Use of hsa_circ_0003258 in preventing and / or treating liver ischemia-reperfusion injury

Abstract

The application discloses application of hsa_circ_0003258 in prevention and / or treatment of liver ischemia-reperfusion injury. The application is found by detection that the expression of hsa_circ_0003258 is significantly decreased in liver ischemia-reperfusion patients; overexpression of hsa_circ_0003258 can significantly inhibit macrophage inflammation and the apoptosis level of hepatocytes after hypoxia-reoxygenation treatment, and improve the function of hepatocytes; hsa_circ_0003258 has a protective effect on relieving liver ischemia-reperfusion injury, and has potential to become a drug for treating liver ischemia-reperfusion injury.

Description

TECHNICAL FIELD

[0001] The application belongs to the field of biological medicine, and particularly relates to application of hsa_circ_0003258 in prevention and / or treatment of hepatic ischemia reperfusion injury. BACKGROUND

[0002] With the significant increase of mortality and incidence of liver diseases worldwide, the number of patients with end-stage liver disease increases year by year, and liver transplantation becomes the best treatment, but hepatic ischemia reperfusion injury (HIRI) is an inevitable complication in the process of liver resection and liver transplantation surgery, which seriously affects the treatment effect. After hepatic ischemia reperfusion, the activation of liver macrophages and the release of inflammatory factors will cause further damage to liver cell function metabolism and tissue structure, which is a risk factor for early liver failure in recipients and leads to high morbidity and mortality. These pathological events promote each other, leading to severe and even irreversible liver dysfunction, which seriously hinders the rescue effect of surgical transplantation surgery. Therefore, in-depth analysis of the pathological process of hepatic ischemia reperfusion injury and targeted search for prevention and treatment targets not only have important theoretical significance, but also have urgent clinical needs.

[0003] Cyclic RNA (circRNA) is a new type of long-chain non-coding RNA, characterized by covalent closed continuous loop and strong stability, and its main functions are to act as miRNA sponge and translate into protein and regulate transcription, etc. It is reported to play an important role in various liver diseases. Therefore, the purpose of the present application is to reveal the prevention and treatment target of hepatic ischemia reperfusion injury, which will help to provide new scientific basis for its prevention and treatment. The present application belongs to the fields of genetic engineering, life science and medicine, and particularly relates to application of hsa_circ_0003258 in prevention and / or treatment of hepatic ischemia reperfusion injury.

[0004] Studies have shown that circRNA is involved in the occurrence and progression of various liver diseases, such as mitochondrial circRNA SCAR, circRNA_002581 and circRNA_0001805, which can alleviate the progression of NASH, while other circRNAs, such as hsa_circRNA_104348 and circRNA-100338, are involved in the occurrence and development of tumors. These research reports show that circRNA can be used as an ideal biological target for diagnosis and treatment of hepatic ischemia reperfusion injury, therefore, circRNAs and their specific biological effects in the course of hepatic ischemia reperfusion injury are worth exploring. SUMMARY

[0005] The application provides an application of hsa_circ_0003258 as a target point in preparation of a diagnostic and / or therapeutic product for ischemia-reperfusion injury.

[0006] The application provides an application of a reagent for detecting an expression level of hsa circ 0003258 in preparation of a diagnostic product for ischemia-reperfusion injury.

[0007] The application provides an application of an expression promoter of hsa_circ_0003258 in preparation of a therapeutic product for ischemia-reperfusion injury.

[0008] The application adopts the technical scheme of:

[0009] The application provides an application of hsa_circ_0003258 as a target point in preparation of a diagnostic and / or therapeutic product for ischemia-reperfusion injury.

[0010] In some embodiments of the application, the ischemia-reperfusion injury comprises renal ischemic injury and / or ischemia-reperfusion injury, myocardial ischemic injury and / or post-ischemic reperfusion injury, liver ischemic injury and / or ischemia-reperfusion injury; preferably, the ischemia-reperfusion injury is liver ischemic injury and / or ischemia-reperfusion injury.

[0011] The application provides an application of a reagent for detecting an expression level of hsa circ 0003258 in preparation of a diagnostic product for ischemia-reperfusion injury.

[0012] In some embodiments of the application, the ischemia-reperfusion injury comprises renal ischemic injury and / or ischemia-reperfusion injury, myocardial ischemic injury and / or post-ischemic reperfusion injury, liver ischemic injury and / or ischemia-reperfusion injury; preferably, the ischemia-reperfusion injury is liver ischemic injury and / or ischemia-reperfusion injury.

[0013] In some embodiments of the application, the reagent comprises a reagent suitable for at least one of the following methods: a fluorescent dye method, a nucleic acid amplification technique, a resonance light scattering method, sequencing or biological mass spectrometry.

[0014] In some embodiments of the application, the reagent comprises a probe or primer capable of specifically binding to hsa_circ_0003258 or a cDNA corresponding to hsa_circ_0003258.

[0015] In some embodiments of the application, the sequence of the primer is:

[0016] F1: 5'-CATGAAAACACACACTGCAC-3';

[0017] R1: 5'-TCCAGAATGCTGCAAGGAGT-3'.

[0018] In some embodiments of the present application, the product is a kit, a chip, a test paper or a reagent.

[0019] In a third aspect of the present application, a reagent of a hsa_circ_0003258 expression promoter is provided for use in any one of the following:

[0020] (1) preparing a drug for preventing and / or treating ischemia-reperfusion injury;

[0021] (2) preparing a drug for preventing and / or treating ischemia and / or hypoxia injury;

[0022] (3) preparing a drug for inhibiting macrophage inflammation;

[0023] (4) preparing a drug for inhibiting hepatocyte apoptosis;

[0024] (5) preparing a drug for improving hepatocyte function.

[0025] In some embodiments of the present application, the ischemia-reperfusion injury comprises: renal ischemia injury and / or ischemia-reperfusion injury, myocardial ischemia injury and / or post-ischemia reperfusion injury, liver ischemia injury and / or ischemia-reperfusion injury; preferably, the ischemia-reperfusion injury is liver ischemia injury and / or ischemia-reperfusion injury.

[0026] In some embodiments of the present application, the hsa_circ_0003258 expression promoter comprises an expression vector containing the circular RNA or the cDNA corresponding to the hsa_circ_0003258.

[0027] In some embodiments of the present application, the vector of the construct is a non-pathogenic viral vector.

[0028] In some embodiments of the present application, the non-pathogenic viral vector is an adenovirus vector, a lentivirus vector or a retrovirus vector.

[0029] In some embodiments of the present application, the vector comprises a viral vector or a non-viral vector.

[0030] In some embodiments of the present application, the viral vector comprises at least one of a lentivirus vector, an adenovirus vector, a baculovirus vector, a retrovirus vector, a poxvirus vector, a Sendai virus vector, a herpes simplex virus vector.

[0031] In some embodiments of the present application, the non-viral vector comprises at least one of a plasmid vector, a cationic polymer vector, chitosan, a liposome, a nanoparticle vector.

[0032] In some embodiments of the present application, the drug comprises a pharmaceutical excipient.

[0033] In some embodiments of the present application, the excipient comprises at least one of a diluent, a binder, a wetting agent, a lubricant, a disintegrant, an emulsifier, a co-solvent, a solubilizer, a preservative, a pH adjuster, an osmotic pressure adjuster, a surfactant, a coating material, an antioxidant, a bacteriostatic agent, or a buffer.

[0034] In some embodiments of the present application, the dosage form of the drug comprises at least one of a suspension, a granule, a capsule, a powder, a tablet, an emulsion, a solution, a dripping pill, an injection, an oral agent, a suppository, an enema, an aerosol, a patch, or a drop.

[0035] In some embodiments of the present application, the administration route of the drug comprises at least one of intravenous injection, intraperitoneal injection, intramuscular injection, subcutaneous injection, oral administration, sublingual administration, nasal administration, atomization administration, or transdermal administration.

[0036] In some embodiments of the present application, the drug contains an effective dose of the hsa_circ_0003258 expression promoter.

[0037] In the present application, the effective dose can be reasonably adjusted according to the actual situation and the judgment of the clinician, and for different species, the drug dose conversion formula or ratio between different species in the art can be reasonably adjusted.

[0038] The beneficial effects of the present application are:

[0039] The present application is found by detecting that the expression of hsa_circ_0003258 significantly decreases in patients with liver ischemia-reperfusion; using a lentiviral vector to construct overexpression of hsa_circ_0003258 can significantly inhibit macrophage inflammation, and also can significantly inhibit the apoptosis level of hepatocytes after hypoxia-reoxygenation treatment, and improve the function of hepatocytes; this indicates that hsa_circ_0003258 may play a protective role in alleviating liver ischemia-reperfusion injury, and has potential to become a drug for treating liver ischemia-reperfusion injury. The nucleotide fragment of hsa_circ_0003258 can be synthesized and connected with appropriate carrier substances such as lentivirus, liposome, functional nanoparticles, etc. to form a drug-carrier complex, which can be used to treat liver ischemia-reperfusion injury through oral administration, intravenous injection, etc.

[0040] The superiority of the hsa_circ_0003258 discovered by the application for the liver ischemia-reperfusion injury treatment drug lies in that: as a new tool for gene expression regulation, the circRNAs are a new type of targeted molecular treatment drug, which is different from traditional treatment drugs, has the advantages of easy synthesis, easy detection, accurate quantification, increased stability and improved affinity after chemical modification, can be effectively positioned to the target organ through a special drug delivery system, and the like, and will greatly improve the specificity and targeting of the liver ischemia-reperfusion injury treatment, and the successful development of the circRNAs drug will provide a new way for the treatment of liver ischemia-reperfusion injury and provide a reference for the development of treatment drugs for other diseases. BRIEF DESCRIPTION OF DRAWINGS

[0041] Figure 1 Characterization results of the exosomes, Figure 1 Fig. 2A shows a transmission electron microscope image, Figure 1 Fig. 2B shows the identification results of Western Blot.

[0042] Figure 2 3D hESC-Exosomes (3D-Exo) effectively improve the mouse IRI and promote the M2 polarization of intrahepatic macrophages and inhibit the apoptosis of hepatocytes, Figure 2 Fig. 3A shows the HE staining of liver tissues of mice in each group, Figure 2 Fig. 3B shows the determination results of physiological biochemical indicators and inflammatory factors in serum.

[0043] Figure 3 Heat map of circRNAs with significant differential expression between 3D hESC-Exosomes and 2D hESC-Exosomes (with log2 fold change (FC)>1 and corrected p value<0.01 as screening criteria).

[0044] Figure 4 Detection of the expression levels of the screened circRNAs, Figure 4 Fig. 4A shows the detection of the expression levels of the six circRNAs with the most significant differential expression in 2D hESC-Exosomes and 3D hESC-Exosomes by RT-qPCR, Figure 4 Fig. 4B shows the detection of the expression levels of the above six circRNAs in the plasma of patients with liver ischemia-reperfusion by RT-qPCR.

[0045] Figure 5 Circular characteristics of hsa_circ_0003258, Figure 5Fig. 1A shows that has_circ_0003258 is located on chromosome 17q21 from CircBase (http: / / www.circbase.org / ) and is formed by reverse splicing of exons 4 and 5 of the linear gene ZNF652, and Sanger sequencing detects the junction site of has_circ_0003258, Figure 5 Fig. 1B shows that the molecular weight of the PCR product detected by nucleic acid electrophoresis using hsa_circ_0003258 is 112 bp (amplification fragment size of hsa_circ_0003258).

[0046] Figure 6 Intervention of the expression of hsa_circ_0003258 in THP-1, Figure 6 Fig. 2A shows the efficiency of transfection of hsa_circ_0003258-specific siRNA in THP-1 cells by RT-qPCR, Figure 6 Fig. 2B shows the efficiency of transfection of overexpression hsa_circ_0003258 lentivirus in THP-1 cells by RT-qPCR.

[0047] Figure 7 hsa_circ_0003258 has a significant inhibitory effect on macrophage inflammation, Figure 7 Fig. 3A shows the CLSM image of CD86 immunostaining in THP-1 induced M1 macrophages transfected with hsa_circ_0003258-specific siRNA (circ si), overexpression hsa_circ_0003258 lentivirus (circ OE) or negative control (circ si-NC and circ OE-NC), green: CD86; blue: DAPI (original magnification, 20 times, scale bar, 40 μm); Figure 7 Fig. 3B shows the level of pro-inflammatory cytokines (IL-1β and IL-6) in the supernatant of M1 macrophages in each group detected by Elisa; Figure 7 Fig. 3C shows the expression level of inflammatory genes (IL-6, IL-1β, ARG-1 and CD206) in M1 macrophages in each group detected by RT-qPCR; Figure 7 Fig. 3D shows the expression level of inflammatory proteins (KLF4, Arg-1, CD206 and CD68) in M1 macrophages in each group detected by western blot.

[0048] Figure 8 Intervention of the expression of hsa_circ_0003258 in human primary hepatocytes, Figure 8 Fig. 4A shows the efficiency of transfection of hsa_circ_0003258-specific siRNA in human primary hepatocytes by RT-qPCR,Figure 8 Figure 14B shows the efficiency of RT-qPCR detection of human primary hepatocytes transfected with lentivirus overexpressing hsa_circ_0003258.

[0049] Figure 9 hsa_circ_0003258 has a significant effect of inhibiting hepatocyte apoptosis, Figure 9 Figure 14A shows the expression levels of apoptosis (Bax, Caspase 3) and liver function (ALB, HGF) related genes in each group of human primary hepatocytes transfected with lentivirus overexpressing hsa_circ_0003258, hsa_circ_0003258 specific siRNA or negative control (circ si-NC and circ OE-NC) after hypoxia-reoxygenation treatment, as detected by RT-qPCR. Figure 9 Figure 14B shows the proportion of apoptotic cells (Annexin + 7-AAD - and Annexin + 7-AAD + ) in each group of human primary hepatocytes after hypoxia-reoxygenation treatment, as detected by flow cytometry. DETAILED DESCRIPTION

[0050] The concept and technical effects of the present application will be described below in conjunction with examples for a clear and complete understanding of the purpose, features and effects of the present application. Obviously, the described examples are only a part of the examples of the present application, but not all the examples. Based on the examples of the present application, other examples obtained by those skilled in the art without creative labor fall within the scope of protection of the present application.

[0051] The raw materials, reagents or devices used in the examples and comparative examples can be obtained from conventional commercial channels or can be obtained by existing technical methods, unless otherwise specified. Unless otherwise specified, the test or test method is a conventional method in the art.

[0052] Full-length sequence of hsa_circ_0003258: CACACACAAAAGACATGCCATTTACATGCGAA ACCTGTGGAAAATCATTCAAACGCAGTATGTCACTCAAGGTGCACTCCTTGCAGCATTCTGGAGAAGCCCTTTAGATGCGAGAACTGTGACGAAAGGTTTCAGTACAA GTACCAGCTACCGCTCCCACATGAGCATTCATATTGGGCACAAACAGTTCATGTGCCAGTGGTGTGGCAAGGATTTCAACATGAAGCAGTACTTCGACGAACACATGAAAACACACACTG (SEQ ID NO: 1).

[0053] Example 1: Culture and exosome isolation of human embryonic stem cells

[0054] (1) 2D culture

[0055] Pre-spreading Matrigel to prepare culture plates for human embryonic stem cells (hESCs): Pre-spread diluted Matrigel (DMEM / F12: Matrigel (Corning Matrigel matrix) = 100:1) in a six-well plate at a volume of 2 mL / well, and incubate the plate in a CO2 incubator for more than 24 hours;

[0056] Digestion and passage: Select one well of hESCs in good condition (good condition: hESCs with a cell coverage of about 70%-80% 4-5 days after passage, with neat clonal edges and no differentiated cells), discard the culture medium, add 1 mL of calcium- and magnesium-free PBS to wash the cells, discard the PBS, and then add 1 mL of ReLeSR. TM (STEMCELL), and aspirate within 1 minute, then return the cells to the CO2 incubator for 2-3 minutes, after which add 1 mL mTeSR to each well. TM 1. Prepare culture medium (STEMCELL). Gently tap the culture plate to remove the digested cells from the bottom of the plate as much as possible. Then, use a 1 mL disposable pipette to gently aspirate and break the cells into small cell clusters (about a dozen hESCs).

[0057] Inoculation: Remove the pre-coated Matrigel plate, discard the Matrigel diluent, and add 3 mL of mTeSR. TM 1. Add 10 μM Y-27632 (Rock inhibitor, purchased from Selleckchem) to improve cell seeding survival rate. Aspirate the cell cluster suspension, coat it, and add 2.5 mL of serum-free mTeSR. TM1. Culture in the wells of the culture medium (1:6-1:10 ratio). Shake the plate in a crosswise motion to ensure the cells are evenly suspended in the culture medium. Change the medium daily. Supernatant harvest: Starting from the third day, collect the cell supernatant and store it at -80℃ for exosome isolation.

[0058] (2) 3D culture

[0059] Digestion and Passaging: When passaged hESCs, select culture wells with 70%-80% coverage, well-defined clonal margins, and undifferentiated cells. After aspirating the culture medium, wash the cells with 1 mL of calcium- and magnesium-free PBS buffer, aspirate the PBS buffer, and then add 1 mL of GCDR (Gentle Cell Dissociation Reagent). Incubate in a CO2 incubator for 5-10 minutes. Afterward, aspirate the GCDR from the wells and add 1 mL of mTeSR. TM 1. Culture medium: Pipettes the cells and uses a pipette to form a single-cell suspension.

[0060] Inoculation: Take 10 μL of single-cell suspension, stain with trypan blue, and count using a hemocytometer. Add 5 mL of mTeSR to the low-adhesion plate. TM 1. Add 10 μM Y-27632 (Rocki) to improve the survival rate of cell seeding. Take a cell suspension containing 500,000 single cells and seed it into the wells. Shake the well plate in a cross shape to make the cells evenly suspended in the culture medium.

[0061] Medium change: After 48 hours, change half the amount of medium per well per day. During the subsequent culture process, Y-27632 will not be added to the culture medium.

[0062] Supernatant harvest: Starting from day 3 of culture, collect the waste culture medium from each medium change, filter it through a 0.22μm sterile membrane, and put it into a 50mL sterile centrifuge tube for subsequent separation and purification of exosomes.

[0063] (3) Exosome isolation and purification included: following the method in Example 1, human embryonic stem cells were cultured for 2D and 3D, with each cell generation cultured for 6 days. From day 3 to day 6, the discarded culture medium was collected daily. The cells were filtered, then centrifuged at 1000g for 10 minutes at 4°C, and the supernatant was collected. The collected supernatant was centrifuged at 2000g for 20 minutes at 4°C, and the supernatant was collected. The collected supernatant was centrifuged at 10000g for 30 minutes at 4°C, and the supernatant was collected. The collected supernatant was centrifuged at 110000g for 70 minutes, the supernatant was discarded, and the precipitate was resuspended with phosphate buffer. The cells were centrifuged again at 110000g for 70 minutes, the supernatant was discarded, the precipitate was resuspended with a small amount of phosphate buffer, and the cells were filtered through a 0.22μm filter membrane for sterilization to obtain hESC-exosomes.

[0064] Experimental results are as followsFigure 1 Figure 1 Figure 1

[0065] Example 2: Establishment of liver ischemia-reperfusion model mice and delivery of exosome treatment

[0066] (1) Establishment of liver ischemia-reperfusion model mice: SPF level ICR mice aged 6-8 weeks were anesthetized and fixed, and the skin was prepared and disinfected. A 5 cm longitudinal incision was made from the xiphoid to the upper abdomen, and the abdominal skin was clamped with forceps. The skin was cut and hemostasia was performed in turn, and the liver and gastrointestinal tract were fully exposed. The perihilar ligament was separated, the hepatic portal was dissected, and the hepatic pedicle that supplied the left and middle lobes of the liver was bluntly separated. Then a small non-injurious artery clamp was used to close it. After blocking for 60 minutes, the blood vessel clamp was removed, and the left and middle lobes of the liver gradually turned red, indicating successful reperfusion of the liver. During reperfusion, the abdominal cavity was sutured and closed.

[0067] (2) Treatment groups: After successful blocking, two treatment groups were 2D hESC-Exosomes (2D-Exos) and 3D hESC-Exosomes (3D-Exos), i.e. 50 μL of 2D-Exos and 3D-Exos with a concentration of 1 μg / mL were injected through the tail vein of mice, respectively. The negative control group (PBS group) was injected with an equal amount of PBS buffer after blocking, and the normal control group (Sham group) was only opened and sutured without blocking treatment.

[0068] (3) Detection: After reperfusion for 6 hours, the mice were sacrificed, and the serum of each group of mice was taken for physiological and biochemical index detection. The liver was taken for histopathological staining and Elisa detection of liver injury indicators such as glutamic-oxalacetic transaminase (AST) and glutamic-pyruvic transaminase (ALT) and inflammatory cytokines such as interleukin 1β (IL-1β) and interleukin 6 (IL-6).

[0069] As Figure 2 ​​​As shown, both 2D-Exo and 3D-Exo can effectively reduce the levels of liver injury indicators such as aspartate aminotransferase (AST) and alanine aminotransferase (ALT), and down-regulate the levels of inflammatory cytokines such as interleukin 1β (IL-1β) and interleukin 6 (IL-6), which indicates that the liver injury treated by Exosomes is improved, the inflammation is relieved, and the liver function is restored, so whether 2D culture or 3D culture, hESC-Exosomes can significantly improve liver inflammation and enhance liver function in ischemia-reperfusion mice.

[0070] Example 3: Chip sequencing of 2D hESC-Exosomes and 3D hESC-Exosomes circRNAs content

[0071] Circular RNA (circRNA) is a new type of long-chain non-coding RNA, which is characterized by covalently closed continuous loops and strong stability, and its main functions include acting as a miRNA sponge, translating into proteins, and regulating transcription. More and more evidence shows that circRNA is involved in the occurrence and progression of various liver diseases. The supernatant of 2D hESC and 3D hESC cells was collected, the exosomes in the supernatant were extracted, the exosome RNA was extracted, and the uncircularized RNA was digested by ribonuclease R (RNase R) to enrich circRNA and perform sequencing.

[0072] The results are shown in Figure 3 The results show that 2D hESC-Exosomes has more significant differential expression of circRNAs than 3D hESC-Exosomes.

[0073] This embodiment mainly uses the exosomes produced by human embryonic stem cells of human origin using a specific culture method to maintain stem cell pluripotency and stemness, which are rich in some specific circular RNAs. Further, chip sequencing technology is used to identify specific circular RNA molecules with specific therapeutic effects among these rich circular RNAs.

[0074] Example 4: RT-qPCR verification of the expression of the most significant differentially expressed circRNAs in 2D hESC-Exosomes and 3D hESC-Exosomes

[0075] According to the specification, RNAiso Plus (Takara, 9109) was used to extract total RNA from 2D hESC-Exosomes, 3D hESC-Exosomes, healthy volunteer plasma samples, and liver ischemia-reperfusion patient plasma, respectively.

[0076] The reverse transcription of circRNA uses the kit PrimeScript TM The preparation of reaction system is as follows:

[0077] Table 1 circRNA reverse transcription reaction system

[0078] Reagent Amount (μL) 5x PrimeScript Buffer (for Real Time) 2 Reverse Transcription Primer 0.5 PrimeScript RT Enzyme Mix I 0.5 Total RNA * RNase Free ddH2O up to 10

[0079] The reaction system can be scaled up as needed, and 500 ng of total RNA can be used in a 10 μL reaction system.

[0080] Gently mix the sample, and reverse the program as follows: reverse transcription at 25°C for 10 minutes and at 42°C for 30 minutes; inactivation of reverse transcriptase at 85°C for 5 seconds; cDNA at 4°C, -80°C storage or subsequent experiments.

[0081] The RT-qPCR reaction is configured as follows after diluting the obtained cDNA by 10 times:

[0082] Table 2 amplification reaction system

[0083] System components Amount 2x SYBR qPCR Master Mix 5 μL Primer 1 (10 μM) 0.2 μL Primer 2 (10 μM) 0.2 μL Template DNA / cDNA 3.6 μL ddH2O To 10 μL

[0084] Mix the reaction solution, centrifuge, and then run the machine according to the following reaction program: pre-denaturation at 95°C for 30 seconds; 95°C for 10 seconds, 60°C for 30 seconds, 40 cycles; melting curve: 95°C for 15 seconds, 60°C for 60 seconds, 95°C for 15 seconds. The expression level of the target gene relative to the internal reference is analyzed by selecting 2 -△△CT Methods for calculation. The forward and reverse primers for amplification reaction are synthesized by Guangzhou Jisai Biological Technology Co., Ltd. and Guangzhou Aikai Biological Technology Co., Ltd. The specific sequences are shown in Table 3.

[0085] Table 3 Forward and reverse primers for amplification reaction

[0086] Name Sequence SEQ ID NO: hsa_circ_024516-qF GCCAGTTCTTCCTTATCCA 2 hsa_circ_024516-qR TGCGGAGTCCAACATCA 3 hsa_circ_103845-qF CACCTAGCAAAAGATCACC 4 hsa_circ_103845-qR GTGCCATTGTCCACATC 5 hsa_circ_102444-qF GACAGAGCGAATCGTCAC 6 hsa_circ_102444-qR GGATGTTCTTAATGGCATAG 7 hsa_circ_405229-qF TAACGATTGTTGAGTGCAGTCCTCA 8 hsa_circ_405229-qR TGAGGACTGCACTCAACAATCGTTA 9 hsa_circ_001302-qF GCGAATCGTCACCACTTAC 10 hsa_circ_001302-qR TTCTTAATGGCATAGCTGATC 11 hsa_circ_0003258-qF CATGAAAACACACACTGCAC 12 hsa_circ_0003258-qR TCCAGAATGCTGCAAGGAGT 13

[0087] The results are shown in Figure 4 , wherein Figure 4 A in the figure shows that among these circRNAs, the expression of hsa_circ_0003258 is significantly up-regulated, and the relative abundance in 3D hESCs-Exosomes is the highest, which is consistent with the circRNAs chip sequencing results shown in Figure 3 ; Figure 4 B in the figure shows that the expression of hsa_circ_0003258 in the plasma of patients with liver ischemia-reperfusion is significantly reduced, and then the role of hsa_circ_0003258 in liver ischemia-reperfusion is analyzed through clinical samples.

[0088] Example 5: Verification of the circularity of has_circ_0003258

[0089] According to the CircBase (http: / / www.circbase.org / ) database, has_circ_0003258 is located on chromosome 17q21 and is formed by reverse splicing of exons 4 and 5 of the linear gene ZNF652. According to the connecting sequence of the circularization site, specific RT-qPCR primers for has_circ_0003258 were designed (primers F1: 5'-CATGAAAACACACACTGCAC-3' (SEQ ID NO: 12) and R1: 5'-TCCAGAATGCTGCAAGGAGT-3' (SEQ ID NO: 13)). The obtained RT-qPCR products were further subjected to Sanger sequencing to verify the splicing site, and the RT-qPCR products were detected by gel electrophoresis to verify the product size. Then, RNase R treatment was used to confirm whether the circular structure of has_circ_0003258 is resistant to RNase R.

[0090] The specific steps are as follows: the elimination of linear RNA uses RNase R of Epicentre, and the solution is prepared according to the following table reaction system: 1 μL RNase R, 2 μL 10x RNase R Reaction Buffer, 1 μL total RNA (500 ng / μL), and 15 μL RNase-Free H2O. After preparing the reaction solution in a sterile EP tube according to the system, incubate at 37°C for 30 minutes. The product obtained after digestion to remove linear RNA is total circRNA, which can exclude the interference of linear RNA containing the same sequence.

[0091] The results are shown in Figure 5 has_circ_0003258 is located on chromosome 17q21 from CircBase (http: / / www.circbase.org / ) and is formed by reverse splicing of exons 4 and 5 of the linear gene ZNF652, and Sanger sequencing detects the connecting site of has_circ_0003258, which is consistent with that published in the circBase database (A in Figure 5 The molecular weight of the amplified product of hsa_circ_0003258 was detected by nucleic acid electrophoresis, and the results are shown in Figure 5 B, the size of the amplified fragment of hsa_circ_0003258 is 112 bp, after RNase R treatment, the expression of ZNF652 is significantly reduced, while the expression of has_circ_0003258 shows no significant difference before and after treatmentFigure 5 C). The above results confirmed the circular nature of has_circ_0003258.

[0092] Example 6: Experiment of changing the level of hsa_circ_0003258 in THP-1 cells

[0093] 1.25 x 10 5 THP-1 cells / well were planted in a 6-well plate, and according to the requirements of the experiment, the control group (normal THP-1 cells without any treatment) was set; the circ si group (transfected with 100 nM siRNA specific to hsa_circ_0003258), the circ si-NC group (transfected with 100 nM siRNA NC), the circ OE group (transfected with hsa_circ_0003258 overexpression lentivirus, MOI value = 50), and the circ OE-NC group (transfected with NC lentivirus, MOI value = 50). Then, each group of THP-1 was induced into M1 type macrophages for detection. THP-1 cells were purchased from the Chinese Academy of Sciences Cell Library.

[0094] The hsa_circ_0003258 overexpression lentivirus vector was constructed according to the instructions of the circRNA lentivirus expression vector pLC5-ciR of Jise Biotechnology Co., Ltd., and the obtained hsa_circ_0003258 overexpression lentivirus can overexpress hsa_circ_0003258 shown in SEQ ID NO: 1.

[0095] Among them, the overexpression hsa_circ_0003258 lentivirus, hsa_circ_0003258 specific siRNA and negative control (circ si-NC and circ OE-NC) for cell experiment transfection were designed by Guangzhou Jise Biotechnology Co., Ltd. The transfection kit is Lipofectamine TM 3000 Reagent (Thermo Fisher), and the transfection method refers to the instructions.

[0096] Table 4 siRNA and target sequence fragments

[0097] Name Sequence SEQ ID NO: hsa_circ_0003258 specific siRNA ACACACTGCACACACAAAAGA 14 siRNA NC Provided by GenScript and responsible for interpretation /

[0098] The cells of each group were collected, total RNA was extracted using RNAiso Plus (Takara, 9109) according to the instructions, and was reversely converted into cDNA. The mRNA reverse transcription system: 2 μL PrimeScript RT Enzyme Mix I, 1 μL total RNA (500 ng / ul) and 7 μL RNase-Free H2O. Then the amplification was carried out in the PCR instrument under the following conditions: 37°C for 15 minutes, 85°C for 5 seconds, and 4°C. The obtained cDNA was used for RT-qPCR experiment to detect the gene expression levels of hsa_circ_0003258 and pro-inflammatory cytokines (IL-6, IL-1β) and anti-inflammatory proteins (ARG-1 and CD206).

[0099] The circRNA reverse transcription and RT-qPCR system was the same as that of Example 2. The results are shown in Table 6. Figure 6 As shown in Table 6, after transfection of hsa_circ_0003258 specific siRNA and overexpression of hsa_circ_0003258 lentivirus, the expression level of hsa_circ_0003258 in THP-1 cells was significantly down-regulated / up-regulated.

[0100] RT-qPCR system: 10 μL Green PCR Master Mix, 0.5 μL Forward primer, 0.5 μL Reverse primer, 5 μL cDNA and 4 μL RNase Free ddH2O. The solution of the reaction system was mixed and centrifuged, and then was loaded into the machine according to the following reaction program: pre-denaturation at 95°C for 5 minutes; 95°C for 15 seconds, 60°C for 15 seconds, 72°C for 32 seconds, cycle 40 times; melting curve: 60°C-95°C.

[0101] The primers were synthesized by Guangzhou Aik Biotechnology Co., Ltd.; see Table 5 for details.

[0102] Table 5

[0103] Name Sequence SEQ ID NO: hIL-6-qF CACACAGACAGCCACTCACC 15 hIL-6-qR TTTTCTGCCAGTGCCTCTTT 16 hIL-1β-qF TTACAG-TGGCAATGAGGATGAC 17 hIL-1β-qR GTCGGAGATTCGTAGCTGGAT 18 hARG-1-qF GGTTTTTGTTGTTGCGGTGTTC 19 hARG-1-qR CTGGGATACTGATGGTGGGATGT 20 hCD206-qF GGGTTGCTATCACTCTCTATGC 21 hCD206-qR TTTCTTGTCTGTTGCCGTAGTT 22 hGAPDH-qF GAAGATGGTGATGGGATTTC 23 hGAPDH-qR GAAGGTGAAGGTCGGAGTC 24

[0104] Finally, the RT-qPCR data were analyzed: all detections were repeated three times with three biological samples, each biological sample was detected three times, the internal reference gene GAPDH was used, and 2 -△△Ct Data processing was performed, and Graphpad was plotted.

[0105] The RT-qPCR results are shown in Table 6. Figure 7As shown in FIG. 6A, the results showed that hsa_circ_0003258 significantly reduced the gene expression level of IL-1β, IL-6 in M1 macrophages, and up-regulated the gene expression level of ARG-1 and CD206, while M1 macrophages with knockdown of hsa_circ_0003258 showed opposite results.

[0106] The expression of CD86 was detected by immunostaining.

[0107] The results of immunostaining are shown in FIG. 6B. Figure 7 As shown in FIG. 6A, the results showed that hsa_circ_0003258 significantly reduced the gene expression level of IL-1β, IL-6 in M1 macrophages, and up-regulated the gene expression level of ARG-1 and CD206, while M1 macrophages with knockdown of hsa_circ_0003258 showed opposite results.

[0108] The levels of pro-inflammatory cytokines (IL-1β and IL-6) in the supernatant of M1 macrophages in each group were detected by Elisa.

[0109] The results are shown in FIG. 6C. Figure 7 As shown in FIG. 6B, the results showed that hsa_circ_0003258 could down-regulate the levels of pro-inflammatory cytokines (IL-1β and IL-6) in the supernatant of M1 macrophages, while M1 macrophages with knockdown of hsa_circ_0003258 showed opposite results.

[0110] The expression levels of inflammatory proteins (KLF4, Arg-1, CD206 and CD68) were detected by western blot.

[0111] The results are shown in FIG. 6D. Figure 7 As shown in FIG. 6D, the results showed that hsa_circ_0003258 significantly reduced the expression of inflammatory protein CD68 in M1 macrophages, and up-regulated the protein levels of anti-inflammatory proteins KLF4, Arg-1 and CD206, while M1 macrophages with knockdown of hsa_circ_0003258 showed opposite results.

[0112] The above results confirmed that hsa_circ_0003258 had the effect of inhibiting inflammation of macrophages.

[0113] Example 7: Experiment of changing the level of hsa_circ_0003258 in human primary hepatocytes

[0114] 1.25 x 10 5Human primary hepatocytes (isolated from the adjacent normal tissue of human primary liver cancer, provided by Guangzhou First People's Hospital. This research was approved by the Research Ethics Committee of Guangzhou First People's Hospital, and the ethics approval number was k-2019-167) were seeded in 6-well plates and divided into groups according to the requirements of the experiment. After the above groups were not subjected to or subjected to hypoxia-reoxygenation (1% oxygen hypoxia culture for 12 hours, followed by normoxic culture for 6 hours), detection was performed. The specific grouping and treatment are as follows:

[0115] Table 6

[0116] Grouping Transfection Hypoxia-reoxygenation Control group (Sham) × × HR × √ circ si NC group Transfection of 100 nM siRNA NC × circ si group Transfection of 100 nM siRNA specific for hsa_circ_0003258 × circ si+HR group Transfection of 100 nM siRNA specific for hsa_circ_0003258 √ circ OE NC group Transfection of NC lentivirus, MOI value = 50 × circ OE group Transfection of hsa_circ_0003258 overexpression lentivirus, MOI value = 50 × circ OE+HR group Transfection of hsa_circ_0003258 overexpression lentivirus, MOI value = 50 √

[0117] Among them, the overexpression hsa_circ_0003258 lentivirus, hsa_circ_0003258 specific siRNA and negative control (circ si-NC and circ OE-NC) for cell experiment transfection were designed by Guangzhou Jisai Biological Technology Co., Ltd. The transfection kit was Lipofectamine TM 3000 Reagent, (Thermo Fisher), and the transfection method referred to the instruction manual.

[0118] The cells in each group were collected, and total RNA was extracted using RNAiso Plus (Takara, 9109) according to the instructions, and was reversely converted into cDNA. The obtained cDNA was used for RT-qPCR experiment to detect the expression of hsa_circ_0003258, apoptosis-related genes (Bax, Caspase 3) and liver function-related genes (ALB, HGF). The reverse transcription of mRNA and circRNA and the RT-qPCR system were the same as in Example 6.

[0119] Among them, the related primers were synthesized by Guangzhou Aik Biotechnology Co., Ltd.; see Table 7 for details.

[0120] Table 7

[0121] Name Sequence SEQ ID NO: hBax-qF CCCGAGAGGTCTTTTTCCGAG 25 hBax-qR CCAGCCCATGATGGTTCTGAT 26 hCasapse 3-qF TTCAGAGGGGATCGTTGTAGAAGTC 27 hCasapse 3-qR CAAGCTTGTCGGCATACTGTTTCA 28 hALB-qF CTGCCTGCCTGTTGCCAAAGC 29 hALB-qR GGCAAGGTCCGCCCTGTCATC 30 hHGF-qF ATTGCCCTATTTCTCGTTGTG 31 hHGF-qR GCATTTCTCATCTCCTCTTCC 32 hGAPDH-qF GAAGATGGTGATGGGATTTC 33 hGAPDH-qR GAAGGTGAAGGTCGGAGTC 34

[0122] Finally, RT-qPCR data analysis was performed: all detections were repeated with three biological samples, each biological sample was detected three times, the internal reference gene was used, and 2 -△△Ct Data processing was performed, and Graphpad was plotted.

[0123] Figure 8 It was shown that after transfection of hsa_circ_0003258 specific siRNA and overexpression of hsa_circ_0003258 lentivirus, the expression level of hsa_circ_0003258 in human primary hepatocytes was significantly down-regulated / up-regulated.

[0124] Figure 9 The middle A shows that hsa_circ_0003258 can effectively inhibit the expression of apoptosis-related genes (Bax, Caspase 3) in hypoxia-reoxygenation treated hepatocytes, and up-regulate the level of liver function related genes (ALB, HGF).

[0125] In addition, the cells in each group were collected, Annexin V-PE and 7-AAD were added, mixed and incubated in the dark for 8-10 min, pre-cooled 1x Binding Buffer was added, mixed and then detected by flow cytometry.

[0126] Cell flow cytometry results Figure 9 The middle B further shows that overexpression of hsa_circ_0003258 can significantly reduce the proportion of apoptotic cells (Annexin + 7-AAD - and Annexin + 7-AAD + ) in hypoxia-reoxygenation treated hepatocytes. Hepatocytes with knockdown of hsa_circ_0003258 showed the opposite results. The above results confirm that hsa_circ_0003258 has the effect of inhibiting hepatocyte apoptosis and improving hepatocyte function.

[0127] The above detailed description has described the present application in detail, but the present application is not limited to the above examples, and various changes can be made within the scope of knowledge possessed by those skilled in the art without departing from the purpose of the present application. In addition, the embodiments of the present application and the features in the embodiments can be combined with each other without conflict.

Claims

1. Application of reagents for detecting hsa_circ_0003258 expression levels in the preparation of diagnostic products for liver ischemia-reperfusion injury; The expression level of hsa_circ_0003258 was significantly reduced in the plasma of patients with hepatic ischemia-reperfusion.

2. The application according to claim 1, characterized in that, The reagents include those suitable for at least one of the following methods: fluorescent dye method, nucleic acid amplification technology, resonance light scattering method, sequencing or biomolecular mass spectrometry.

3. The application according to claim 2, wherein the reagent comprises a probe or primer capable of specifically binding to hsa_circ_0003258 or the cDNA corresponding to hsa_circ_0003258.

4. The application according to claim 3, wherein the primer sequence is: F1: 5'-CATGAAAACACACACTGCAC-3'; R1: 5'-TCCAGAATGCTGCAAGGAGT -3'.

5. The application according to claim 1, wherein the product is a reagent kit, chip, test strip, or reagent.

6. Application of the reagent for promoting hsa_circ_0003258 expression in the preparation of drugs for treating hepatic ischemia-reperfusion injury; The hsa_circ_0003258 expression promoter is an hsa_circ_0003258 overexpression lentivirus.

7. The application according to claim 6, characterized in that, The drug contains pharmaceutical excipients.

8. The application according to claim 7, characterized in that, The excipients include at least one of the following: diluent, binder, wetting agent, lubricant, disintegrant, emulsifier, cosolvent, solubilizer, preservative, pH adjuster, osmotic pressure adjuster, coating material, antioxidant, and antibacterial agent.

9. The application according to claim 6, characterized in that, The dosage form of the drug includes at least one of the following: suspension, granules, capsules, powders, tablets, emulsions, solutions, pills, suppositories, enemas, aerosols, patches, or drops.

10. The application according to claim 6, characterized in that, The route of administration of the drug includes at least one of the following: intravenous injection, intraperitoneal injection, intramuscular injection, subcutaneous injection, oral administration, sublingual administration, nasal administration, nebulized administration, or transdermal administration.

Images