9 protein.

108. The CRISPR / Cas system of claim 106, wherein the nuclease-inactive Cas protein is derived from a Streptococcus pyogenes Cas9 protein.

109. The CRISPR / Cas system of any one of claims 90 to 108, wherein the nucleic acid encoding the nuclease-inactive Cas protein is codon-optimized for expression in mammalian or human cells.

110. The CRISPR / Cas system of any one of claims 90 to 109, wherein the CRISPR / Cas system comprises: (a) the first guide RNA in RNA form, optionally wherein the first guide RNA comprises at least one modification; and / or (b) said second guide RNA in the form of RNA, optionally wherein said second guide RNA comprises at least one modification.

111. The CRISPR / Cas system of claim 110, wherein the at least one modification comprises 2'-O-methyl modified nucleotides and / or phosphorothioate bonds between nucleotides.

112. The CRISPR / Cas system of any one of claims 90 to 111, wherein the CRISPR / Cas system comprises the nucleic acid encoding the nuclease-inactive Cas protein, wherein the nucleic acid comprises an mRNA encoding the nuclease-inactive Cas protein, optionally wherein the mRNA encoding the nuclease-inactive Cas protein comprises at least one modification.

113. The CRISPR / Cas system of any one of claims 90 to 109, wherein the CRISPR / Cas system comprises: (a) the nucleic acid encoding the nuclease-inactive Cas protein and the one or more DNAs encoding the first guide RNA, wherein the nucleic acid encoding the nuclease-inactive Cas protein comprises DNA; and / or (b) the nucleic acid encoding the nuclease-inactive Cas protein and the one or more DNAs encoding the second guide RNA, wherein the nucleic acid encoding the nuclease-inactive Cas protein comprises DNA.

114. The CRISPR / Cas system of claim 113, wherein: (a) the DNA encoding the nuclease-inactive Cas protein and the one or more DNAs encoding the first guide RNA are in one or more vectors; and / or (b) the DNA encoding the nuclease-inactive Cas protein and the one or more DNAs encoding the second guide RNA are in one or more vectors.

115. The CRISPR / Cas system of claim 114, wherein the one or more vectors are one or more viral vectors.

116. The CRISPR / Cas system of claim 115, wherein the one or more viral vectors are one or more adeno-associated viral (AAV) vectors.

117. The CRISPR / Cas system of any one of claims 90 to 116, wherein: (a) the nuclease-inactive Cas protein or the nucleic acid encoding the nuclease-inactive Cas protein and the first guide RNA or the one or more DNAs encoding the first guide RNA are associated with a lipid nanoparticle; and / or (b) the nuclease-inactive Cas protein or the nucleic acid encoding the nuclease-inactive Cas protein and the second guide RNA or the one or more DNAs encoding the second guide RNA are associated with lipid nanoparticles.

118. The CRISPR / Cas system of any one of claims 90 to 117, wherein: (I) the first DNA targeting segment comprises at least 17, at least 18, at least 19 or at least 20 consecutive nucleotides of the sequence shown in any one of SEQ ID NOs: 72-111 and 113; and / or (II) the first DNA targeting segment is at least 90% or at least 95% identical to the sequence shown in any one of SEQ ID NOs: 72-111 and 113; and / or (III) The first guide RNA target sequence comprises at least 17, at least 18, at least 19 or at least 20 consecutive nucleotides of the sequence shown in any one of SEQ ID NOs: 32-71 and 112.

119. The CRISPR / Cas system of any one of claims 90 to 118, wherein: (I) the first DNA targeting segment comprises at least 17, at least 18, at least 19 or at least 20 consecutive nucleotides of the sequence shown in any one of SEQ ID NOs: 93-95; and / or (II) the first DNA targeting segment is at least 90% or at least 95% identical to the sequence shown in any one of SEQ ID NOs: 93-95; and / or (III) The first guide RNA target sequence comprises at least 17, at least 18, at least 19 or at least 20 consecutive nucleotides of the sequence shown in any one of SEQ ID NOs: 53-55.

120. The CRISPR / Cas system of any one of claims 90 to 118, wherein: (I) the first DNA targeting segment comprises at least 17, at least 18, at least 19 or at least 20 consecutive nucleotides of the sequence shown in SEQ ID NO:74; and / or (II) the first DNA targeting segment is at least 90% or at least 95% identical to the sequence shown in SEQ ID NO:74; and / or (III) The first guide RNA target sequence comprises at least 17, at least 18, at least 19 or at least 20 consecutive nucleotides of the sequence shown in SEQ ID NO:

34.

121. The CRISPR / Cas system of any one of claims 90 to 120, wherein: (I) the second DNA targeting segment comprises at least 17, at least 18, at least 19 or at least 20 consecutive nucleotides of the sequence shown in any one of SEQ ID NOs: 118-121; and / or (II) the second DNA targeting segment is at least 90% or at least 95% identical to the sequence shown in any one of SEQ ID NOs: 118-121; and / or (III) The second guide RNA target sequence comprises at least 17, at least 18, at least 19 or at least 20 consecutive nucleotides of the sequence shown in any one of SEQ ID NOs: 114-117.

122. The CRISPR / Cas system of any one of claims 90 to 121, wherein the C9orf72 gene is a mammalian C9orf72 gene.

123. The CRISPR / Cas system of any one of claims 90 to 122, wherein the C9orf72 gene comprises a human C9orf72 promoter.

124. The CRISPR / Cas system of any one of claims 90 to 123, wherein the C9orf72 gene is a human C9orf72 gene or a humanized C9orf72 gene.

125. A pharmaceutical composition comprising the CRISPR / Cas system according to any one of claims 90 to 124 and a pharmaceutically acceptable carrier.

126. A composition comprising a guide RNA or one or more DNAs encoding the guide RNA, wherein the guide RNA comprises a DNA targeting segment that targets a guide RNA target sequence in a C9orf72 gene, wherein the guide RNA target sequence is within a C9orf72 hexanucleotide repeat expansion sequence between a first non-coding endogenous exon and exon 2 of the C9orf72 gene, and wherein the guide RNA is capable of binding to a nuclease-inactive Cas protein and targeting the nuclease-inactive Cas protein to the guide RNA target sequence.

127. The composition of claim 126, wherein binding of the Cas protein to the guide RNA target sequence reduces or eliminates expression of a transcript that initiates at exon 1A of C9orf72.

128. The composition of claim 126 or 127, wherein binding of the Cas protein to the guide RNA target sequence reduces or eliminates expression of transcripts that initiate at C9orf72 exon 1A, but does not reduce or eliminate expression of transcripts that initiate at C9orf72 exon 1B.

129. The composition of any one of claims 126 to 128, wherein binding of the Cas protein to the guide RNA target sequence reduces or eliminates expression of transcripts containing the C9orf72 hexanucleotide repeat sequence.

130. The composition of any one of claims 126 to 129, wherein binding of the Cas protein to the guide RNA target sequence reduces or eliminates expression of transcripts containing the C9orf72 hexanucleotide repeat sequence, but does not reduce or eliminate expression of transcripts starting at C9orf72 exon 1B.

131. The composition of any one of claims 126 to 130, wherein binding of the Cas protein to the guide RNA target sequence reduces or eliminates expression of both sense and antisense transcripts containing the C9orf72 hexanucleotide repeat sequence.

132. The composition of any one of claims 126 to 131, wherein binding of the Cas protein to the guide RNA target sequence reduces or eliminates expression of both sense and antisense transcripts containing the C9orf72 hexanucleotide repeat sequence, but does not reduce or eliminate expression of transcripts that initiate at C9orf72 exon 1B.

133. The composition of any one of claims 126 to 132, wherein the guide RNA is a single guide RNA (sgRNA).

134. A composition according to any one of claims 126 to 133, wherein the nuclease-inactive Cas protein is a nuclease-inactive Cas9 protein.

135. The composition of claim 134, wherein the nuclease-inactive Cas9 protein is derived from a Streptococcus pyogenes Cas9 protein, a Staphylococcus aureus Cas9 protein, a Campylobacter jejuni Cas9 protein, a Streptococcus thermophilus Cas9 protein, or a Neisseria meningitidis Cas9 protein.

136. A composition according to claim 134, wherein the nuclease-inactive Cas protein is derived from Streptococcus pyogenes Cas9 protein.

137. The composition of any one of claims 126 to 136, wherein the CRISPR / Cas system comprises the guide RNA in the form of RNA, optionally wherein the guide RNA comprises at least one modification.

138. The composition of claim 137, wherein the at least one modification comprises 2'-O-methyl modified nucleotides and / or phosphorothioate bonds between nucleotides.

139. The composition of claim 138, wherein the one or more DNAs encoding the guide RNA are in one or more vectors.

140. The composition of claim 139, wherein the one or more vectors are one or more viral vectors.

141. The composition of claim 140, wherein the one or more viral vectors are one or more adeno-associated viral (AAV) vectors.

142. The composition of any one of claims 126 to 141, wherein the guide RNA or the one or more DNAs encoding the guide RNA is associated with a lipid nanoparticle.

143. A composition according to any one of claims 126 to 142, wherein: (I) the DNA targeting segment comprises at least 17, at least 18, at least 19 or at least 20 consecutive nucleotides of the sequence shown in any one of SEQ ID NOs: 118-121; and / or (II) the DNA targeting segment is at least 90% or at least 95% identical to the sequence shown in any one of SEQ ID NOs: 118-121; and / or (III) The guide RNA target sequence comprises at least 17, at least 18, at least 19 or at least 20 consecutive nucleotides of the sequence shown in any one of SEQ ID NOs: 114-117.

144. The composition of any one of claims 126 to 143, wherein the C9orf72 gene is a mammalian C9orf72 gene.

145. The composition of any one of claims 126 to 144, wherein the C9orf72 gene comprises a human C9orf72 promoter.

146. The composition of any one of claims 126 to 145, wherein the C9orf72 gene is a human C9orf72 gene or a humanized C9orf72 gene.

147. A pharmaceutical composition comprising a composition according to any one of claims 126 to 146 and a pharmaceutically acceptable carrier.

Images