Bacillus amyloliquefaciens ZF522 and application thereof in prevention and treatment of ginger root rot

Abstract

The invention discloses bacillus amyloliquefaciens ZF522 and application of the bacillus amyloliquefaciens ZF522 in prevention and treatment of ginger root rot. The bacillus amyloliquefaciens ZF522 provided by the invention has the preservation number of CGMCC (China General Microbiological Culture Collection Center) No.31037 in the General Microbiological Culture Collection Center of the China Committee for Culture Collection of Microorganisms. In-vivo tests show that the control effects of the bacillus amyloliquefaciens ZF522 on cucumber damping-off and ginger root rot can reach 55.56% and 50.84% respectively, and the bacillus amyloliquefaciens ZF522 can play a biological control role.

Description

Technical Field

[0001] The present invention belongs to the field of microbial technology and specifically relates to a strain of Bacillus amyloliquefaciens ( Bacillus amyloliquefaciens ) ZF522 and its application in controlling ginger root rot. Background Art

[0002] Ginger is a perennial herb of the genus Zingiberaceae, and is grown in Sichuan, Guangdong, Shandong, Fujian, Henan, and Shaanxi in my country. Ginger root rot is a soil-borne disease caused by infection with Fusarium and Pythium, which mainly harms the tubers, causing the tubers to rot and turn brown, and the plants to wither. The diseased tubers are water-soaked and translucent, and clear liquid can be exuded by squeezing the affected part. Mycelium grows on the surface of the tubers. In severe cases, it can lead to a decrease in yield or even a total crop failure. At present, chemical control is still the main method for the prevention and control of ginger root rot at home and abroad, but its excessive application is not only extremely harmful to human health, but also easily causes problems such as bacterial resistance. Therefore, finding broad-spectrum, high-efficiency, and low-toxic biological pesticides has become a consensus among scholars and pesticide users at home and abroad.

[0003] In recent years, biological control has gradually developed into an important method of plant disease control due to its advantages of safety, high efficiency, environmental protection and economy, and can effectively replace the use of chemical pesticides to a certain extent. In the existing biological control experiment of ginger root rot pathogens, Wang Cuicui et al. screened out two strains with antagonism to ginger root rot pathogens from the rhizosphere soil of ginger through in vitro antagonism experiments, namely, Pseudomonas fluorescens and Alcaligenes faecalis; Xu Yingying used ginger blight pathogens as indicators and used in vitro culture to isolate a strain of Bacillus brevis with antagonistic effect from the rhizosphere soil of ginger, and two strains of citrus-resistant actinomycetes, namely, Streptomyces fredii and Streptomyces laurensis; Veerubommu Shanmugam et al. found that bacteria Burkholderia cepacia With fungi Trichoderma harzianum After mixed inoculation, the control effect on ginger root rot in the field can reach 49.3%. Summary of the invention

[0004] The technical problem to be solved by the present invention is how to antagonize citrus fruit pythium and / or prevent and control cucumber damping-off disease and / or prevent and control ginger root rot disease.

[0005] In order to solve the above technical problems, the present invention provides a strain of Bacillus for the first time, wherein the Bacillus is Bacillus amyloliquefaciens ( Bacillus amyloliquefaciens ) ZF522, which is deposited in the General Microbiology Center of China Microorganism Culture Collection Committee (referred to as CGMCC, address: No. 3, No. 1 Beichen West Road, Chaoyang District, Beijing), with the deposit number CGMCC No.31037.

[0006] The present invention also provides a composition, which contains the above-mentioned Bacillus.

[0007] The active ingredient of the above composition may be the Bacillus and / or its metabolite and / or its culture.

[0008] In the above, the metabolite can be obtained from the shaking culture of the Bacillus. The metabolite can be a bacterial metabolite of the Bacillus. The bacterial metabolite of the Bacillus can be prepared according to the following method: culturing the Bacillus in LB liquid culture medium, collecting the bacterial liquid, and the bacterial liquid is the bacterial metabolite of the Bacillus.

[0009] The culture may be a material obtained by culturing the Bacillus in a microbial culture medium.

[0010] The culture medium is prepared from the following raw materials: 10 g of tryptone, 5 g of yeast powder, 10 g of NaCl, and 1000 mL of distilled water.

[0011] The substance may be a fermentation product, such as a fermentation broth containing the Bacillus and a substance secreted into a liquid culture medium, or a solid fermentation product containing the Bacillus and a substance secreted into a solid culture medium.

[0012] The composition can be a bacterial agent. The bacterial agent can be a pathogen inhibitor or a disease inhibitor.

[0013] The above-mentioned bacterial agent refers to a live bacterial preparation made by expanding the target microorganisms and using a carrier as an adsorbent to adsorb the fermentation liquid or solid fermentation product of the bacteria.

[0014] The above-mentioned bacterial agents may be in various dosage forms, including but not limited to liquid, emulsion, suspension, powder, granule, wettable powder or water dispersible granule, etc.

[0015] The bacterial agent may further include a carrier as required, and the carrier may be a solid carrier or a liquid carrier.

[0016] In the above, the composition may be any of the following: A1) Compositions for antagonizing Pythium, A2) A composition for preventing and controlling cucumber damping-off disease, A3) Composition for preventing and treating ginger root rot, A4) A composition for inhibiting the development of reproductive structures of pathogenic bacteria.

[0017] The present invention also provides a method for preparing the above composition, comprising the step of using the Bacillus as a component of the composition.

[0018] The present invention also provides application of the above-mentioned bacillus or composition in preparing products.

[0019] The product may contain the Bacillus and / or a metabolite of the Bacillus and / or a culture of the Bacillus.

[0020] The product has at least one of the following properties: B1) Antagonism against Pythium, B2) Prevention and treatment of cucumber damping-off disease, B3) Prevention and treatment of ginger root rot, B4) Inhibit the development of reproductive structures of pathogens.

[0021] The pathogen may be Pythium.

[0022] The present invention also provides a method for treating and / or preventing plant diseases caused by Pythium, which comprises contacting plants with the above-mentioned Bacillus or composition to treat and / or prevent plant diseases caused by Pythium.

[0023] The Pythium can be Pythium aphanidermatum ( Pythium aphanidermatum ).

[0024] The plant disease caused by Pythium can be ginger root rot and / or cucumber damping-off.

[0025] The purpose of the above method is to prevent and control soil-borne diseases caused by Pythium aphanidermatum.

[0026] In the above, the plant may be any of the following: C1) Angiosperms, C2) Magnoliaceae, C3) Cucurbitales or Zingiberales, C4) Cucurbitaceae or Zingiberaceae plants; C5) Cucumber or ginger plants, C6) Cucumber or ginger.

[0027] In this experiment, soil rhizosphere bacteria were isolated from the rhizosphere soil of ginger. The ginger root rot caused by Pythium was targeted. The in vitro-in vivo repeated screening method was used to screen out Bacillus amyloliquefaciens ZF522, which has a good control effect on Pythium aphanidermatum. Its taxonomic status was determined by morphological characteristics, Biolog determination and multi-gene sequence analysis. At the same time, the control effect of antagonistic strains on ginger root rot was determined, in order to provide a technical reference for the biological control of ginger Pythium root rot. Through cross-validation of the in vivo control effect of cucumber damping-off and ginger root rot, which are both caused by Pythium aphanidermatum, the control effects were 55.56% and 50.84%, respectively, further indicating that strain ZF522 has a stable control effect on ginger root rot. It provides new strain resources and theoretical basis for the use of microorganisms for biological control and preparation of biological microbial agent products.

[0028] Collection Instructions Bacteria name: Bacillus amyloliquefaciens Latin name: Bacillus amyloliquefaciens Strain ID: ZF522 Depository: China National Microbiological Culture Collection Administration General Microbiology Center Abbreviation of depository institution: CGMCC Address: No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing Deposit date: June 24, 2024 CGMCC Registration Number: CGMCC No.31037 BRIEF DESCRIPTION OF THE DRAWINGS Figure 1 This is an in vitro test of the protective effect of strain ZF522 against ginger root rot.

[0029] Figure 2 Observation of the morphological characteristics of strain ZF522.

[0030] Figure 3 Phylogenetic tree of strain ZF522 based on 16S rDNA, gyrA, and gyrB gene sequences.

[0031] Figure 4 This is the effect of ZF522 on the development of reproductive structures of Pythium aphanidermatum.

[0032] Figure 5 This is the electrophoresis diagram of amplification of lipopeptide resistance substances.

[0033] Figure 6 This study was conducted to determine the efficacy of strain ZF522 against cucumber damping-off disease in living potted plants.

[0034] Figure 7 This study was to determine the protective efficacy of strain ZF522 against ginger root rot in living potted plants. DETAILED DESCRIPTION

[0035] The present invention is further described in detail below in conjunction with specific embodiments, and the examples provided are only for illustrating the present invention, rather than for limiting the scope of the present invention. The examples provided below can be used as a guide for further improvements by those of ordinary skill in the art, and do not constitute a limitation of the present invention in any way.

[0036] The experimental methods in the following examples, unless otherwise specified, are all conventional methods, and are performed according to the techniques or conditions described in the literature in the field or according to the product instructions. The materials, reagents, etc. used in the following examples, unless otherwise specified, can all be obtained from commercial channels.

[0037] The following examples used SPSS23.0.0.0 statistical software to process the data, and used the t-test method to perform statistical difference analysis. The English letters after the numerical values ​​in each column indicate the degree of significance of the difference. There was no significant difference between treatments with the same letters at the 0.05 level, and there was a significant difference between treatments without the same letters at the 0.05 level.

[0038] Experimental Materials: Test pathogen: Pythium aphanidermatum ( Pythium aphanidermatum ) is deposited in the Institute of Vegetables and Flowers of the Chinese Academy of Agricultural Sciences, and the reference is “Chai Ali, Li Baoju, Shi Yanxia, ​​Xie Xuewen, Study on the classification of soil-borne fungi based on Fourier transform infrared spectroscopy, Spectroscopy and Spectral Analysis, 2011, 31 (08)”. The public can obtain the biological material from the applicant, and the biological material is only used for repeating the experiments of the present invention and cannot be used for other purposes.

[0039] Test reagents: Bacterial genomic DNA extraction kit (DP302, purchased from Beijing Tiangen Biochemical Technology Co., Ltd.), anhydrous ethanol (analytical grade) purity ≥ 99%, 2× Taq Master PCR Mix, ddH2O, agarose, TAE buffer, BM5000 DNA Marker. The above reagents were purchased from Beijing Biomed Gene Technology Co., Ltd.

[0040] Test culture medium: PD medium (200 g peeled potato, 20 g glucose, 20 g agar powder, 1000 mL distilled water, natural pH), PDA medium (PD medium with 20 g agar powder added); LB medium (10 g tryptone, 5 g yeast powder, 10 g NaCl, 1000 mL distilled water, natural pH); LB solid medium (LB liquid medium with 20 g agar powder added).

[0041] Test reagent: 40% ethylenediamine suspension (Jinan Taihe Chemical Co., Ltd.).

[0042] Example 1. Isolation and identification of strains 1.1 Isolation of strains Healthy ginger rhizosphere soil was collected from a ginger planting area in Linghe Town, Anqiu City, Shandong Province, where ginger root rot was seriously infected. The soil was placed in a sterile ziplock bag and stored in a -4°C refrigerator for later use. The dilution plate method was used to isolate Bacillus in the soil. 10 g of soil sample was weighed and placed in a 250 mL Erlenmeyer flask containing 90 mL of sterile water. The soil sample was shaken and cultured at 28°C and 180 r / min for 30 min to fully suspend it in sterile water. The soil suspension was treated in an 80°C water bath for 20 min to obtain the soil suspension. The soil suspension was diluted 10 times in a gradient and the concentration was selected as 1×10 -3 , 1×10 -4 , 1×10 -5 100 μL of three gradients were spread on LB plates and cultured at 28 °C for 48 h. Single colonies with different colony morphology were selected for purification and culture. After numbering, they were stored in a -80 °C refrigerator for future use.

[0043] 1.2 In vitro screening of antagonistic strains Preparation of biocontrol bacterial suspension: The biocontrol strains isolated from the soil were used in batches to determine the control effect on ginger root rot by in vitro tests, and strains with significant control effects were screened. Ten treatments were set up each time (8 different biocontrol strains, 50% methacryloyl methacrylate wettable powder 1g / L, and clear water control), 6 pieces of ginger in each treatment, and 3 replicates.

[0044] Refer to the in vitro screening test method of Li Mingtong's biocontrol strains: 1) Slice preparation: wipe the surface of ginger with 70% alcohol for disinfection; rinse with sterile water 4 times; cut the ginger into slices with a thickness of 0.5-1.0 cm with a sterilized blade for later use. 2) Preparation of biocontrol bacteria suspension: Take a single colony of strain ZF522 and inoculate it in liquid LB medium, shake and culture at 28°C and 180 r / min for 24 hours until the concentration of the bacterial suspension is 1×10 8 CFU / mL, add sterile water to dilute 300 times and set aside. Use a pipette to draw 600 μL and drop it on the disinfected ginger slices. Use 600 times diluted oxadimethoxine (total active ingredient content 68%, of which) as the positive control group; 600 μL sterile water was added to both the blank control group and the negative control group. 3) Preparation of pathogen inoculum: Use a 6mm puncher to punch 10 mycelium cakes grown on PDA medium plates, place them in 200mL PD, and incubate at 30°C, 180 r·min -1The culture was carried out in a constant temperature shaker for 3 days. After the culture was completed, the mycelium was crushed with a tissue crusher under sterile conditions and diluted 10 times with sterile water for later use. 4) Pathogen inoculation: 600 μL of pathogen inoculation solution was added to the treatment group, positive control group and negative control group respectively, and the blank control group was not inoculated with pathogen inoculation solution. Each treatment was repeated 3 times. 5) Culture and observation: The experimental treatment was placed in a 30℃ incubator for 3 days, and then each group was taken out to count the incidence, and the incidence rate and disease index were calculated.

[0045] Investigation method: The test investigated the incidence of cucumber damping-off disease in each treatment before and after the application of pesticides, and calculated the disease index and control effect. All cucumber seedlings were investigated for each treatment, and the disease grade of all leaves of each cucumber seedling was investigated according to the grading standard. Refer to NY / T 1857.1-2010 method. Grading standard: Grade 0: no symptoms; Grade 1: the area of ​​lesions accounts for less than 1 / 10 of the total leaf area; Grade 3: the area of ​​lesions accounts for 1 / 10-1 / 4 of the total leaf area; Grade 5: the area of ​​lesions accounts for 1 / 4-1 / 2 of the total leaf area; Grade 7: the area of ​​lesions accounts for 1 / 2-3 / 4 of the total leaf area; Grade 9: the area of ​​lesions accounts for more than 3 / 4 of the total leaf area; Disease index = Σ (number of diseased leaves at each level × relative level value) / (total number of leaves surveyed × highest disease level) × 100; Relative control effect (%) = [1-(disease index of control area before drug application × disease index of drug-treated area after drug application) / (disease index of control area after drug application × disease index of drug-treated area before drug application)] × 100.

[0046] A total of 83 strains of bacteria were isolated from the rhizosphere soil of ginger in Anqiu, Shandong, and 276 strains of bacteria were previously stored in the bacterial library. An antagonistic bacterium with good inhibitory effect was obtained by in vitro screening, which was numbered ZF522. The test results showed that this antagonistic bacteria had a good control effect on ginger root rot caused by Pythium aphanidermatum, with a control effect of 53.64%, while the control effect of the control chemical agent oxadimethoxine was 50.16% (Table 1).

[0047] Table 1 Determination of the protective effect of strain ZF522 on living potted plants

[0048] Note: Data are expressed as mean ± standard deviation. Different lowercase letters after the data in the same column indicate significant differences (P<0.05).

[0049] Figure 1 This is an in vitro test of the protective effect of strain ZF522 on ginger root rot, where A is ginger treated with a 300-fold diluted solution of strain ZF522; B is ginger treated with a 600-fold diluted oxadiazine solution; C is ginger treated with water; and D is a healthy control.

[0050] 1.3 Identification of antagonistic strains 1.3.1 Morphological identification Use a sterilized toothpick to pick a single colony of strain ZF522 on LB solid medium and culture at 28°C for 24 hours. Observe the morphological characteristics of the strain and determine the physiological and biochemical indicators according to the "Common Bacteria System Identification Manual" and "Berger's Bacteria Identification Manual". Strain ZF522 initially appears light yellow on the LB plate ( Figure 2 Middle A), later it appears pale white ( Figure 2 B), with a special smell, the colony surface is prominent, opaque, with neat edges, and ridge-like protruding wrinkles on the surface. Under scanning electron microscopy, strain ZF510 is short rod-shaped, about 1.05 μm in length ( Figure 2 Middle C).

[0051] 1.3.2 Physiological and biochemical identification The physiological and biochemical characteristics of strain ZF522 were detected by referring to Microbiology Experiment (Shen Ping, Fan Xiurong, Li Guangwu. Microbiology Experiment (3rd edition). Beijing: Higher Education Press, 1999.) and Manual of Identification of Common Bacterial Systems (Dong Xiuzhu, Cai Miaoying. Manual of Identification of Common Bacterial Systems. Beijing: Science Press, 2011.).

[0052] The strain ZF522 was identified as a Gram-positive bacterium that can grow at 28-37℃. The starch hydrolysis, VP reaction, catalase and motility tests were all positive, while the gelatin liquefaction and nitrate reduction tests were negative. The strain had good salt tolerance and could grow in different NaCl contents (1%-10%). In terms of carbon source utilization, the strain ZF514 could utilize D-maltose, D-trehalose, D-cellobiose, gentiobiose, sucrose, D-sorbitol, D-mannitol, etc., and could grow at pH 5 and pH 6. However, it could not utilize stachyose, D-raffinose and α-D-lactose (Table 2).

[0053] Table 2 Physiological and biochemical characteristics of strain ZF522

[0054] Note: + indicates positive; - indicates negative; W indicates weakly positive.

[0055] 1.3.2 Construction of multi-gene development tree The TIENGEN bacterial genomic DNA extraction kit was used to extract a small amount of genomic DNA from strain ZF522 as a template, and 16S rDNA, gyr A and gyr Conservative genes such as B were amplified by PCR and sequenced (Table 1). The resulting PCR products were sequenced by Beijing Bomed Biotechnology Co., Ltd. The sequencing results were analyzed using MEGA 6.0, Sequence Matrix, Seaview4 and other software to construct a maximum likelihood phylogenetic tree and analyze its taxonomic status.

[0056] Table 3 Primer information for constructing multi-gene phylogenetic tree

[0057] Note: gyr B: DNA gyrase subunit B; gyr A: DNA gyrase subunit A.

[0058] After PCR amplification, the gene sequences of 16S rDNA, gyrA and gyrB of strain ZF522 were obtained, and the conserved gene sequences corresponding to multiple strains of Bacillus were downloaded from NCBI. After comparing the sequences of each pair of conserved genes using MAGA 6.0, the three pairs of conserved genes of multiple strains of Bacillus were concatenated using Seaview4, Sequence Matrix, etc., and a multi-gene phylogenetic tree of strain ZF522 was constructed in MAGA 6.0. The results showed that it was located on the same branch as Bacillus amyloliquefaciens. Therefore, its taxonomic status was determined to be Bacillus amyloliquefaciens ( Figure 3 ). Strain ZF522 was deposited in the General Microbiology Center of China Microorganism Culture Collection Administration (CGMCC, address: No. 3, Yard No. 1, Beichen West Road, Chaoyang District, Beijing) on ​​June 24, 2024, with the deposit number CGMCC No.31037.

[0059] The 16S rDNA of strain ZF522 is sequence 1 (SEQ ID NO: 1, 870 bp) in the sequence list, and is as follows: 5’-TTGTGAGCGCTTGAGCGTGGATATGGTACAACTCTGGGTAACTCCTTACGTCGTATCCTCTTATCCTCACTCCCTGGTGCCGCTGTAACATCGATCCAGATAGATGGTGTACTGCACGAATTCTCGACAATCGAAGGCGTTGTGGAAGATGTTACAACGATAATCTTGCACATTAAAAAGCTTGCATTGAAAATCTACTCTGATGAAGAGAAGACGCTTGAAATTGATGTACAGGGCGAAGGAACTGTCACAGCAGCTGATATTACACACGACAGCGATGTTGAAATCCTTAATCCGGATCTTCATATCGCGACTCTTGGTGAGAATGCGAGTTTCCGAGTTCGCCTTACTGCACAAAGAGGACGTGGGTATACACCTGCTGATTCGAACAAAAGAGACGATCAGCCAATCGGCGTGATTCCGATCGATTCAATCTTTACGCCAGTTTCTCGTTTATCTTATCAGGTAGAAAACACTCGTGTAGGCCAGGTTGCAAACTATGACAAACTTACACTTGATGTTTGGACTGACGGAAGCACTGGACCGAAGGAAGCAATTGCGCTCGGTTCAAAGATTTTAACTGAACACCTTAATATATTCGTCGGTTTAACTGACGAAGCTCAGCATGCTGAAATCATGGTTGAAAAAGAAGAGGATCAAAAAGAGAAAGTTCTTGAAATGACGATTGAGGAACTTGATCTTTCTGTCCGGTCTTACAACTGCTTGAAGCGTGCGGGCATTAACACGGTTCAAGAACTTGCGAACAAGACGGAAGAAGATATGATGAAAGTTCGCAACCTGGGACGCAAATCACTTGAAGAAGTGAAAACAAAAATTGAAGAACTTGGACTCGGACTTTCGCAAAAGAAA-3’. 1.4 Biocontrol mechanism analysis 1.4.1 Effect of strain ZF522 on the mycelial characterization of Pythium aphanidermatum Find the center point at the bottom of the culture dish with the prepared PDA culture medium, then draw a cross on it, and inoculate the pathogen cake with a diameter of 6 mm to the center; inoculate the shaken bacterial solution to the filter paper pieces in four directions 30 mm away from the center. The control group does not inoculate the bacterial suspension, and inserts the sterilized cover glass into the culture medium at 30° from the place close to the bacterial cake, and seals it with plastic wrap, and places it in a 30℃ constant temperature incubator to culture until there are more hyphae attached to the cover glass. Take out the cover glass and use an optical microscope to observe the morphology of the hyphae and spores of the club cell.

[0060] Compared with normal pathogen hyphae, under the influence of strain ZF522, the hyphae of Pythium aphanidermatum were deformed and bent, some internodes were swollen, and there were fractures and vesicle structures; the hyphae were irregularly deformed, the hyphae were passive, the amount of hyphae decreased, the internodes were shortened, and the hyphae were fractured ( Figure 4 ).

[0061] 1.4.2 PCR detection of lipopeptide synthase gene in functional strains Take the slant-preserved purified strain, inoculate it on LB solid medium by plate streak method, pick a single colony and inoculate it on LB liquid medium, culture it at 30℃ and 180 r / min with shaking for 24 h, take 1.5 mL of bacterial solution and centrifuge it at 10 000 r / min for 5 min, remove the supernatant, resuspend it in 200 μL ddH2O, treat it with 95℃ boiling water for 10 min, treat it with ice bath for 5 min, centrifuge it at 10 000 r / min for 5 min, and extract the supernatant as the strain DNA template.

[0062] The six pairs of specific primers used in this study (Table 4) were synthesized by Beijing Qingke Biotechnology Co., Ltd., and the strains were amplified by PCR using the above specific primers. The amplification system was 20 μL, and the specific method was as follows: 10×buffer2.0 μL, dNTPs 1.6 μL, DNA template 1.0 μL, Taq DNA polymerase 0.2 μL, upstream and downstream primers 1.0 μL each, and ddH2O filled the system. Amplification conditions: 98℃ 2 min; 98℃ 10 s, 52℃ 15 s (ituC) or 54℃ 15 s (bymC) or 58℃ 15 s (srfA), 72℃ 10 s, 35 cycles; 72℃ 5 min, after the amplification, store at 4℃ for future use. The amplification product was detected by 1.0% agarose gel electrophoresis, and the detection results were observed in the gel imaging system.

[0063] Table 4 Primers for detecting lipopeptide resistance genes

[0064] Amplification results of primers encoding genes of Surfactins, Iturin, Fengycin and Bacillomycin D synthetase ( Figure 5 ) showed that Bacillus amyloliquefaciens ZF522 strain had a lipopeptide resistance target gene srf (1000 bp), fenA (1300 bp), iuda (875 bp), iU (275 bp), iD (647 bp), bymC The results showed that the lipopeptidase resistance gene was present in Bacillus amyloliquefaciens ZF522. Figure 5 1, 5, 9, 13, 17 are 5000 bp DNA molecular weight control bands 5000 bp DNA Marker; 2, 6, 10, 14, 18 are strain Stain ZF522; 3, 7, 11, 15, 19 are positive controls Positive control pf-5; 4, 8, 12, 16, 20 are negative blank controls Negative controls; 1-4 are srf ; 5-8 fenA ; 9-12 iU ; 13-16 bymA ; 17-20 bymC .

[0065] Example 2: Verification of potted plant protection efficacy of strain ZF522 2.1 Effect of strain ZF522 on cucumber damping-off in potted plants Since the disease cycle of ginger root rot is relatively long, and the Bacillus amyloliquefaciens ZF522 screened in this experiment is a functional strain with obvious antagonistic effect on Pythium aphanidermatum, it should have good prevention and control effects on soil-borne diseases caused by Pythium aphanidermatum. Therefore, a potted plant prevention effect test was first conducted to verify the cucumber damping-off disease caused by Pythium aphanidermatum.

[0066] A single colony of strain ZF522 was inoculated into liquid LB medium and cultured at 28°C and 180 r / min for 24 h. The culture solution was collected and diluted 300 times with sterile water to obtain the biocontrol agent ZF522. The content of strain ZF522 in the biocontrol agent ZF522 was 3.3×10 5 CFU / mL.

[0067] The soil inoculation method was used: the concentration was 1×10 8 CFU / mL of Pythium aphanidermatum ( Pythium aphanidermatum) The bacterial suspension was mixed with sterile soil at a ratio of 1:10 (volume ratio) as transplanting soil (soil containing Pythium aphanidermatum). Select "Zhongnong No. 6" cucumber seedlings with two leaves and one heart, use a sterilized toothpick to slightly pierce the root system of the cucumber seedling to create a wound, and then use the transplanting soil as the matrix to re-transplant the cucumber seedlings into a new 72-hole tray, with one seedling in each hole. After moisturizing and culturing for 1 day, it was divided into 3 experimental treatments: 1) ZF522 treatment: Use the biocontrol bacteria ZF522 agent for root irrigation treatment, and irrigate each plant with 300 ml of the biocontrol bacteria ZF522 agent (corresponding to Figure 6 2) Dimethomorph treatment: Use 600 times dimethomorph WP 50% to irrigate the roots, 50 ml per plant (corresponding to Figure 6 3) Clean water control treatment: irrigate roots with clean water, 50 ml per plant (corresponding to Figure 6 C). Each treatment was repeated 3 times for 8 cucumber seedlings. After 3 days, the disease index and control effect of cucumber damping-off disease were investigated according to the investigation method of Example 1. At the same time, a healthy control (corresponding to Figure 6 Middle D): Except that the transplanting soil was sterile soil, other operations were the same as the clean water control treatment.

[0068] The results showed that 3 days after the water control was inoculated with Pythium aphanidermatum, cucumbers began to show obvious symptoms of disease. The control effect of ZF522 on cucumber damping-off disease was 55.56%, which was higher than the control effect of 48.15% of dimethomorph, but there was no significant difference (P>0.05) (Table 5, Figure 6 ).

[0069] Table 5 Determination of the efficacy of strain ZF522 against cucumber damping-off disease in living potted plants

[0070] 2.2 Effect of strain ZF522 on ginger root rot in potted plants The soil inoculation method was used: the concentration was 1×10 8 CFU / mL of Pythium aphanidermatum ( Pythium aphanidermatum ) The bacterial suspension was mixed with sterile soil at a ratio of 1:10 (volume ratio) as the cultivation soil (soil containing Pythium aphanidermatum). Select fresh and germinated ginger seeds of the season and mix them with a concentration of 1×10 8 CFU / mL of the pathogen suspension was thoroughly mixed with sterile soil at a ratio of 1:10, and the surface was disinfected by wiping with an alcohol cotton ball. After breaking the ginger to create a wound, the healthy sprouted ginger seeds were inoculated into the soil mixed with Pythium aphanidermatum. The original solution of the ZF522 bacterial suspension (1×10 8CFU / mL) for root irrigation, 300 ml for each plant. A total of 4 experimental treatments were set up: 1) 300 times dilution of strain ZF522 bacterial suspension (1×10 5 CFU / mL) irrigate the roots with 50 mL (corresponding to Figure 7 2) 600 times dimethomorph wettable powder, 50 ml root irrigation (corresponding to Figure 7 3) Water the roots with 50ml of water (corresponding to Figure 7 C); 4) healthy controls (corresponding to Figure 7 Each treatment was repeated three times with 6 ginger plants per treatment. The disease index and control effect were investigated after 30 days.

[0071] Three days after the pathogen solution control was inoculated with Pythium aphanidermatum, ginger began to show obvious signs of disease. After the roots were irrigated with the 300-fold diluted strain ZF522 suspension, the prevention effect against ginger root rot was 50.84%, which was higher than the prevention effect of 44.06% of the 5% methacryloyl WP control treatment, but there was no significant difference (P>0.05) (Table 6).

[0072] Table 6 Determination of the protective effect of strain ZF522 on ginger root rot in living potted plants

[0073] Note: Data are expressed as mean ± standard deviation. Different lowercase letters after the data in the same column indicate significant differences (P<0.05).

[0074] The present invention has been described in detail above. For those skilled in the art, without departing from the purpose and scope of the present invention, and without the need to carry out unnecessary experimental conditions, the present invention can be implemented in a wide range under equivalent parameters, concentrations and conditions. Although the present invention provides specific embodiments, it should be understood that the present invention can be further improved. In a word, according to the principles of the present invention, the application is intended to include any changes, uses or improvements to the present invention, including departure from the disclosed scope in the application, and changes made with conventional techniques known in the art.

Claims

1. Bacillus, characterized in that The bacillus is Bacillus amyloliquefaciens ( Bacillus amyloliquefaciens ) ZF522, which is deposited in the General Microbiology Center of China Microorganism Culture Collection Committee (referred to as CGMCC, address: No. 3, No. 1 Beichen West Road, Chaoyang District, Beijing), with the deposit number CGMCC No.31037.

2. A composition, characterized in that The composition contains the Bacillus according to claim 1.

3. The composition according to claim 2, characterized in that: The composition is a culture, and the culture is a substance obtained by culturing the bacillus in a microbial culture medium.

4. The composition according to claim 2, characterized in that: The composition is a bacterial agent.

5. A composition according to any one of claims 2 to 4, characterized in that The composition is any one of the following: A1) Compositions for antagonizing Pythium, A2) A composition for preventing and controlling cucumber damping-off disease, A3) Composition for preventing and treating ginger root rot, A4) A composition for inhibiting the development of reproductive structures of pathogenic bacteria.

6. A method for preparing a composition, characterized in that The composition is the composition according to any one of claims 2 to 5, and the method comprises the step of using the Bacillus according to claim 1 as a component of the composition.

7. Use of the bacillus according to claim 1 or the composition according to claims 2-5 in preparing a product.

8. The product according to claim 7, characterized in that The product has at least one of the following properties: B1) Antagonism against Pythium, B2) Prevention and treatment of cucumber damping-off disease, B3) Prevention and treatment of ginger root rot, B4) Inhibit the development of reproductive structures of pathogens.

9. A method for treating and / or preventing plant diseases caused by Pythium, characterized in that: The method comprises contacting a plant with the Bacillus of claim 1 or the composition of claims 2 to 5 to treat and / or prevent plant diseases caused by Pythium.

10. The composition according to claim 5, the product according to claim 8, or the method according to claim 9, characterized in that: The plant is any one of the following: C1) Angiosperms, C2) Magnoliaceae, C3) Cucurbitales or Zingiberales, C4) Cucurbitaceae or Zingiberaceae plants; C5) Cucumber or ginger plants, C6) Cucumber or ginger.

Images