Cocoa biting analogue and preparation method and application thereof

Abstract

The invention relates to a cacao Ying analogue as well as a preparation method and application thereof. The cocoa Ying analogs of the present invention have an N-terminal lanolin sulfur ring. Experiments show that the cacao Ying analogue has an inhibition effect on growth of various different bacteria such as methicillin-resistant staphylococcus aureus, vancomycin-resistant enterococcus faecalis and pseudomonas aeruginosa, and can be used for preparing antibacterial drugs.

Description

Technical Field

[0001] The present invention belongs to the field of biomedicine technology, and specifically relates to Cacaoidin (CAO) analogs and preparation methods and uses thereof. Background Art

[0002] Lanthipeptides are a class of active peptides mainly produced by Gram-positive bacteria. They are highly modified peptide antibiotics that are synthesized by ribosomes and then undergo a series of post-translational modifications.

[0003] Cacaoidin is a CAO molecule reported by Francisco Javier Ortiz-López et al. in Angew.Chem.Int.Ed., belonging to the Lanthidin subfamily. Lanthidin has the amino acid dimethylation characteristics of linaridin and the lanthionine characteristics of lanthipeptide, hence the name.

[0004] Later, Tao Meifeng and others discovered Lexapeptide, which was classified as Class V lanthipeptide. In terms of molecular structure, Lexapeptide is similar to CAO and can also be classified as a lanthidin molecule.

[0005] The kokodin molecule has excellent activity against drug-resistant bacteria, which is inseparable from the two sulfur-containing macrorings in its molecular skeleton, and the enzymatic mechanism that catalyzes the formation of the two rings is also very novel.

[0006] However, existing antibiotics and other antibacterial drugs are difficult to meet the clinical antibacterial needs for a variety of different pathogens (especially drug-resistant bacteria). Therefore, there is an urgent need to develop new antibiotics with antibacterial effects in this field. Summary of the invention

[0007] The main purpose of the present invention is to provide a novel antibiotic with antibacterial effect and its preparation method and application.

[0008] In a first aspect of the present invention, a cocoa tin analog or a pharmaceutically acceptable salt thereof is provided, wherein the cocoa tin analog has an N-terminal lanthiol ring and has a structure shown in Formula I, Formula II or Formula III:

[0009]

[0010] In another preferred embodiment, the cocoidine analogs are compounds represented by Formula I and Formula III.

[0011] The second aspect of the present invention provides a pharmaceutical composition, which contains (A) an effective amount of the cocoagulant analog or a pharmaceutically acceptable salt thereof according to the first aspect of the present invention; and (B) a pharmaceutically acceptable carrier.

[0012] In another preferred embodiment, the pharmaceutical composition is a liquid preparation or a solid preparation.

[0013] The third aspect of the present invention provides a use of the cocoagulant analog or pharmaceutically acceptable salt as described in the first aspect, for (a) preparing an antibacterial drug; (c) preparing a composition for inhibiting the growth of microorganisms; and / or (d) preparing a composition for treating bacterial infection.

[0014] In another preferred embodiment, the antibacterial drug is used to inhibit drug-resistant and non-resistant bacteria.

[0015] In another preferred embodiment, the antibacterial drug is used to inhibit bacteria selected from the group consisting of Gram-positive bacteria, Gram-negative bacteria, or a combination thereof.

[0016] In another preferred embodiment, the bacteria are selected from the following group: Staphylococcus bacteria, Enterococcus bacteria, Pseudomonas aeruginosa, or a combination thereof.

[0017] In another preferred embodiment, the bacteria are Staphylococcus, Enterococcus, or Pseudomonas aeruginosa.

[0018] In another preferred embodiment, the bacteria are methicillin-resistant Staphylococcus aureus MRSA, methicillin-sensitive Staphylococcus aureus MSSA, vancomycin-sensitive Enterococcus faecalis VSE, vancomycin-resistant Enterococcus faecalis VRE, and Pseudomonas aeruginosa.

[0019] A fourth aspect of the present invention provides a method for inhibiting bacteria in vitro, comprising:

[0020] (a) In vitro, applying the cocoagulant analog or pharmaceutically acceptable salt of claim 1 to bacteria that need to be inhibited, thereby inhibiting the bacteria.

[0021] In step (a), the cocoagulant analog or pharmaceutically acceptable salt according to claim 1 is applied to a site in need of treatment.

[0022] In another preferred embodiment, the inhibiting bacteria includes inhibiting bacterial growth.

[0023] In another preferred embodiment, the method is a non-therapeutic method.

[0024] In another preferred embodiment, the method is applied to the surface of an object to be antibacterial.

[0025] In a fifth aspect of the present invention, a separated gene cluster encoding a cocoa tin analogue is provided, wherein the gene cluster comprises a stn1 gene cluster and a stn2 gene cluster, wherein the stn1 gene cluster has a nucleotide sequence shown in SEQ ID No: 5, and the stn2 gene cluster has a nucleotide sequence shown in SEQ ID No: 6.

[0026] In another preferred embodiment, the gene cluster encoding the cocoidin analogue has a nucleotide sequence shown in SEQ ID No:4.

[0027] In another preferred embodiment, the gene cluster is a polynucleotide.

[0028] The sixth aspect of the present invention provides a vector, the vector comprising the gene cluster encoding the cocoa tin analogue as described in the fifth aspect of the present invention. The seventh aspect of the present invention provides a genetically engineered cell, the cell comprising the vector of claim 11 or the gene cluster encoding the cocoa tin analogue as described in claim 10 integrated into its genome.

[0029] In another preferred embodiment, the cells include prokaryotic cells and eukaryotic cells.

[0030] In another preferred embodiment, the cell is Streptomyces, preferably Streptomyces coelicolor (S. coelicolor).

[0031] In another preferred embodiment, the cell is S. coelicolor M145, S. coelicolor M1146 or S. coelicolor M1152.

[0032] The eighth aspect of the present invention provides a method for preparing the cocoagulant analog or pharmaceutically acceptable salt as described in the first aspect of the present invention, comprising the steps of:

[0033] (i) culturing the cell according to the seventh aspect of the invention under conditions suitable for expression, thereby obtaining a fermentation product containing the cocoagulant analog or a pharmaceutically acceptable salt thereof; and

[0034] (ii) isolating the cocoa butter analog or pharmaceutically acceptable salt as described in the first aspect of the present invention from the fermentation product.

[0035] In another preferred embodiment, the cell contains exogenous stn1 gene cluster and stn2 gene cluster, wherein the stn1 gene cluster has a nucleotide sequence shown in SEQ ID No: 5, and the stn2 gene cluster has a nucleotide sequence shown in SEQ ID No: 6.

[0036] The ninth aspect of the present invention provides a method for preparing a pharmaceutical composition, comprising the steps of: mixing the cocoagulant analog or a pharmaceutically acceptable salt thereof described in the first aspect of the present invention with a pharmaceutically acceptable carrier to form a pharmaceutical composition.

[0037] The tenth aspect of the present invention provides a method for treating bacterial infection in animals, comprising the steps of administering the above-mentioned cocoagulant analog or a pharmaceutically acceptable salt thereof or the above-mentioned pharmaceutical composition of the present invention to the animal in need of treatment.

[0038] In another preferred embodiment, the animal includes: a human or a non-human mammal.

[0039] It should be understood that within the scope of the present invention, the above-mentioned technical features of the present invention and the technical features specifically described below (such as embodiments) can be combined with each other to form a new or preferred technical solution. Due to space limitations, they will not be described one by one here. BRIEF DESCRIPTION OF THE DRAWINGS

[0040] Figure 1 A schematic diagram of the structure of the stn gene cluster is shown.

[0041] Figure 2 A schematic diagram of the structure of plasmid XYQ-2 is shown.

[0042] Figure 3 The LC-HR-MS analysis of the fermentation lysis broth of the plasmid conjugate corresponding to XYQ-2 is shown.

[0043] Figure 4 The MS / MS spectrum of the STN1 molecule is shown.

[0044] Figure 5 The MS / MS spectrum of the STN2 molecule is shown.

[0045] Figure 6 The MS / MS spectrum of the STN3 molecule is shown. DETAILED DESCRIPTION

[0046] The inventors have developed novel cocoa-dine antibiotics (cocoa-dine analogs) for the first time after extensive and in-depth research. The cocoa-dine analogs of the present invention have unique structures and excellent antibacterial activity. The present invention was completed on this basis.

[0047] Specifically, the inventors conducted a large amount of genome mining and screening based on the molecular skeleton of cocoa, thereby successfully obtaining novel analogs. In vitro antibacterial experiments show that the cocoa analogs of the present invention have good antibacterial activity and stability, and can serve as the basis for future research on antibacterial agents.

[0048] the term

[0049] As used herein, the term "CAO" refers to Theobroma cacao.

[0050] As used herein, the term "stn gene" refers to a Salmonella enterotoxin gene.

[0051] As used herein, the term "LC-MS" refers to liquid chromatography-mass spectrometry.

[0052] As used herein, the term "MIC" refers to minimum inhibitory concentration.

[0053] Cocamidotin analogs (or cocamidotin antibiotics)

[0054] As used herein, the terms "cocoidin antibiotics of the present invention", "cocoidin analogs of the present invention", "antibiotics of the present invention", "peptide antibiotics of the present invention", and "compounds of the present invention" are used interchangeably to refer to the cocoidin analogs described in the first aspect of the present invention. It should be understood that the terms also include various pharmaceutically acceptable salts, hydrates, or solvates of the compounds of the present invention.

[0055] As used herein, the term "pharmaceutically acceptable salt" refers to a salt suitable for use as a drug formed by a compound of the present invention and an acid or base. Pharmaceutically acceptable salts include inorganic salts and organic salts. A preferred class of salts is a salt formed by a compound of the present invention and a base. Salts can be formed by cations and negatively charged groups (e.g., carboxylates) on the compounds of the present invention. Suitable cations include sodium ions, potassium ions, magnesium ions, calcium ions, and ammonium ions, such as tetramethylammonium ions. Bases suitable for forming salts include, but are not limited to, hydroxides of alkali metals and alkaline earth metals (e.g., NaOH, KOH), oxides of alkali metals and alkaline earth metals, carbonates of alkali metals and alkaline earth metals (e.g., sodium carbonate), ammonia, organic amines, and the like.

[0056] The antibiotic of the present invention has an N-terminal lanthiol ring structure.

[0057] Preferably, the cocoagulant analogue of the present invention is a compound represented by formula I, II or III:

[0058]

[0059] Stn gene cluster

[0060] The present invention also provides a gene cluster for producing the cocoa tin analog of the present invention, namely, the Stn gene cluster. The stn gene cluster can be obtained from the Streptomyces sp. TN 58 strain.

[0061] like Figure 1As shown in the figure, the Stn gene cluster includes genes encoding unknown protein StnU1, kinase StnK, phosphate lyase StnL, precursor peptides StnA1-3, methyltransferase StnM, transporter proteins StnT1-3, redox protein StnB, HFCD family oxidative decarboxylase StnD, TvaE-like protein StnE, peptidase StnP, and unknown protein StnU2 ( Figure 1 ).

[0062] To facilitate expression, the inventors also split the Stn gene cluster to obtain the Stn1 gene cluster and the Stn2 gene cluster.

[0063] The Stn1 gene cluster and the Stn2 gene cluster, or the Stn gene cluster, are introduced into a suitable host cell, and the cocoagulant analogs of the present invention can be produced by fermentation.

[0064] Engineering bacteria and preparation method

[0065] The present invention also provides an engineered bacterium that can be used to produce the compound of the present invention, and a method for preparing the cocoidene analog of the present invention.

[0066] Typically, the preparation method of the present invention comprises the following steps:

[0067] (1) Obtaining the stn gene cluster, dividing the stn gene cluster into two segments, namely the stn1 cluster and the stn2 cluster;

[0068] (2) cloning the stn1 cluster and the stn2 cluster into expression vectors (such as plasmids) respectively;

[0069] (3) introducing the expression vector (such as a plasmid) into a recipient bacterium for fermentation;

[0070] (4) Separating the cocoa analogs of the present invention from the fermentation product.

[0071] In one embodiment of the present invention, novel cocoidine analogs are identified by determining the peptidase cleavage site and the core peptide sequence and detecting the fermentation product using LC-MS.

[0072] Based on the characteristics of the cocoa tin analogs of the present invention, the cocoa tin analogs of the present invention can be separated from the fermentation products in a variety of different ways (such as directly fermenting from the native bacteria Streptomyces sp. TN 58).

[0073] In another preferred embodiment, the recipient bacteria is Streptomyces, preferably Streptomyces coelicolor (S. coelicolor), and more preferably Streptomyces coelicolor (S. coelicolor) M145 recipient strain.

[0074] Pharmaceutical compositions and applications

[0075] The cocoagulant analogs of the present invention are a class of compounds having excellent antibacterial activity and can therefore be used as antibiotics.

[0076] Experiments show that the cocoidine analogues of the present invention have an inhibitory effect on the growth of various bacteria such as methicillin-resistant Staphylococcus aureus, vancomycin-resistant Enterococcus faecalis and Pseudomonas aeruginosa, and can be used to prepare antibacterial drugs.

[0077] The compounds of the present invention can be administered to mammals (such as humans) by oral, rectal, parenteral (intravenous, intramuscular or subcutaneous), topical administration, etc., preferably parenteral administration.

[0078] The compounds of the present invention can be administered alone or in combination with other pharmaceutically acceptable compounds. It should be noted that the compounds of the present invention can be administered in combination.

[0079] Solid dosage forms for oral administration include capsules, tablets, pills, powders and granules. In these solid dosage forms, the active compound is mixed with at least one conventional inert excipient (or carrier), such as sodium citrate or dicalcium phosphate, or with the following ingredients: (a) fillers or extenders, for example, starches, lactose, sucrose, glucose, mannitol, and silicic acid; (b) binders, for example, hydroxymethylcellulose, alginates, gelatin, polyvinyl pyrrolidone, sucrose, and acacia; (c) humectants, for example, glycerol; (d) disintegrants, for example, agar, calcium carbonate, potato starch or tapioca starch, alginic acid, certain complex silicates, and sodium carbonate; (e) solubilizers, for example, paraffin; (f) absorption accelerators, for example, quaternary ammonium compounds; (g) wetting agents, for example, cetyl alcohol and glyceryl monostearate; (h) adsorbents, for example, kaolin; and (i) lubricants, for example, talc, calcium stearate, magnesium stearate, solid polyethylene glycols, sodium lauryl sulfate, or mixtures thereof. In the case of capsules, tablets and pills, the dosage forms may also comprise buffering agents.

[0080] Solid dosage forms such as tablets, pills, capsules, pills and granules can be prepared using coatings and shell materials, such as enteric coatings and other materials known in the art. They may contain opacifiers, and the release of the active compound or compounds in such compositions can be delayed in a certain part of the digestive tract. Examples of embedding components that can be used are polymeric substances and waxes. If necessary, the active compound can also be formed into microencapsulated form with one or more of the above-mentioned excipients.

[0081] The liquid dosage form of the present invention includes a pharmaceutically acceptable emulsion, solution, suspension, syrup or tincture. In addition to the active compound, the liquid dosage form may contain an inert diluent conventionally used in the art, such as water or other solvents, solubilizers and emulsifiers, for example, ethanol, isopropanol, ethyl carbonate, ethyl acetate, propylene glycol, 1,3-butylene glycol, dimethylformamide and oil, in particular cottonseed oil, peanut oil, corn germ oil, olive oil, castor oil and sesame oil or a mixture of these substances.

[0082] Besides such inert diluents, the composition may also include adjuvants such as wetting agents, emulsifying and suspending agents, sweetening, flavoring, and perfuming agents.

[0083] Suspensions, in addition to the active compounds, may contain suspending agents such as, for example, ethoxylated isostearyl alcohols, polyoxyethylene sorbitol and sorbitan esters, microcrystalline cellulose, aluminum methanol and agar, or mixtures of these substances.

[0084] Compositions for parenteral injection may include physiologically acceptable sterile aqueous or anhydrous solutions, dispersions, suspensions or emulsions, and sterile powders for reconstitution into sterile injectable solutions or dispersions. Suitable aqueous and non-aqueous carriers, diluents, solvents or excipients include water, ethanol, polyols and suitable mixtures thereof.

[0085] Dosage forms for topical administration of the compounds of the invention include ointments, powders, patches, sprays and inhalants. The active ingredient is mixed under sterile conditions with a physiologically acceptable carrier and any preservatives, buffers, or propellants that may be required.

[0086] The compounds of the present invention may be administered alone or in combination with other active ingredients such as antibiotics.

[0087] When using the pharmaceutical composition, a safe and effective amount of the compound of the present invention is applied to a mammal (such as a human) in need of treatment, wherein the dosage during administration is a pharmaceutically effective dosage, and for a person weighing 60 kg, the daily dosage is usually 1 to 1000 mg, preferably 20 to 500 mg. Of course, the specific dosage should also take into account factors such as the route of administration and the health status of the patient, which are all within the skill of a skilled physician.

[0088] The main advantages of the present invention include:

[0089] (a) The present invention provides a class of peptide antibiotics with novel structures.

[0090] (b) The cocoacidin analogs of the present invention have certain antibacterial properties against non-resistant and resistant Gram-positive and Gram-negative bacteria, and in particular have an inhibitory effect on the growth of various bacteria such as methicillin-resistant Staphylococcus aureus, vancomycin-resistant Enterococcus faecalis and Pseudomonas aeruginosa.

[0091] The present invention will be further described below in conjunction with specific examples. It should be understood that these examples are intended to illustrate the present invention only and are not intended to limit the scope of the present invention. The experimental methods in the following examples where specific conditions are not specified are usually performed under conventional conditions, such as those described in Sambrook et al., Molecular Cloning: A Laboratory Manual (New York: Cold Spring Harbor Laboratory Press, 1989), or under conditions recommended by the manufacturer. Unless otherwise indicated, percentages and parts are weight percentages and weight parts.

[0092] Example 1: Preparation of CAO analogs STN1, STN2 and STN3

[0093] 1. Acquisition and structure of the stn gene cluster

[0094] After extensive screening, the present inventors found that there is a gene cluster encoding CAO analogs, namely, the stn gene cluster, in the Streptomyces sp. TN 58 strain.

[0095] The stn gene cluster was obtained by PCR amplification, and the sequencing results showed that the sequence of the stn gene cluster was as shown in SEQ ID NO: 4. The gene cluster includes multiple genes encoding unknown protein StnU1, kinase StnK, phosphate lyase StnL, precursor peptide StnA1-3, methyltransferase StnM, transporter StnT1-3, redox protein StnB, HFCD family oxidative decarboxylase StnD, TvaE-like protein StnE, peptidase StnP, unknown protein StnU2 ( Figure 1 ).

[0096] The entire stn cluster (U1-U2) is 13.9 Kb in total. Since it is separated by a gene encoding a transporter protein, the target cluster is divided into two segments after deducting the transporter protein, namely the stn1 cluster (SEQ ID NO: 5) and the stn2 cluster (SEQ ID NO: 6).

[0097] The stn1 cluster (SEQ ID NO: 5) is stn1 (U1-M), with a length of approximately 4.6 Kb

[0098] The stn2 cluster (SEQ ID NO: 6) is stn2 (B-U2) and is approximately 5.5 Kb in length.

[0099] Based on the research of the present invention, it is speculated that the amino acid sequences of the three core peptides StnA1-CP to StnA3-CP of the stn cluster are as shown in SEQ ID NOs: 1-3.

[0100]

[0101] 2. Preparation and identification of CAO analogs STN1, STN2 and STN3

[0102] The stn1 cluster (SEQ ID NO: 5) and the stn2 cluster (SEQ ID NO: 6) were cloned into two multiple cloning sites of the expression vector pXYDuet-1, respectively, to obtain an expression plasmid containing the stn1 cluster (SEQ ID NO: 5) and the stn2 cluster (SEQ ID NO: 6), which was named XYQ-2 ( Figure 2 ).

[0103] The plasmid XYQ-2 or pXYDuet-1 empty plasmid (as a blank control) prepared as above was transformed and introduced into ET12567 competent cells (ET12567 competent cells: a competent cell of Escherichia coli strain, used for conjugation transfer operations between different genera). Then, the conjugation transfer operation was performed and introduced into the M145 recipient strain of Streptomyces coelicolor (S. coelicolor) to obtain the transformed engineered bacteria.

[0104] The grown conjugates were subjected to PCR detection to select the transformed engineered bacteria into which the stn1 cluster (SEQ ID NO: 5) and the stn2 cluster (SEQ ID NO: 6) were introduced.

[0105] Three conjugates (transformed engineered bacteria) verified to be correct by PCR were selected and fermented separately using YEME medium. LC-MS was used to detect whether CAO analogs were produced in the fermentation products.

[0106] Fermentation: Obtaining the target compound: After trying three liquid culture media, YEME, TSB, and GYM, the fermentation and induction time were investigated. By comparing the yield of the target molecule and the amount of bacteria under different conditions, the fermentation medium was finally determined to be TSB. After sterilization, 500ml conical flasks were used, each containing 100ml of culture medium. The spores that had been activated in advance using MS solid plates (containing Am resistance, 50ug / ml) were taken in 1×1cm2 squares and inoculated into TSB culture medium. The spores were cultured at 30℃ and 220rpm for about 48h. After the amount of bacteria increased significantly, thiothricin (tsr) antibiotics (5ug / ml) were added to induce gene cluster expression. Then, the bacteria were collected after continuing to be cultured under the same conditions for about 60h. A total of 90L of fermentation material was fermented.

[0107] result:

[0108] In the fermentation products of S. coelicolor M145 recipient bacteria introduced with XYQ-2 plasmid, three CAO molecular analogs were successfully detected, named STN1, STN2, and STN3.

[0109] The collected bacteria were soaked three times with 1:1 volume of acetone, and the extracts were collected respectively. The extracts were concentrated by rotary evaporation at 30°C to obtain the crude extract containing the target molecule, which was wet loaded onto the MCI column, and then 60%, 80%, 90%, 95%, and 100% methanol were used as eluents. Each gradient was washed with 4 column volumes, and the fractions with 1 / 4 column volume were collected in one bottle. Then, LC-MS was used for detection, and the fractions containing the target molecule were combined. The crude fractions containing the target molecule were wet loaded onto the Sephadex LH-20 gel column with methanol as the solvent, and methanol was used as the mobile phase. The fractions were collected, and the fractions containing the target molecule were combined for LC-MS detection. The corresponding monomers STN1 about 9 mg and STN3 about 8 mg were finally purified by HPLC semi-preparation. The preparation conditions were: phase A: water (0.1% TFA), phase B: methanol (0.1% TFA). 0-6 min: 8% B; 6-8 min: 8% to 77% B; 8-27 min: 77% B; 27-28 min: 76% to 100% B; 28-38 min: 100% B. Chromatographic column: Agilent Eclipse XDB-C18, 5um, 9.4×250mm.

[0110] The CAO molecular analogs were analyzed by LC-MS, and the LC-HR-MS analysis results of three CAO analogs STN1, STN2 and STN3 were obtained ( Figure 3 ).

[0111] Furthermore, the molecular structures of three CAO analogs were determined by secondary mass spectrometry, Maerfey derivatization and nuclear magnetic resonance.

[0112] The secondary mass spectrum and structure of STN1 are shown in Figure 4 And formula I, it has an N-terminal lanthiol ring, a middle lanthiol ring and a C-terminal AviCys, and is the V-type lanthiol peptide with the most complex ring system discovered so far.

[0113]

[0114] The secondary mass spectrometry structure of STN2 is shown in Figure 5 and Formula II, having an N-terminal lanthiol ring.

[0115]

[0116] The secondary mass spectrometry structure of STN3 is shown in Figure 6and Formula III, having an N-terminal lanthiol ring.

[0117]

[0118] Example 2: Antimicrobial Activity Test

[0119] In this example, the antibacterial activity of the compounds of the present invention against a variety of different bacteria was tested.

[0120] 1. Tested bacteria (5 strains in total):

[0121] 1.1 Gram-positive bacteria (G + )

[0122] Methicillin-resistant Staphylococcus aureus: MRSA ATCC 43300;

[0123] Staphylococcus aureus: MSSA ATCC 29213;

[0124] Enterococcus faecalis: VSE ATCC 29212;

[0125] Vancomycin-resistant Enterococcus faecalis: VRE ATCC 51299.

[0126] 1.2 Gram-negative bacteria (G - )

[0127] Pseudomonas aeruginosa: ATCC9027.

[0128] 2. Culture medium:

[0129] 2.1CAMHB liquid culture medium (Qingdao Haibo, batch number: 20220118). Used for bacterial culture and sample antibacterial activity detection. 121℃, sterilization for 10min.

[0130] 2.2BHI solid culture medium (Qingdao Haibo, batch number: 20200227). Used for bacterial culture. 121℃, sterilize for 15min.

[0131] 3. Test samples

[0132] Among the three cocoa tin analogs of the present invention, STN1 and STN3 were selected for testing. Since there are only two amino acid differences between STN2 and STN3, and the retention times of the two molecules are very close from LC-MS, STN3 was selected for testing.

[0133] serial number Compound No. Molecular weight weight Solvents 1 StnA1 3061.597 0.6 DMSO 2 StnA3 2100.0502 1 DMSO

[0134] 4. Experimental methods and results

[0135] 4.1 Preparation of test sample stock solution

[0136] StnA1 and StnA3 were prepared into a stock solution of 2.56 mg / ml.

[0137] 4.2 Preparation of test sample concentration gradient

[0138] Double dilution of the test sample solution: Aseptically operate, take a sterile 96-well plate, add 140 μL of the above-obtained mother solution to the first well, and add 70 μL of sterile water to the 2nd-12th wells respectively. Take 70 μL from the first well and add it to the second well, mix well. Take 70 μL from the second well and add it to the third well, repeat to the 11th well, take 70 μL and discard it, and finally add a well with only 70 μL of sterile water as a growth control. In this way, a series of gradient concentrations of the sample solution to be tested are obtained.

[0139] 4.3 Determination of minimum inhibitory concentration (MIC) of samples against different strains

[0140] Different strains were inoculated into 3 mL of CAMHB and BHI liquid culture medium, cultured at 37°C overnight, and diluted with CAMHB and BHI to obtain a bacterial concentration of about 10 5 CFU / mL bacterial suspension. Take a sterile 96-well culture plate, add 10μL of the test sample dilution with different gradient concentrations prepared according to experimental method 2 to each well, and then add 90μL of each bacterial suspension. After mixing, place in a 37℃ incubator and culture for 24 hours to judge the results. The sample test concentrations are 256, 128, 64, 32, 16, 8, 4, 2, 1, 0.5, 0.25, and 0μg / mL respectively. The results are interpreted as the lowest drug concentration that completely inhibits bacterial growth in the small well as MIC.

[0141] 5. Experimental Results

[0142] The antibacterial activity test results are shown in Table 1.

[0143] Table 1. Antimicrobial activity test (MIC: μg / mL)

[0144]

[0145]

[0146] The above results show that the cocoidin analogs of the present invention have antibacterial properties against Gram-positive bacteria and Gram-negative bacteria, especially the StnA1 compound shows more excellent antibacterial activity, even against drug-resistant strains such as methicillin-resistant Staphylococcus aureus and vancomycin-resistant Enterococcus faecalis. The structures of the StnA2 compound and the StnA3 compound are very similar, which suggests that the activities of the two are similar. In addition, the activity of the StnA3 compound against Gram-positive bacteria is weaker than that of the compound StnA1, and the activity against Gram-negative bacteria such as Pseudomonas aeruginosa is comparable to that of the compound StnA1.

[0147] All documents mentioned in the present invention are cited as references in this application, just as each document is cited as reference individually. In addition, it should be understood that after reading the above teachings of the present invention, those skilled in the art can make various changes or modifications to the present invention, and these equivalent forms also fall within the scope defined by the claims attached to this application.

[0148] sequence

[0149] stn cluster sequence (SEQ ID No: 4):

[0150]

[0151] ccgtggtcatggagagcccgggacgcggcggcagcacggccacgttgggacgggcggccagcgccgcgtggtgggcccgg

[0152] taggcggcgctgtgcagcccgcccggcggcagcgcgggcagcagcaccaccggggcggtggtgcactgcgcggccagcag

[0153] cgcggggctgtcggccagcccgagggccaggcgcgccatgaagtgcagggtggcgggggcgacgaccacggcttcggccc

[0154] actcggtccacagcacgtgccgcgcgtgcacctcgtcctcggcccaccggtccggcaggacctcggcgccgctgtgcccggc

[0155] gagcgtgacccggctgacgaaccgctcggcgctcgcggtcaccccgatccgcagctccagggacgggtacgtgctgcgcaac

[0156] cagccaagccaatacggtagttcggcggctgccacggccccggtcaccacgagcagcagccgcgagatccccagcgcgggc

[0157] gccggtacggcggccacggaaccgggggcggcctgcgcggcgaccgccgccggaacggtctccggggccggggccgccg

[0158] gggtcgcgggggcctgcgtaccggcgctcaccgcgtcagctccggcagcatcgcctgcaggtccgccagcgcggagggcag

[0159] cccctccacctggcacacaccggtcaggttcagcgcgatctcgtcgacgcccaccgccgcgtactccacgagccggtcacgca

[0160] cctcgccgaggtcgccgtggacgaacgcgccgccctcgatcacggccttcgcgacggacagcgggtcgggctggtcgacgtc

[0161] gatgcccgagcggcgcagcatgtcctggtagtgcggcatcgagaggtggccggtgttgccggccaggaccagcttcgccgggt

[0162] cccggtcgggcgcggtcagcgccaccgggaccatcgccaccaggcgcggcatcggccggcccgcggcctcggccccggcc

[0163] cggagctcgggaacgatgacgtcccgcaggtacttcggcggggtcagccacgtgatggccacgtccgccacctcgccggcca

[0164] gccgggccatcttcggccgcagcacgccggcgccgagctcgacgcgcggtcccggcagggacggcagcccgatgcggcag

[0165] tcgaagtactcgccgcgcagctcgacctcgcggccggccagcaggccgcccatgatggtgaagtactcgcgcaccgcgccca

[0166] gctggctgcggtagggcgcgcccagcacgttcttctggaggatcgccgcgcccggtccgatgcccgcgaccaccgggtggcc

[0167] ggtggtcaccgcgagggacttggcctggagcgcggcctcgatcgggtgtcggaagggcatcagcgtgaccgccgtgcccacc

[0168] gggatccggaatccggaggccgccgcgtacgtgaaggtctggtacggctcggacatcagggcctggccctgccacagccggt

[0169] ccgcggcgccggaggcgaccagcgcggccagcgggagcgcctgctcgtgccgggtcggcatgaacggcatcatgatcgagt

[0170] acttggtcatgccgtgacttccttcgtggaccgggccgccggggcggcggcgccgctgagcaactgggcactgaccagttcgct

[0171] gtaggcggggctggagtcgagcagttcgtcgtgcgtgccctcggcgatgacccggccgcggtccatgacgacgaccttcgcgg

[0172] cgtgccggacggtggacaggcggtgcgcgaccaccaggaccgcccggtcctcggcgagggtgtcgacgatctgccgcagcc

[0173] gctgctcgttgacgctgtcgagctgcgaggacggctcgtcgaggaggaccaggctcccttccgccagtaccgcgcgggccagg

[0174] gcgacccgctggcgctgcccgccggagaggtcgtgggcgccgccgaggacggtgtccaggccgtcgggcagcgcccggac

[0175] ggaggtgtcgaggccgaccgcggcgagcgccgcgtacagctcctcgtcggtcggtacggcggccaggcccaggctcaggtt

[0176] ggcccgtacggtgtcgccgagcagggtgaacgcctggtcgacgaaggcgatccggccgcgcagctcgttcagcggcaggcg

[0177] cgcggcctcctcgccgaacaggtgcacacggcccgactgcggctccatgaaccgttcgatgagggccagcgcggtggacttgc

[0178] cggcgccggagagaccgacgacggccgtcagaccctgggcgggcacctcgaagtccacgccgcgcaggacgggttcgtcg

[0179] ccatagccgaaggtcacgtcctcgaagcggacggcgggggccggaccgggggtgttccggccgcccgccgtccgggccgg

[0180] ctccgccgcggcgggcgccaggtcctccaccggtagggcgaagacgtcgttgaaccgctgccgggaggtgagcccggcctg

[0181] gatctgcgcggcaccggaggccgccatgatcaggggagcggtcagctggagcaggtagaggaggaaggcgacgaagtcgg

[0182] ggagggcgaggtcaccggagacgagccgggcgccgccgccgagcagcacggtcagcagggcgatctgctggcccaggttg

[0183] atcacggggacgaccagcgactccatgcgcgccgcgtccacgccgagcttctccagccgccgtgcgtgaccgtccagcgtgc

[0184] ggccgacccgctcctccgcccggtacgccttgatgacgacgagggcgtcgagcgcggtgatgaactggtgggtcagcgtgcc

[0185] gatgtcgtcctgcatgttctggtacgtgcgccggagcccgcggatcacgacggcgacgaaggccagggcgcacacgaacccg

[0186] gccagggtgatcagcagcagcacccagtccaggacgcccatgatgacgatggtgccgagcagggtgatcgcggccatcggga

[0187] gctggatcggcccgatgttgatggcgcccttgagctgcatggcgtcggcggtcagccgggtggcgaggtcgccgctgcccacc

[0188] gccttggcgtcggacagccgcatggccaggccgcgccgcatcgtggtgatgcgcagccggcggaccagctgctcgccgagg

[0189] cgggacagcaggaacgcggcgagcgcgcccgccagggcggagcccagtccggtgccgatcatcagcagggcggcccggg

[0190] tgagtccctggccctgctggacctgctggaccagctcggcgacgaccagcggcagtgcgagggtggcggcggcggagaccg

[0191] ccgcgagcagggcgatcacggccatctggagccggttgccgggccggaacagctcgcgcaggatgcgcagctcaccgtccc

[0192] aggagtcggcggcgcgttcggcggacgcctcggtcttggtggtgacggtcatgacattccccccagtcgggcgttgcgcaggg

[0193] cggtccgggccttgacgatgccgccgtgctggagcaggccaccgatgtagatccggccgccgacgcgcagcagcgcggcga

[0194] tcgaaccgagcagcaggacggcggccagggcgacctcccaccacggcacgttctcgctcgccatccggaccggcatgacgg

[0195] ccgaggacaggcccggcaccagggacagcacccgggtgagggtgtcgctgatcccggtgaagggcgccagcgcggccatc

[0196] aggctcaaggtctggagcatgctgaccgggccggccgcgtgctggaggtcctcggcccgggaggccagggcccccgcgacg

[0197] gcccacagggcggcgaatcccaggaagccggggatgaaccagagcaccacggacacgctggtgccgatcgcgtcggccgg

[0198] cgcgtccaccaggtcggcggcgatggcgaccgtgacgccgcccgccgccatggcgctgatctgcacgaacgccacgagccc

[0199] gatgccgagcaccttgcccgccagcagctgccaggcgtgcaccttggccagcagcacctccacgatgcggctggacttctcctc

[0200] caggacgccctgggcgatgccctggccgaacatgaaggtcaggaagaacagggccatcacgccgatcgcggcggtcatggtc。

[0201] cgctcggtcctgcggtccgcgtccgggtcgagcgcggacacggtcagcggctgtacggccagggcccgcgcgatcgcgggg

[0202] tcggtcagtccgccgtcccgcagccgttcggtggtctgcgccgtgcggtgggcctcgtacagcgggccggccagcggctcggg

[0203] gagcttctcgcggaccaggacccggccctcgccgaccagcgcggcgtcggccttctccgcccgtacggcggcctccgcggcc

[0204] gcctcgttctcgtaggagacgacctccacgccgcgcgcgccaccgtcgccggatgccccggcggtctgcgcgcgcagcgattc

[0205] ggtcaggtcccggtgttcgccgacgacggcgaggaccggacggtccgcggcgccggtgaagaccttctgcagcccgagggc

[0206] accgcagaacaccaggatcatcatgacgagggaggcccacagctccttgcgctggaactgcgtgacgatctcgcgccaggcga

[0207] cgaggccgacgagggtgagcggcccgtgcggggtgttccggttcatgctgccaccgcctcgcggaagatttcggtcagggacg

[0208] actcgcgccaggcgaagtggacgatgtcgccgtgggtctgggcggccgagaggatctcccgtacggagacctgctcctcgacc

[0209] tccagcgtgtagcggtcgtggcgcgcctcgacgacgcgggtgccggcaacggccgacgcccacccggccggagcgccctcc

[0210] agggcgatctccaggcggcgggtggtcttgccgcgcagttcctccaccgtcccctcggcgaccagggcgccgtcgcggacgat

[0211] gcccacccggtcgcacagccgctccaccaggtcgagctggtggctggagaagacgacgggcacgccgtcgcgggtgaactc

[0212] ggtcagtgcctgcgccatcgcgtcggaggcgaccgggtcaaggccggagaagggctcgtccaggatcagcacgcccgggcg

[0213] gtggatcagggcggcgatcagctggaccttctgctgattgcccagcgacagcttgtccagcacgtccttggggcccatcttgacc

[0214] ccgaggcgctcgatccactcgtcggcccgggccttggcctcgcgggcccccatgccgctgagccgggcgaagtagacgagct

[0215] ggtcgcggggacgcatcttgccgtacaggccccgctcctcgggcatgtagccgatgaggcggcggccggcgctgtcgacggg

[0216] gcggccctcgaagcggacctcgccggtgtcggcggccagcatgccgagcgcgatgcgcatggcggtggtcttgccggcgcc

[0217] gttggccccgcagaacccgtacagctcaccggggcggacctggaaggacagtccgcgcaggaccttcttgtcgccgaacgcct

[0218] tggtgagagcgtcgaactcaagcaccggccacctccgggacgcggtccccggcgacggccggggagaactcgacgacggac

[0219] cgcaccggggtgaccggaccctgccaggtcggggtgagaccggcccggtcggccaggtccttgacggcctcgacggtccgg

[0220] gcggggaccgggacggtggcggcgacgcgcagcgcggtgtcggcggcggccaggcccgtgcccgtctcgggcaggttgat

[0221] ctcggcgaggagcacccgcccgtcgggaccggcggcctcggcgacgcggcgcaggatggccacggacttctcgtcgctcca

[0222] gtcggcgaggatccccgacagcaggtagacgtcgtgtcccttgggcagttcctcgaagaagctggcggcgacggcgctgccgc

[0223] ggtcggccaggccggcctctcgatgcggcgggcggcgatccccgcgacgttgggcaggtcgatgacggtgccccgcaggt

[0224] gcgggtgggcacgcagcagctcgatgagcagggtgccgttgttgccgccgacgtcggcgacgctgcggaccgtcgaccagtc

[0225] gtacgcgcggatgacggcgtcggcgtcccagccggccacggtcggcccctccgcctccagggctctgacgtagaccgggtcg

[0226] gtgttgatctcgtcccagtagtcgcggccgaacacggcggcgtgggaggcctccccggtccgcacggtgtgcagcaggcccac

[0227] cagtccgaggagacacggccgaacaggccctccatgctgaggtactgggccaggctcggctcatgggtgcgcagcagggg

[0228] gcgggagaggtcggtgagggcgtggacgccgtcggcgtcgaccgtgaacagccccagttccacgaggtagcgcaggactt

[0229] cgcgaacacctcggggtgcgcgccggcccgttcggccagcgtcgcggcagtgccacctccttcagccaccaggtcggcgatg

[0230] ccgagggtggcggccacgcggacggcgttgggcttgaggaggtcggacatgtcgaggaggtctgggtgtgtgcgctgttgtc

[0231] ggtcattcgcctgggcttccccgttgtggagtgaggggttcgatgggcacggggcccggaagtggggcgggcacggtgcccgg

[0232] aagtcaggtgggggcgcgggggcccgggggcggggcgcggtgccgtgacgccccggggggcggcgggtgcccggagtc

[0233] gggcacccgccgcgggcgttctagcccggcccgttggtggtgacgtagctgagcgcgaagctcgccacggcgccgcagaac

[0234] ggggtggtggccggggcgccggtcaccgcatcgacctcgatctcgtcggcgtcggcataggactcgtaacccgtcaccaggtc

[0235] ttcgagcgtgctctggtcgtttctcatggcggtcgtctcccttcaaatcgtgtgtgtggatgatgagttggagtgaggctccggctta

[0236] accgggtccgttggtggtgacgtagctgagcatgaagctcgcggcggcaccgcagaacggggtggtggccggggcgccggt

[0237] caccgcgtcgacctcgatctcgtcggcgtcggcataggactcgtaacccgtcaccagctcctcaagggtgttctggtcgtgggac

[0238] atgtggttcacctcccttcgtcggctcgttgcgtacgggaggacggcggctgcgggaatcccgcggggatcagcagccgagctt

[0239] gtaggtggcgccaccggcggcggaggcggcggccgaggcgcaccagccggaggacaccgcggacgcggcgacggtcgc

[0240] ggcgcagaccggggtggtggccggggcgtcggcgaccgcctggatgcccagctccgaggcctcggcgtaggtgttgtagcc

[0241] ggcgaccaggtccatcatcgaagcgttgtccatggttcttctccttgtggaagggtgcccggtgggcacctgagaggtgtgccgt

[0242] acgtggtgcacgtgcggtacgtactgaggtggaagcagggagcgggtgcgcggggcactcacgccctgcagccccctcaggc

[0243] cgcggcggccgtcggggcggtgccggtcgcgcccggggtcaccggtgcggggagttccggcgaggtgaggttgcgcgccg

[0244] gacggtgcgggtcgatgccggcctgggtgaagcgggccgtgagcgcctcggtcagcgggattccgtgccgggcccggtcga

[0245] gcagggcttcggcggcggcgccggcgcggtgctgtccgaagctgaggccgcgcatggccggccggtggtccgcgggctcga

[0246] aggccacgccgacgccgggggcgacgcggtggacgaagtgcgatgtctcggcgcccagtccgggcagggacggcgccagt

[0247] tcggcgaggaccggaactgcgtgccaggcgtcgggctggaggtagacgacgagggcgtcgcgcctcgggtagagcggcag

[0248] gcaggagaggaccttggcctggtaggcgatctccagctcgttgagccgggtcaggacggcccgccaggcgtccggggcggc

[0249] ctgggagtcgctcaggttcaggtagacgcgcagcagttccgtcggcgcgccccggttgaccgggctggtgacgacgaagaag

[0250] ccgggggagagcgcgggccgcgcggcgggcacgccgagttcgacgcgggtgccgggtgccggggcggtgacgctcatggt

[0251] ctgccgggggacccatgtccggatgccgtcccgcaggacgagcacgtcggcggcgtcggcgggggtgccggccggctggg

[0252] gaagcaccacggcctcggcggtgacggtgcggtgcggtacggcgtcgccgaggcgccgctcgaagtcggtgtcgcgcagga

[0253] tccgcggcagcttggaggccgactcgtcctggccggagtgcagggtctcgtacagggcggtgccgaggagggtcttgagctca

[0254] ccggggctgtccgcggtcagttcgcggcccgcgacggtcgcggagaggcggtcgtcggcgatgcgtacgcgttccagggcct

[0255] ggagcagcgcggcgggcggggcttcggtaccggtgccggggccggtgctcgttcttgttctcgttcccgtgctcacggggttac

[0256] ctccaatccgagtgcggtgacgaacttctgggggtggagaaggatgttgcggccgatgccggcggccgcccgctcgatgccgg

[0257] acaggcgcatccgctgcgcgctgcctgcgatcaggcggtcgagcatgtgccagccggcgaaggcggcggcccgctcgggga

[0258] gtccggggtccatgtcggggcgtacggcggcgtacgcccgccagaagtgccggatcttgggccgcaggcgttcgatcttggcc

[0259] acgccgcggctgaggatcgcctcgtgggtgagctcgtactcctcgggcccgctgccctcttcgtcgccacgggtggtgaccacg

[0260] tcgaggatggagcggtagagccactcgccggcgaagctgcccacgtcgcgggcggggtcggcgagccggaactcctcccag

[0261] tccgccacgtacaggccctcgtcggtgagcaggagctggtcgacgcggaagtcgcagtgggaggggaccttgggcgcggcg

[0262] gcctcggcggcgcgcagccgcgtcagtgcctcgaccagctgtgcgtcgctctgcatcaggcgccaggcctggagttcggcgaa

[0263] gcccaggttgtcgaacatgcccggaggcaggccctggaggaagtccagggagggcagcgccggcggggtggtgtccagctc

[0264] ctcggggccggggtgctccgcgccgtgcaggaggccgatggcgcggccgacctggccggccagctcgtcgtcgaagctctc

[0265] gtccaccatcagctcggccccgctgcgggcgccgtcgaggtaggtgaaggcgaccagccgttcggcggtgtcgttgcccagga

[0266] agaccgggccgcgcagtgcgtggggcgggagggtgacggcgaaccgctcgaaggcgagcaggcgccgcatccggtcgcg

[0267] gacgtcatcgccggttccgacgagccgtttgacgaagacctcgcggccgctttccgtactgccggcccatatttcgttgcggccta

[0268] tcggcgcggagagcgaattcctgtcgaagtggccgaatcccatacggtcgagaaaggattccaccgccggaactccgtcgaga

[0269] tcgacgggagcgaatgtggtcgacatcgggtggccgacctcagatgctctgcgtcgcgggaccggtggtcaccgaggggctct

[0270] gccagccgggaatcgactggttcgggccctgccggctcgggccctgccagcccgggatctgctggctggggctctgccagccc

[0271] gggatcgaagccgccgtgacctgcggttccgtcggctcgcccggcgtctcgtcggccaccgtgacggcggtcgcggtgacctg

[0272] gtgaatgccggccggcgcggcggaacggtcctccgagtcacccgaaccggtcagggtcgcgacggcgattccggcgaccag

[0273] tcccagtgcggtgaatacgtagaccgagcgcttcttcgaacgttccctgacggtggcagacttcgacat

[0274] Stn1 cluster (SEQ ID No: 5):

[0275]

[0276] stn2 cluster (SEQ ID No: 6):

[0277]

[0278] ctcgacgggaccgccaccgccccgcgcgccggtggcgcgcagcagccgggccagcacggtgtgcgcgaggtacccggcca

[0279] ggtcgcgggccgggtccggcagccggtagccgagcgccacggcggtcgcggccacgcccggttcggtgccgtacgcccac

[0280] cggtccgcttccggcgcccgctcgcgcaggtccgggcgggtgggcacgggccgccccgggatgtccccgaagtaccgctcg

[0281] accagcgcgcgggcctcggccgcgtcgaacccgccgacgagcgtcagcacggcgttgccgggcgcgtagtgctcggcgaag

[0282] aaggcccggcagtcggcgacggtcgcgctgcgcagccgctccgggtccccgtacccgtcgtgcgcgttggcgtacgagcggt

[0283] agagcacagagggcagcagcggccaggggaagccgccgtacgggcgctccacggtcgtcccgcggatctccagggcgacg

[0284] ccctcaagctgctccgcgagggcctcctcggtgaacagcggcgcccgcatccggtcggcttcggcgaacagcgccccgtcga

[0285] gggcggaggcgggcacggcctggtagtagtccgtgtagtcctggtgcgtggtgccgttcgcggaaccgccgagccggtggat

[0286] ccggtcgtagaactcgcctccggccagctgggcgctgccctggaacatgaggtgctcgaagaggtgcgcgaagccctcgcgg

[0287] ccggggggttcggaccggaacccgaccccgtagtgcacggccaccgccacccgggggtggccgtgggagggggcgagca

[0288] gcacccggagcccgttgggcagggtgaaccggtgcatcagtggtctcctggtgcggtgggaccgccgaagccggtgaggtag

[0289] ccgaggaagccggcgaagcgttcgacggtctccggctgccagccgacgtaggcggtgtagtcgtgcaggtgcagggcgatgc

[0290] gcagggccgccagccgcggccgcagcggaccgagggagcgcccgtacccctcctcgacggcgtcgacgagggactgccag

[0291] gcccggctgtcgccggagagctgccaggcgagctcggtgagctcgccgacggcccagcccacgtcggagtaccagggggc

[0292] gaggcacaggtcctcgccggccagcagctccacggggccgtcggcggcggggccggacacgggggcggcggcgacgagc

[0293] gagccgaggccgggcgcgccgtgggagacgacgagggccgggtcggcggcgagttcggcggtccagtcgcgcagccggt

[0294] gccagcgctcggcgccgagccgctcgcgcagtacggacgcggcctgcgcggcccagacctccggcgcgcggccggcgagc

[0295] cacgcgtcgagccgggcccagccgcgcgaggcggtggacggggccggcacgccggacgggacgggcaccgggaccggg

[0296] gcggtgtgcagggcggcgagggcgcggccgagggcgtgcagggccgggcgcagcccggggtgcgggccgtgccgcagc

[0297] aggtggccggccacggactcgtccccggacaggccgcggtaggcgcgcgcgccgccgggcagctcctccccgtggaccag

[0298] gcgcacgcccggggtcgggggggtctcggggagcggggtcggcagcgggtggaagccggcgggggcgagcggtccggg

[0299] ctcgcggatccacaggccgccgtggacggtcgtgcgcagcagcccggtcccgaagcggacgggaccgccgccgacgccctc

[0300] ggcggcctccttgacggcggtggcggtgggggtggcggtcacagcgtgctcgccggcggcgggaggggcacggacccggc

[0301] ggcggccagttcgcggcggcgctgctcgaccatcgcgagcgcgtcgggcagcggcgcgggcgcccaggcgtcctcgcggc

[0302] ccgtggtcatggagagcccgggacgcggcggcagcacggccacgttgggacgggcggccagcgccgcgtggtgggcccgg

[0303] taggcggcgctgtgcagcccgcccggcggcagcgcgggcagcagcaccaccggggcggtggtgcactgcgcggccagcag

[0304] cgcggggctgtcggccagcccgagggccaggcgcgccatgaagtgcagggtggcgggggcgacgaccacggcttcggccc

[0305] actcggtccacagcacgtgccgcgcgtgcacctcgtcctcggcccaccggtccggcaggacctcggcgccgctgtgcccggc

[0306] gagcgtgacccggctgacgaaccgctcggcgctcgcggtcaccccgatccgcagctccagggacgggtacgtgctgcgcaac

[0307] cagccaagccaatacggtagttcggcggctgccacggccccggtcaccacgagcagcagccgcgagatccccagcgcgggc

[0308] gccggtacggcggccacggaaccgggggcggcctgcgcggcgaccgccgccggaacggtctccggggccggggccgccg

[0309] gggtcgcgggggcctgcgtaccggcgctcaccgcgtcagctccggcagcatcgcctgcaggtccgccagcgcggagggcag

[0310] cccctccacctggcacacaccggtcaggttcagcgcgatctcgtcgacgcccaccgccgcgtactccacgagccggtcacgca

[0311] cctcgccgaggtcgccgtggacgaacgcgccgccctcgatcacggccttcgcgacggacagcgggtcgggctggtcgacgtc

[0312] gatgcccgagcggcgcagcatgtcctggtagtgcggcatcgagaggtggccggtgttgccggccaggaccagcttcgccgggt

[0313] cccggtcgggcgcggtcagcgccaccgggaccatcgccaccaggcgcggcatcggccggcccgcggcctcggccccggcc

[0314] cggagctcgggaacgatgacgtcccgcaggtacttcggcggggtcagccacgtgatggccacgtccgccacctcgccggcca

[0315] gccgggccatcttcggccgcagcacgccggcgccgagctcgacgcgcggtcccggcagggacggcagcccgatgcggcag

[0316] tcgaagtactcgccgcgcagctcgacctcgcggccggccagcaggccgcccatgatggtgaagtactcgcgcaccgcgccca

[0317] gctggctgcggtagggcgcgcccagcacgttcttctggaggatcgccgcgcccggtccgatgcccgcgaccaccgggtggcc

[0318] ggtggtcaccgcgagggacttggcctggagcgcggcctcgatcgggtgtcggaagggcatcagcgtgaccgccgtgcccacc

[0319] gggatccggaatccggaggccgccgcgtacgtgaaggtctggtacggctcggacatcagggcctggccctgccacagccggt

[0320] ccgcggcgccggaggcgaccagcgcggccagcgggagcgcctgctcgtgccgggtcggcatgaacggcatcatgatcgagt

[0321] acttggtcat

Claims

1. A cocoa dine analog or a pharmaceutically acceptable salt thereof, characterized in that: The cocoa tin analogue has an N-terminal lanthiocyclic ring, and the cocoa tin analogue has a structure shown in Formula I, Formula II or Formula III:

2. The cocoa dine analog or pharmaceutically acceptable salt according to claim 1, characterized in that: The cocoa butter analogs are compounds shown in Formula I and Formula III.

3. A pharmaceutical composition, characterized in that The pharmaceutical composition contains (A) an effective amount of the cocoagulant analog or a pharmaceutically acceptable salt according to claim 1; and (B) a pharmaceutically acceptable carrier.

4. The pharmaceutical composition according to claim 3, characterized in that The pharmaceutical composition is a liquid preparation or a solid preparation.

5. The use of the cocoagulant analog or pharmaceutically acceptable salt according to claim 1, characterized in that: Used for (a) preparing antibacterial drugs; (c) preparing compositions for inhibiting microbial growth; and / or (c) preparing compositions for treating bacterial infections.

6. The use according to claim 5, characterized in that The antibacterial drug is used to inhibit drug-resistant and non-resistant bacteria.

7. The use according to claim 5, characterized in that The antibacterial drug is used to inhibit bacteria selected from the group consisting of Gram-positive bacteria, Gram-negative bacteria, or a combination thereof.

8. The use according to claim 6, characterized in that The bacteria is selected from the group consisting of Staphylococcus bacteria, Enterococcus bacteria, Pseudomonas aeruginosa, or a combination thereof.

9. A method for inhibiting bacteria in vitro, characterized in that: include: (a) applying the cocoagulant analog or pharmaceutically acceptable salt of claim 1 to bacteria to be inhibited in vitro, thereby inhibiting the bacteria; In step (a), the cocoagulant analog or pharmaceutically acceptable salt according to claim 1 is applied to a site in need of treatment.

10. An isolated gene cluster encoding a cocoa tin analog, characterized in that: The gene cluster comprises a stn1 gene cluster and a stn2 gene cluster, wherein the stn1 gene cluster has a nucleotide sequence shown in SEQ ID No:5, and the stn2 gene cluster has a nucleotide sequence shown in SEQ ID No:6.

Images