Method for detecting antisense oligonucleotide PS DNA in C57BL / 6J mouse serum based on Splint-PCR method

Abstract

The invention belongs to the technical field of biological analysis, and particularly relates to a method for detecting PS DNA (deoxyribonucleic acid) of antisense oligonucleotide in C57BL / 6J mouse serum based on a Splint-PCR (polymerase chain reaction) method. The method comprises the following steps: adding a probe A and a probe B into a sample to be detected, and hybridizing; adding SplintR Ligase into the system, and carrying out a ligation reaction; carrying out qPCR reaction on the connection product, and detecting; wherein the volume ratio of the two probe solutions to the sample to be detected is (1-3): (1-3): (2-10); in each reaction system, the final concentration of the two probe solutions is 300-600 nM; and the addition amount of the SplintR Ligase is 0.5 to 1.25 units / [mu] L. The sensitivity of the method is obviously superior to that of the prior art, and the method has a good application prospect in antisense oligonucleotide detection.

Description

Technical Field

[0001] The invention belongs to the technical field of biological analysis, and particularly relates to a method for detecting antisense oligonucleotide PS DNA in C57BL / 6J mouse serum based on a Splint-PCR method. Background Art

[0002] SplintR-PCR is a DNA ligation technique that uses PBCV DNA Ligase (also known as SplintR ligase, PBCV-1 DNALigase or SplintR Ligase) and can be used for qualitative and quantitative detection of DNA and RNA. Compared with hybridization ELISA, it has the advantages of higher sensitivity and wider detection range.

[0003] The detection principle of SplintR-PCR is divided into 3 steps:

[0004] 1. Hybridization of the substrate to be detected (such as DNA, RNA), probe Probe A and probe Probe B: Probe A and Probe B have a sequence base complementary to the substrate respectively, and the sequences of Probe A and Probe B are adjacent. In the constructed hybridization reaction system, high temperature denaturation is first performed, and then annealing is performed slowly, so that the substrate, Probe A, and Probe B can hybridize to form a three-body complex.

[0005] 2. SplintR Ligase-mediated ligation reaction: In order to connect the phosphodiester bond between adjacent nucleotides of Probe A and Probe B, a SplintR ligation reaction system was constructed. A certain amount of active units of SplintR Ligase was added, and the ligation reaction was carried out at the optimal ligation temperature. Then, the reaction was inactivated by heating.

[0006] 3. qPCR reaction: Add forward primer Primer-F, reverse primer Primer-R, premix containing DNA polymerase, the ligation product obtained in the previous step, and double-quenched probe (used to further reduce the background value of the reaction) to the qPCR reaction system. After multiple cycles of denaturation, annealing, and extension steps, it can be used to detect the concentration of the substrate in the sample.

[0007] Antisense oligonucleotides (ASOs) are short-chain DNA or RNA molecules that inhibit translation or stability of target mRNA by complementary binding, thereby regulating gene expression. They are often used in gene function research and treatment of certain genetic diseases. The SplintR-PCR method has been used to achieve quantitative detection of ASOs. For example, the document "Shin M, Meda Krishnamurthy P, Devi G, Watts JK. Quantification of Antisense Oligonucleotides by Splint Ligation and Quantitative Polymerase Chain Reaction. Nucleic Acid Ther. 2022 Feb; 32 (1): 66-73. doi: 10.1089 / nat.2021.0040. Epub 2021 Dec 17. PMID: 34928745; PMCID: PMC8817697." discloses that the SplintR-PCR method can effectively detect and quantify ASOs in biological samples. In this document, the range of quantification of ASOs is 1pM-1uM. Based on this existing technology, in order to meet higher application requirements, people still hope to expand the SplintR-PCR method to the lower limit of ASOs detection, thereby improving the sensitivity of detection.

[0008] However, SplintR-PCR is already a highly sensitive detection method, and its detection limit for many samples can reach the sub-nanomolar level (i.e., picomolar level). Based on this extremely low detection limit, to further improve the detection limit of this method for specific samples, it is necessary to optimize a lot of conditions in the detection for specific samples, which is very difficult. Summary of the invention

[0009] In view of the problems of the prior art, the present invention provides a method for detecting antisense oligonucleotide PSDNA in C57BL / 6J mouse serum based on Splint-PCR method.

[0010] A method for detecting antisense oligonucleotide PSDNA based on Splint-PCR method, comprising the following steps:

[0011] Step 1, hybridization: adding probe A solution and probe B solution to the sample to be tested, hybridizing to form a three-body complex;

[0012] Step 2, ligation: adding SplintR Ligase to the system to carry out ligation reaction;

[0013] Step 3, qPCR reaction: the ligation product obtained in step 2 is subjected to qPCR reaction for detection;

[0014] Wherein, in step 1, the volume ratio of the probe Probe A solution, the probe Probe B solution and the sample to be detected is (1-3):(1-3):(2-10); the concentration of the probe Probe A solution is 300-600nM, and the concentration of the probe Probe B solution is 300-600nM;

[0015] In step 2, the amount of SplintR Ligase added is 0.5-1.25 units / μL.

[0016] Preferably, the sample to be tested is C57BL / 6J mouse serum;

[0017] The nucleotide sequence of the antisense oligonucleotide PSDNA is shown in SEQ ID NO.1;

[0018] The nucleotide sequence of probe Probe A is shown in SEQ ID NO.2;

[0019] The nucleotide sequence of probe Probe B is shown in SEQ ID NO.3.

[0020] Preferably, in step 1, the volume ratio of the probe Probe A, the probe Probe B and the sample to be detected is 2:2:10; the concentration of the probe Probe A solution is 500 nM, and the concentration of the probe Probe B solution is 500 nM.

[0021] Preferably, in step 1, the hybridization conditions are: incubation at 90-95° C. for 5-40 min; or, incubation at 90-95° C. for 5-40 min and incubation at 51° C. for 30-40 min.

[0022] Preferably, in step 1, the hybridization conditions are: incubation at 95° C. for 5 min and incubation at 51° C. for 30 min.

[0023] Preferably, in step 2, the amount of SplintR Ligase added is 1.25 units / μL.

[0024] Preferably, in step 2, the conditions for the ligation reaction are: incubation at 25-37° C. for 0.5-4 h.

[0025] Preferably, in step 2, the conditions for the ligation reaction are: incubation at 25° C. for 4 h.

[0026] Preferably, in step 3, the reaction system of the qPCR reaction includes:

[0027] The ligation product 2-4.0 μL,

[0028] DNA polymerase premix 12.5 μL,

[0029] Forward primer solution 1-1.5 μL,

[0030] Reverse primer solution 1-1.5 μL,

[0031] Double quenching probe solution 0.7-1.0μL,

[0032] Water 7.8-4.5 μL

[0033] Wherein, the concentration of the forward primer solution is 8-12 μM, the concentration of the reverse primer solution is 8-12 μM, and the concentration of the double quenching probe solution is 8-12 μM.

[0034] Preferably, the premix of the DNA polymerase is selected from TaqMan TM Fast Advanced Master Mix or iTaqUniversal Probes Supermix;

[0035] And / or, the nucleotide sequence of the forward primer is shown in SEQ ID NO.4;

[0036] And / or, the nucleotide sequence of the reverse primer is shown in SEQ ID NO.5;

[0037] And / or, the nucleotide sequence of the double quenching probe is shown in SEQ ID NO.6.

[0038] The present invention applies the Splint-PCR method to detect antisense oligonucleotide PSDNA in C57BL / 6J mouse serum. In order to achieve higher sensitivity and reduce the quantitative detection limit to the femtomolar level, the present invention optimizes various conditions of the detection method (e.g., the amount of probe, the amount of SplintR Ligase, hybridization conditions, connection conditions, selection of DNA polymerase, etc.), and finally reduces the lower limit of the quantitative range of the detection method to 250fM, which is significantly improved compared to the picomolar detection limit of the prior art. Therefore, the present invention has a good application prospect in antisense oligonucleotide detection.

[0039] Obviously, according to the above contents of the present invention, in accordance with common technical knowledge and customary means in the art, without departing from the above basic technical ideas of the present invention, other various forms of modification, replacement or change may be made.

[0040] The above contents of the present invention are further described in detail below through specific implementation methods in the form of embodiments. However, this should not be understood as the scope of the above subject matter of the present invention being limited to the following examples. All technologies realized based on the above contents of the present invention belong to the scope of the present invention. BRIEF DESCRIPTION OF THE DRAWINGS

[0041] Figure 1 is the linear range fitting result of experimental group 1 in experimental example 1;

[0042] Figure 2 This is the linear range fitting result of experimental group 2 in experimental example 1;

[0043] Figure 3 This is the linear range fitting result of experimental group 3 in experimental example 1;

[0044] Figure 4 It is the linear range fitting result of experimental group 4 in experimental example 1;

[0045] Figure 5 This is the linear fitting result of the large standard concentration range of experimental group 5 in experimental example 1;

[0046] Figure 6 The first group of comparisons of amplification curves after using different DNA polymerase premixes in Experiment 2, where: ASO is amplified using TaqMan TM The results of Fast Advanced Master Mix (2x); ASO-1 is the result of using iTaq Universal Probes Supermix (2x); ASO-2 is the result of using TB Green Premix Ex TaqTMII (Tli RNaseHPlus) (2x);

[0047] Figure 7 The second set of comparisons of amplification curves after using different DNA polymerase premixes in Experiment 2, where: ASO is amplified using TaqMan TM The results for ASO-1 were obtained using the Fast Advanced Master Mix (2x). The results for ASO-1 were obtained using the iTaq Universal Probes Supermix (2x). DETAILED DESCRIPTION

[0048] In the following examples and experimental examples, reagents and raw materials not specifically described are all commercially available products.

[0049] Example 1 Method for detecting antisense oligonucleotide PSDNA in C57BL / 6J mouse serum based on Splint-PCR method

[0050] The method of this embodiment includes the following steps:

[0051] Step 1, hybridization: add probe Probe A solution and probe Probe B solution to the sample to be detected for hybridization to form a trimeric complex; the volume ratio of the probe Probe A solution, the probe Probe B solution and the sample to be detected is (1-3):(1-3):(2-10); the concentration of the probe Probe A solution is 300-600nM, and the concentration of the probe Probe B solution is 300-600nM; the hybridization conditions are: incubation at 90-95°C for 5-40min; or, incubation at 90-95°C for 5-40min and incubation at 51°C for 30-40min.

[0052] Step 2, ligation: SplintR Ligase is added to the system to carry out ligation reaction; the amount of SplintR Ligase added is 0.5-1.25 units / μL; the conditions of the ligation reaction are: incubation at 25-37° C. for 0.5-4 h.

[0053] Step 3, qPCR reaction: the ligation product obtained in step 2 is subjected to qPCR reaction for detection;

[0054] The reaction system of qPCR reaction includes:

[0055] The ligation product 2-4.0 μL,

[0056] DNA polymerase premix 12.5 μL,

[0057] Forward primer solution 1-1.5 μL,

[0058] Reverse primer solution 1-1.5 μL,

[0059] Double quenching probe solution 0.7-1.0μL,

[0060] Water 7.8-4.5 μL

[0061] Wherein, the concentration of the forward primer solution is 8-12 μM, the concentration of the reverse primer solution is 8-12 μM, and the concentration of the double quenching probe solution is 8-12 μM.

[0062] The sample to be tested is C57BL / 6J mouse serum;

[0063] The nucleotide sequence of the antisense oligonucleotide PSDNA (all phosphorothioate modified) is shown in SEQ ID NO.1: GCCCCTAGCGCGCGACTC;

[0064] The nucleotide sequence of probe Probe A is shown in SEQ ID NO.2:

[0065] CTCGACCTCTCTATGGGCAGTCACGACAGGAGTCGCGCG;

[0066] The nucleotide sequence of probe Probe B (5' phosphate modification) is shown in SEQ ID NO. 3: pCTAGGGGCCGCTGAGTCGGAGACACGCAGGGCTTAA;

[0067] The nucleotide sequence of the forward primer Primer-F is shown in SEQ ID NO.4: GCTCGACCTCTCTATGGGC;

[0068] The nucleotide sequence of the reverse primer Primer-R is shown in SEQ ID NO.5: TTAAGCCCTGCGTGTCTCC;

[0069] The nucleotide sequence of the double-quenched probe is shown in SEQ ID NO.6: / FAM / CTAGCGCGC / ZEN / GACTCCGTCGTG / IABkFQ / .

[0070] The premix of the DNA polymerase is selected from TaqMan TM Fast Advanced Master Mix or iTaqUniversal Probes Supermix.

[0071] The PCR amplification procedure is as follows:

[0072]

[0073] The dye was selected as FAM and the temperature of the heated lid was 105°C.

[0074] The technical solution of the present invention is further illustrated by experiments below.

[0075] Experimental Example 1 Comparison of quantitative range under different detection conditions

[0076] 1. Experimental Methods

[0077] The experimental steps of each experimental group of this embodiment are the same as those of Example 1, except that the specific parameter conditions of each step are adjusted, wherein the PSDNA standard curve sample is a series of standard solutions of different concentrations of antisense oligonucleotide PSDNA prepared using the serum of C57BL / 6J mice as a matrix, and the specific conditions are as follows:

[0078] Experimental Group 1:

[0079] Prepare 14 μL hybridization reaction system: 10 μL PSDNA standard curve sample, 2 μL Probe A (100 nM), 2 μL Probe B (100 nM); 90°C for 5 min, 51°C for 40 min, and cool to 37°C.

[0080] Ligation system: 2 μL 10×SplintR ligase Reaction Buffer (manufacturer: NEB), 1 μL SplintR ligase (25 units) per well, 3 μL nuclease-free HO 2 O, incubated at 25°C for 4 h, and then the ligation mixture was heat-inactivated at 65°C for 20 min.

[0081] qPCR reaction system:

[0082]

[0083] Reaction conditions:

[0084]

[0085] Experimental Group 2:

[0086] Prepare 14 μL of hybridization reaction system: 10 μL PSDNA standard curve sample, 2 μL Probe A (500 nM), 2 μL Probe B (500 nM). 90°C for 5 min, 51°C for 30 min, and cool to 37°C.

[0087] Ligation system: 2 μL 10×SplintR ligase Reaction Buffer (manufacturer: NEB), 1 μL SplintR ligase (25 units) per well, 3 μL nuclease-free HO 2 O, incubated at 25°C for 4 h, and then the ligation mixture was heat-inactivated at 65°C for 20 min.

[0088] qPCR reaction: prepare 3 sets of reaction systems respectively.

[0089] Reaction system 1:

[0090]

[0091] Reaction system 2:

[0092]

[0093] Reaction system 3:

[0094]

[0095]

[0096] The PCR amplification procedure is as follows:

[0097]

[0098] Experimental Group 3:

[0099] Prepare 14 μL of hybridization reaction system: 10 μL PSDNA standard curve sample, 2 μL Probe A (500 nM), 2 μL Probe B (500 nM). 95°C for 5 min, 51°C for 30 min, and cool to 37°C (at a rate of 0.1°C per second).

[0100] Ligation system: 2 μL 10×SplintR ligase Reaction Buffer, 1 μL SplintR ligase (25 units) and 3 μL nuclease-free H 2 O, incubated at 25°C for 4 h, and then the ligation mixture was heat-inactivated at 65°C for 20 min.

[0101] 3.qPCR reaction:

[0102] Prepare 2 sets of reaction systems respectively.

[0103] Reaction system 1:

[0104]

[0105]

[0106] Reaction system 2:

[0107]

[0108] The PCR amplification procedure is as follows:

[0109]

[0110] Experimental Group 4:

[0111] Prepare 14 μL of hybridization reaction system: 10 μL PSDNA standard curve sample, 2 μL ProbeA (500 nM), 2 μL ProbeB (500 nM), a total of 14 μL. 95°C for 5 min, 51°C for 30 min, and cool to 37°C (at a rate of 0.1°C per second).

[0112] Ligation system: 2 μL 10×SplintR ligase Reaction Buffer (manufacturer: NEB), 1 μL SplintR ligase (25 units) per well, 3 μL nuclease-free HO2 O, incubated at 25°C for 4 h, and then the ligation mixture was heat-inactivated at 65°C for 20 min.

[0113] qPCR reaction:

[0114] Prepare 2 sets of reaction systems respectively:

[0115] Reaction system 1:

[0116]

[0117] Reaction system 2:

[0118]

[0119] The PCR amplification procedure is as follows:

[0120]

[0121]

[0122] Experimental Group 5:

[0123] Prepare 30 μL of hybridization reaction system: 0.3 μL Probe A (10 μM), 0.3 μL Probe B (10 μM), 20 μL PSDNA standard curve sample; 95°C for 5 min, and cool to 37°C (at a rate of 0.1°C per second).

[0124] Ligation system: Add about 5.6 units of SplintR ligase to each well. Incubate at 37°C for 1 hour; heat inactivate at 65°C for 20 minutes.

[0125] qPCR reaction system:

[0126]

[0127] Reaction conditions:

[0128]

[0129] 2. Experimental Results

[0130] After testing the PSDNA standard curve samples under different conditions, the quantitative detection range of the above experimental groups 1-4 is as follows Figure 1-Figure 4 As shown; however, samples above 100nM and below 250pM cannot be accurately quantified, and the correlation coefficient does not meet the standard, such as Figure 5 As shown (where the connection conditions are the same as those of experimental group 1, and the concentration range of the standard is 1fM-1μM). The detection conditions and quantitative detection range of each experimental group are compared through a table, and the results are as follows:

[0131]

[0132]

[0133] From the above comparison we can see:

[0134] 1. In the hybridization system, the amount of PSDNA standard curve sample (equivalent to the sample to be tested), the amount of ProbeA / ProbeB and the hybridization conditions will affect the quantitative range of the detection method. Among them, when the conditions are: 10μL PSDNA standard curve sample (250fM-10nM), 2μL ProbeA (500nM), 2μL ProbeB (500nM), and the hybridization conditions are 95℃ 5min, 51℃ 30min, the optimal detection sensitivity of 250fM can be achieved.

[0135] 2. The amount of SplintR ligase added and the connection temperature in the connection reaction system were optimized, and it was confirmed that under the condition of less than 25Units / well, the connection efficiency would increase with the increase of the activity unit of SplintR ligase; and the efficiency of connection at 25℃ for 4h was higher than that at 37℃ for 30min. The test under the condition of 3.3Units / well and 37℃ for 30min did not meet the quantitative requirements and could not meet the detection requirements. For example, the correlation coefficient of experimental group 5 was only 0.742, which did not meet the standard requirement of 0.98, and STD1 and STD2 had no response values, which did not meet the requirements of the quantitative range.

[0136] It can be seen from this experimental example that the present invention optimizes the conditions of the two steps of hybridization and ligation, thereby achieving better detection sensitivity.

[0137] Experimental Example 2 Effect of DNA polymerase

[0138] 1. Experimental Methods

[0139] This experiment compares the effects of different DNA polymerases on the method of this application. Different DNA polymerase Mix premixes were used, including: TaqMan TMFast Advanced Master Mix (2x) (Manufacturer: Thermo Fisher), iTaqUniversal Probes Supermix (2x) (Manufacturer: Bio Rad), Taq Pro HS Probe Master Mix (Manufacturer: Novozyme) and Premix Ex Taq (Probe qPCR) (Manufacturer: Takara) were used to prepare 4 DNA polymerase mix premixes. The hybridization conditions, SplintR ligase dosage, ligation conditions, and PCR reaction conditions were consistent with those of experimental group 3. The reaction system was:

[0140]

[0141]

[0142] 2. Experimental Results

[0143] The amplification results are as follows Figure 6 , 7 As shown, the experimental results show that in the amplification system of the present invention, TaqMan TM Both FastAdvanced Master Mix (2x) and iTaq Universal Probes Supermix (2x) produced significant amplification with good linearity and R 2 The amplification curves of Taq Pro HS Probe Master (2x) and Premix Ex Taq (Probe qPCR) (2x) were abnormal and the detection could not be completed.

[0144] Therefore, in the detection system of the present invention, TaqMan TM Fast Advanced Master Mix (2x) or iTaq Universal Probes Supermix (2x) was used as the DNA polymerase.

[0145] Through the above embodiments and experimental examples, it can be seen that the present invention optimizes the parameter conditions and reagent types of each step of the Splint-PCR method, and constructs a method for detecting antisense oligonucleotide PSDNA in C57BL / 6J mouse serum. Under optimal conditions, the quantitative limit of the present invention can reach 250fM, which has a significantly better sensitivity than the prior art and has a good application prospect in antisense oligonucleotide detection.

Claims

1. A method for detecting antisense oligonucleotide PS DNA based on Splint-PCR, characterized in that: The steps include: Step 1, hybridization: adding probe A solution and probe B solution to the sample to be tested, hybridizing to form a three-body complex; Step 2, ligation: adding SplintR Ligase to the system to carry out ligation reaction; Step 3, qPCR reaction: the ligation product obtained in step 2 is subjected to qPCR reaction for detection; Wherein, in step 1, the volume ratio of the probe Probe A solution, the probe Probe B solution and the sample to be detected is (1-3):(1-3):(2-10); the concentration of the probe Probe A solution is 300-600nM, and the concentration of the probe Probe B solution is 300-600nM; In step 2, the amount of SplintR Ligase added is 0.5-1.25 units / μL.

2. The method for detecting antisense oligonucleotide PS DNA based on Splint-PCR method according to claim 1, characterized in that: The sample to be tested is C57BL / 6J mouse serum; The nucleotide sequence of the antisense oligonucleotide PS DNA is shown in SEQ ID NO.1; The nucleotide sequence of probe Probe A is shown in SEQ ID NO.2; The nucleotide sequence of probe Probe B is shown in SEQ ID NO.

3.

3. The method for detecting antisense oligonucleotide PS DNA based on Splint-PCR method according to claim 1, characterized in that: In step 1, the volume ratio of the probe Probe A, the probe Probe B and the sample to be detected is 2:2:10; the concentration of the probe Probe A solution is 500 nM, and the concentration of the probe Probe B solution is 500 nM.

4. The method for detecting antisense oligonucleotide PS DNA based on Splint-PCR method according to claim 1, characterized in that: In step 1, the hybridization conditions are: incubation at 90-95° C. for 5-40 min; or, incubation at 90-95° C. for 5-40 min and incubation at 51° C. for 30-40 min.

5. The method for detecting antisense oligonucleotide PS DNA based on Splint-PCR method according to claim 4, characterized in that: In step 1, the hybridization conditions are: incubation at 95°C for 5 min and incubation at 51°C for 30 min.

6. The method for detecting antisense oligonucleotide PS DNA based on Splint-PCR method according to claim 1, characterized in that: In step 2, the amount of SplintR Ligase added is 1.25 units / μL.

7. The method for detecting antisense oligonucleotide PS DNA based on Splint-PCR method according to claim 1, characterized in that: In step 2, the conditions for the ligation reaction are: incubation at 25-37°C for 0.5-4h.

8. The method for detecting antisense oligonucleotide PS DNA based on Splint-PCR method according to claim 7, characterized in that: In step 2, the conditions for the ligation reaction are: incubation at 25°C for 4 hours.

9. The method for detecting antisense oligonucleotide PS DNA based on Splint-PCR method according to claim 1, characterized in that: In step 3, the reaction system of the qPCR reaction includes: The ligation product 2-4.0 μL, DNA polymerase premix 12.5 μL, Forward primer solution 1-1.5 μL, Reverse primer solution 1-1.5 μL, Double quenching probe solution 0.7-1.0μL, Water 7.8-4.5 μL Wherein, the concentration of the forward primer solution is 8-12 μM, the concentration of the reverse primer solution is 8-12 μM, and the concentration of the double quenching probe solution is 8-12 μM.

10. The method for detecting antisense oligonucleotide PS DNA based on Splint-PCR method according to claim 9, characterized in that: The premix of the DNA polymerase is selected from TaqMan TM Fast Advanced Master Mix or iTaq UniversalProbes Supermix; And / or, the nucleotide sequence of the forward primer is shown in SEQ ID NO.4; And / or, the nucleotide sequence of the reverse primer is shown in SEQ ID NO.5; And / or, the nucleotide sequence of the double quenching probe is shown in SEQ ID NO.6.

Images