Application of inhibitor of Hnf4 alpha os gene in targeted liver macrophage in preparation of medicine for preventing and treating liver ischemia-reperfusion injury
By using an siRNA inhibitor targeting the Hnf4αos gene in liver macrophages, combined with lipid nanoparticles and DS-targeting molecules, specific knockout of the Hnf4αos gene was achieved. This solved the problem of poor targeting of inflammatory response and mitochondrial oxidative stress in HIRI, enabling precise regulation of immune metabolism and improving the prevention and treatment of liver ischemia-reperfusion injury.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2026-02-10
- Publication Date
- 2026-04-10
AI Technical Summary
Existing technologies struggle to simultaneously target the core processes of macrophage-mediated inflammatory responses and mitochondrial oxidative stress, failing to achieve integrated and precise regulation of immune metabolism, resulting in poor prevention and treatment of liver ischemia-reperfusion injury (HIRI).
By employing siRNA inhibitors targeting the Hnf4αos gene in liver macrophages, and loading them onto lipid nanoparticles, the Hnf4αos gene is specifically knocked down or eliminated. Combined with DS-targeting molecules and fluorescent materials, selective recognition and uptake of M1 macrophages are achieved, enhancing mitochondrial stress resistance and promoting M2 polarization.
It significantly improves liver ischemia-reperfusion injury, reduces hepatocellular damage, decreases inflammatory cell infiltration and inflammatory factor levels, enhances macrophage stress resistance, promotes M2 polarization, and alleviates liver tissue structural and functional damage.
Smart Images

Figure CN121818696A_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of biomedical technology, specifically involving targeting liver macrophages. Hnf4αos Application of gene inhibitors in the preparation of drugs for the prevention and treatment of hepatic ischemia-reperfusion injury. Background Technology
[0002] Hepatic ischemia-reperfusion injury (HIRI) is a common and serious complication in liver transplantation, partial hepatectomy, liver trauma repair, and hepatic blood flow occlusion surgery. Its pathological process involves hypoxic energy metabolism disorders during the ischemic phase and a cascade amplification of oxidative stress and inflammatory responses during the reperfusion phase. This can induce hepatocyte apoptosis, necrosis, and immune cascade reactions, leading to poor postoperative outcomes such as liver dysfunction, graft injury, and acute and chronic rejection. Although basic and clinical research on HIRI has made some progress, its complex and incompletely elucidated pathological mechanisms mean that effective prevention and treatment measures are still lacking, becoming a key bottleneck restricting the improvement of prognoses in liver surgery.
[0003] Current intervention strategies for hepatic inflammatory response (HIRI) mainly include ischemic preconditioning, antioxidant drug therapy, immunosuppressant intervention, and anti-inflammatory therapy. These measures mostly act on downstream links of inflammatory responses or oxidative stress, and suffer from problems such as insufficient target specificity, unclear mechanisms of action, and unstable intervention effects. On the one hand, Kupffer cells (KCs), the innate immune cells of the liver, play a core role in HIRI. Their overactivation and release of pro-inflammatory cytokines and M1-type pro-inflammatory polarization exacerbate tissue damage. However, current technologies mostly intervene through broad-spectrum immunosuppression or systemic anti-inflammatory drugs, which cannot achieve selective regulation of specific macrophage subsets and easily interfere with the body's normal immune function. On the other hand, mitochondrial oxidative stress is a key link in the early damage of HIRI. Traditional antioxidant therapy cannot accurately target mitochondria, the main source of ROS, and cannot effectively reverse mitochondrial dysfunction. In addition, current technologies lack systematic regulation of the "macrophage immune response-mitochondrial metabolic imbalance" pathological axis, and the drugs have poor targeting and insufficient local enrichment. Most studies are still at the basic stage, lacking translatable precision intervention technologies, making it difficult to block the pathological process of HIRI at its source.
[0004] In summary, existing HIRI prevention and treatment technologies struggle to simultaneously target the core processes of macrophage-mediated inflammatory responses and mitochondrial oxidative stress, failing to achieve integrated and precise regulation of immune metabolism. Therefore, developing novel intervention methods capable of precisely regulating hepatic macrophage immune function and polarization, and improving mitochondrial metabolic homeostasis, is a crucial need to overcome the bottlenecks in HIRI prevention and treatment and improve the prognosis of liver surgery. Summary of the Invention
[0005] Based on this, the purpose of this invention is to provide a new strategy for early and precise intervention of HIRI by specifically regulating the expression of the Hnf4αos gene in liver macrophages. This is expected to block the vicious cycle of inflammation and oxidative stress from the source and bring new directions to the prevention and treatment of HIRI.
[0006] To achieve the above objectives, the present invention can adopt the following technical solutions: This invention provides a method for targeting liver macrophages. Hnf4αos The application of gene inhibitors in the preparation of drugs for preventing and treating liver ischemia-reperfusion injury, wherein the inhibitors target and inhibit hepatic macrophages. Hnf4αos The siRNA of the gene, the nucleotide sequence of the siRNA is shown in SEQ ID NO:1. Preferably, in the above applications, the inhibitor targets and inhibits hepatic macrophages. Hnf4αos The gene's siRNA is loaded via lipid nanoparticles.
[0007] More preferably, in the above applications, the inhibitor targets and inhibits hepatic macrophages. Hnf4αos The preparation methods for siRNA of genes, siRNA loaded onto lipid nanoparticles, and inhibitors include: (1) DSPE-TK-PEG2000, DPPC and DOTAP were dissolved in chloroform and evaporated under reduced pressure to obtain a lipid film; (2) The lipid film was hydrated and then emulsified with perfluoropentane to obtain cationic nanoparticles; (3) Inhibitors were obtained by combining cationic nanoparticles and siRNA.
[0008] More preferably, in the above applications, the mass ratio of DSPE-TK-PEG2000, DPPC and DOTAP is (68-72):(23-27):(3-7).
[0009] More preferably, in the above applications, the mass ratio of cationic nanoparticles to siRNA is (9-11):1.
[0010] More preferably, in the above applications, the inhibitor targets and inhibits hepatic macrophages. Hnf4αos The gene's siRNA is loaded via lipid nanoparticles, which also carry DS-targeting molecules.
[0011] More preferably, in the above applications, the inhibitor targets and inhibits hepatic macrophages. Hnf4αos The siRNA of the gene is loaded onto lipid nanoparticles, which also load DS-targeting molecules. Methods for preparing the inhibitor include: (1) DSPE-TK-PEG2000, DPPC and DOTAP were dissolved in chloroform and evaporated under reduced pressure to obtain a lipid film; (2) The lipid film was hydrated and then emulsified with perfluoropentane to obtain cationic nanoparticles; (3) Composite cationic nanoparticles were obtained by co-incubating cationic nanoparticles with DS-targeting molecules; (4) Inhibitors were obtained by combining composite cationic nanoparticles and siRNA.
[0012] More preferably, in the above applications, the mass ratio of the composite cationic nanoparticles to siRNA is (9-11):1.
[0013] More preferably, in the above applications, the inhibitor targets and inhibits hepatic macrophages. Hnf4αos The gene's siRNA is loaded via lipid nanoparticles, which are also loaded with fluorescent materials.
[0014] More preferably, in the above applications, the inhibitor targets and inhibits hepatic macrophages. Hnf4αos The gene's siRNA is loaded via lipid nanoparticles, which also load DS-targeting molecules and fluorescent materials.
[0015] Preferably, in the above applications, the drug for preventing liver ischemia-reperfusion injury has one or more of the following effects: (a) It has the effect of reducing the degree of hepatocellular damage after hepatic ischemia-reperfusion injury; or (b) It has the effect of reducing inflammatory cell infiltration and / or inflammatory factor levels after hepatic ischemia-reperfusion injury; or (c) It promotes M2 polarization of hepatic macrophages after hepatic ischemia-reperfusion injury and inhibits pro-inflammatory responses; or (d) It has the effect of enhancing the stress resistance of liver macrophage mitochondria.
[0016] Preferably, in the above applications, the dosage form of the drug for preventing liver ischemia-reperfusion injury is an injection, oral liquid, powder, tablet or capsule.
[0017] The beneficial effects of this invention include: By specifically knocking down or eliminating cells targeting liver macrophages, this invention... Hnf4 αos Genes, thereby inhibiting Hnf4αos Gene expression can significantly improve liver ischemia-reperfusion injury (HIRI) model-related damage; specifically, specific knockdown or knockout of genes targeting liver macrophages. Hnf4αosGenes can alleviate hepatocellular damage following hepatic ischemia-reperfusion injury, reduce inflammatory cell infiltration and inflammatory factor levels, promote M2 polarization of hepatic macrophages, inhibit pro-inflammatory responses, and enhance the stress resistance of hepatic macrophage mitochondria. This means that genes can be specifically knocked down or eliminated from hepatic macrophages. Hnf4αos Gene reagent (targeting liver macrophages) Hnf4αos Gene inhibitors are used in the preparation of drugs to prevent and treat liver ischemia-reperfusion injury. Attached Figure Description
[0018] Figure 1 This is the structural formula of PSh@L / TD NPs in this invention; Figure 2 Scanning electron microscope (SEM) images of PSh@L / TD NPs prepared for the example; Figure 3 Histograms of Zeta potentials (surface charges) for different nanoparticles prepared for the examples; Figure 4 Dynamic light scattering (DLS) particle size distribution curves of different nanoparticles prepared for the examples; Figure 5 Bar chart showing the average particle size of different nanoparticles prepared for the examples; Figure 6 Gel electrophoresis of PSh@L / TD NPs prepared for the example; Figure 7 The siRNA transfection efficiency of PSh@L / TD NPs prepared for this example Figure 8 Fluorescence intensity was detected by flow cytometry for different nanoparticles (with fluorescent labels) prepared for the example. Figure 9 The fluorescence of P@L / TD NPs (with fluorescent labeling) prepared for this example in macrophages; Figure 10 The effect of P@L / TD NPs (with fluorescent labeling) prepared for the example on the ratio of M1 / M2 macrophages; Figure 11 HE staining of major organs in mice treated with different nanoparticles; Figure 12 Heatmaps of blood biochemistry and routine blood parameters in mice treated with different nanoparticles; Figure 13 The in vivo performance of P@L / TD NPs and P@L / TK NPs (with fluorescent labeling) prepared for the examples in mice; Figure 14Fluorescence of P@L / TD NPs and P@L / TK NPs (with fluorescent labels) prepared for the examples in isolated organs; Figure 15 Fluorescence of P@L / TD NPs and P@L / TK NPs (with fluorescent labeling) prepared for the examples in the tumor region; Figure 16 The fluorescence quantitative analysis of P@L / TD NPs and P@L / TK NPs (with fluorescent labels) prepared for the examples in the tumor region; Figure 17 The average photoacoustic imaging contrast of P@L / TD NPs and P@L / TK NPs (with fluorescent labels) prepared for the examples under different laser powers; Figure 18 HE staining of mouse liver tissue treated with PSh@L / TD NPs and PSC@L / TD NPs prepared for the example; Figure 19 Serum ALT levels in mice treated with PSh@L / TD NPs and PSC@L / TD NPs prepared for this example; Figure 20 The serum AST levels of mice treated with PSh@L / TD NPs and PSC@L / TD NPs prepared for this example; Figure 21 The expression of serum-related proteins in mice treated with PSh@L / TD NPs and PSC@L / TD NPs prepared for the example. Detailed Implementation
[0019] The embodiments described are provided to better illustrate the present invention, but are not intended to limit the scope of the invention to the embodiments described. Therefore, non-essential improvements and adjustments made to the embodiments by those skilled in the art based on the above description are still within the scope of protection of the present invention.
[0020] The terminology used herein is for the purpose of describing particular embodiments only and is not intended to limit this disclosure. Singular expressions include plural expressions unless they have a distinct meaning in the context. As used herein, it should be understood that terms such as “comprising,” “having,” “including,” are intended to indicate the presence of features, numbers, operations, components, parts, elements, materials, or combinations thereof. The terminology of the invention is disclosed in the specification and is not intended to exclude the possibility that one or more other features, numbers, operations, components, parts, elements, materials, or combinations thereof may be present or added. As used herein, “ / ” may be interpreted as “and” or “or,” depending on the context.
[0021] In a first aspect, embodiments of the present invention provide a method for targeting liver macrophages. Hnf4αos The application of gene inhibitors in the preparation of drugs for preventing and treating liver ischemia-reperfusion injury, wherein the inhibitors target and inhibit hepatic macrophages. Hnf4αos The siRNA of the gene, the nucleotide sequence of the siRNA is shown in SEQ ID NO:1. It should be noted that in this invention, the target is specifically knocked down or eliminated from liver macrophages. Hnf4αos Genes, thereby inhibiting Hnf4αos Gene expression can significantly improve liver ischemia-reperfusion injury (HIRI) model damage. Specifically, this invention proposes a novel immunometabolic regulation technique targeting lncRNA-Hnf4αos as the core target, addressing a key upstream link in the pathogenesis of HIRI. By constructing a mouse Kupffer cell-specific Hnf4αos knockout model and combining single-cell transcriptomics and functional validation, the key regulatory role of Hnf4αos in macrophage immunophenotype and mitochondrial homeostasis in HIRI was revealed. Furthermore, molecular biology techniques confirmed that silencing the Hnf4αos gene promotes mitochondrial fusion and oxidative phosphorylation, maintains mitochondrial membrane potential and mitochondrial energy metabolism, and clears abnormally accumulated ROS; it significantly reduces the release of pro-inflammatory cytokines, inhibits aseptic inflammatory responses, and induces macrophage polarization from M1 to M2, promoting a shift in the immune microenvironment from a pro-inflammatory to a repair-oriented state, thereby effectively alleviating the structural and functional damage to liver tissue caused by I / R. Compared with existing technologies, this invention targets the pathological source of HIRI at the molecular level, and has the dual functions of immune response regulation and mitochondrial homeostasis maintenance, overcoming the limitations of traditional antioxidant or anti-inflammatory treatments that only act on downstream links, have poor targeting, and unstable efficacy.
[0022] It should also be noted that targeted knockdown or elimination of liver macrophages Hnf4αos The gene editing reagents are well-known in the field, such as those based on CRISPR gene editing technology; in addition, the inhibitors are those that target and inhibit liver macrophages. Hnf4αos The gene's siRNA has the following nucleotide sequence as shown in SEQ ID NO:1: CCACCACGCAGACAAGAAATT.
[0023] In some specific examples, the siRNA in the above applications is loaded via lipid nanoparticles.
[0024] It should be noted that the inhibitor in this invention can be lipid nanoparticles loaded with siRNA. That is, siRNA, as an effective active ingredient, is loaded onto lipid nanoparticles through electrostatic adsorption, encapsulation, or other methods, which can improve the in vivo stability and uptake efficiency of siRNA. In addition, lipid nanoparticles are known in the art.
[0025] In some specific examples, in the above applications, siRNA is loaded onto lipid nanoparticles, and the methods for preparing the inhibitors include: (1) DSPE-TK-PEG2000, DPPC and DOTAP were dissolved in chloroform and evaporated under reduced pressure to obtain a lipid film; (2) The lipid film was hydrated and then emulsified with perfluoropentane (PFP) to obtain cationic nanoparticles; (3) Inhibitors were obtained by combining cationic nanoparticles and siRNA.
[0026] It should be noted that this invention introduces a PFP phase transition core to achieve gas-liquid phase transition under low-intensity focused ultrasound (LIFU), enabling ultrasound-triggered on-demand release and enhanced imaging. Furthermore, utilizing the pathological characteristic of elevated ROS in ischemic lesions, NHS-TK-NHS is used as a thioketal cleavage bond, allowing the nanoparticles to undergo specific degradation and release under ROS conditions. Experimental results show that this nanosystem possesses good biocompatibility and exhibits higher targeting, persistence, and imaging enhancement capabilities in the inflammatory microenvironment, providing a novel solution superior to existing technologies for the early diagnosis and precision treatment of HIRI.
[0027] In some specific examples, the mass ratio of DSPE-TK-PEG2000, DPPC and DOTAP in the above applications is (68-72):(23-27):(3-7).
[0028] In some specific examples, the mass ratio of cationic nanoparticles to siRNA in the above applications is (9-11):1.
[0029] It should be noted that in the above method for preparing the inhibitor (lipid nanoparticles loaded with siRNA), the mass ratio of cationic nanoparticles to siRNA can preferably be (9-11):1, such as 9.5:1, 10:1 or 10.5:1, etc. The siRNA inhibition rate of the lipid nanoparticles containing siRNA prepared in this ratio is better.
[0030] In some specific examples, in the above applications, the inhibitor targets and inhibits hepatic macrophages. Hnf4αos The gene's siRNA is loaded via lipid nanoparticles, which also carry DS-targeting molecules.
[0031] It should be noted that, as mentioned above, the present invention can also endow lipid nanoparticles with the ability to selectively recognize and take up M1 macrophages through DS-targeting molecule modification, thus solving the technical problem of existing carriers lacking immune cell targeting.
[0032] In addition, the DS-targeting molecules are well known in the field, as described in the literature "Subcellular Distribution of Prussian Blue Nanozymes Dictates Enzymatic Activity and Macrophage Polarization for Effective Colitis Therapy" and "One stone three birds: Andrographis paniculata-derived exosome-like nanoparticles mitigate dextransulfate sodium-induced colitis".
[0033] It should be noted that this invention can also endow lipid nanoparticles with the selective recognition and uptake ability of M1 macrophages through DS-targeting molecule modification, solving the technical problem of the lack of immune cell targeting in existing carriers. Under the above structural synergy, the lipid nanoparticles of this invention realize a triple response mechanism of "exogenous LIFU control + endogenous ROS induction + M1 macrophage targeting", which not only improves the in vivo stability and tissue accumulation capacity of siHnf4αos, but also significantly enhances the local release efficiency in the ischemia-reperfusion liver, and can simultaneously obtain phase transition ultrasound imaging signals, realizing the integration of treatment and diagnosis.
[0034] In some specific examples, in the above applications, siRNA is loaded via lipid nanoparticles, which also load DS-targeting molecules. The methods for preparing the inhibitors include: (1) DSPE-TK-PEG2000, DPPC and DOTAP were dissolved in chloroform and evaporated under reduced pressure to obtain a lipid film; (2) The lipid film was hydrated and then emulsified with perfluoropentane to obtain cationic nanoparticles; (3) Composite cationic nanoparticles were obtained by co-incubating cationic nanoparticles with DS-targeting molecules; (4) Inhibitors were obtained by combining composite cationic nanoparticles and siRNA.
[0035] In some specific examples, the mass ratio of the composite cationic nanoparticles to siRNA in the above applications is (9-11):1.
[0036] In some specific examples, in the above applications, the inhibitor targets and inhibits hepatic macrophages. Hnf4αos The gene's siRNA is loaded via lipid nanoparticles, which are also loaded with fluorescent materials.
[0037] It should be noted that, as mentioned above, in order to detect the application of the drug in vivo, fluorescent materials can be added to the lipid nanoparticles in this invention. Furthermore, the fluorescent materials are well-known in the art, such as DiI (lipophilic membrane dye), DiR (lipophilic near-infrared fluorescent dye (emission wavelength ~780nm)), FITC-glucan, or Cy5.5-labeled peptides / antibodies, etc.
[0038] In some specific examples, in the above applications, the inhibitor targets and inhibits hepatic macrophages. Hnf4αos The gene's siRNA is loaded via lipid nanoparticles, which also load DS-targeting molecules and fluorescent materials.
[0039] It should be noted that, in addition to loading siRNA and DS-targeting molecules, lipid nanoparticles can also contain fluorescent materials, the selection of which is as described above.
[0040] In some specific examples, in the above applications, drugs for preventing hepatic ischemia-reperfusion injury have one or more of the following effects: (a) It has the effect of reducing the degree of hepatocellular damage after hepatic ischemia-reperfusion injury; or (b) It has the effect of reducing inflammatory cell infiltration and / or inflammatory factor levels after hepatic ischemia-reperfusion injury; or (c) It promotes M2 polarization of hepatic macrophages after hepatic ischemia-reperfusion injury and inhibits pro-inflammatory responses; or (d) It has the effect of enhancing the stress resistance of liver macrophage mitochondria.
[0041] In some specific examples, in the above applications, the dosage forms of drugs for preventing liver ischemia-reperfusion injury are injections, oral liquids, powders, tablets, or capsules.
[0042] It should be noted that the dosage form of the drug for preventing liver ischemia-reperfusion injury in this invention is a dosage form known in the art, including but not limited to the dosage forms listed above. Furthermore, the preparation methods of the dosage forms listed above are known in the art.
[0043] To better understand the present invention, specific examples are provided below to further illustrate the content of the present invention, but the content of the present invention is not limited to the examples below.
[0044] In the following example, the HE staining steps are as follows: (1) Plaster-embedded sections of mouse liver tissue were baked in a 60℃ oven for 60 minutes; (2) Dewaxing of paraffin sections: The sections were placed in xylene, anhydrous ethanol, 90% ethanol, 85% ethanol and 80% ethanol in sequence for dewaxing; (3) After staining with hematoxylin for 10 minutes, rinse gently with running water for 5 minutes to remove residual color; (4) After the 0.7% hydrochloric acid alcohol has been separated for 1-2 seconds, rinse gently with running water; (5) Soak in 80% ethanol for 30-60 seconds, then soak in eosin for 5 seconds, and then soak in 80% ethanol for 5 seconds; (6) After air drying, apply 1-2 drops of neutral resin to the slide and observe after drying; By observing the cytoplasmic fading, vacuolization, nuclear condensation, nuclear fragmentation, nuclear dissolution, and erythrocyte stasis of liver tissue in the H&E staining results, the results were analyzed and scored by categorizing them as no findings (0 points), mild (1 point), moderate (2 points), and severe (3 points).
[0045] In the following example, the Western blot analysis steps are as follows: (1) Calculate the loading volume required for loading 30 mg of protein based on the measured protein concentration; (2) Add tissue and cell proteins to the corresponding concentration of pre-prepared SDS-PAGE gel for electrophoresis separation (electrophoresis is performed under the conditions of stacking gel 80V and separating gel 120V). (3) After the target protein band is separated, stop electrophoresis and perform electroporation at 200mA for 3 hours using a "sandwich" structure of sponge, filter paper, gel, NC membrane, filter paper, and sponge. (4) After electroporation, block with 5% skim milk at room temperature for 1 hour, then perform antigen-antibody reaction with the corresponding concentration of specific primary antibody, incubate at room temperature for 1 hour, and then transfer the band to a 4°C refrigerator and shake overnight. (5) The next day, place the strip on a horizontal shaker and shake it at room temperature for 1 hour; (6) Wash the strip thoroughly with PBST for 30 minutes (10 minutes at a time, for a total of 30 minutes); (7) Then incubate with the corresponding species' fluorescent secondary antibody at room temperature in the dark for 1 hour; (8) Then wash thoroughly for 30 minutes using the same method; (9) Visualize and analyze proteins using the Odyssey imaging system.
[0046] In the following example, macrophages were analyzed by flow cytometry: Collected macrophages were incubated in PBS containing 2% FBS at 4 °C for 30 min with anti-CD11b-APC, anti-CD206-APC, and anti-CD86-FITC antibodies. After washing, they were analyzed using a flow cytometer (e.g., BD FACSCanto II), with at least 10,000 cellular events collected per sample. Data were analyzed using FlowJo software (v10.8.1), and biomarker expression was expressed as mean fluorescence intensity (MFI) or percentage of positive cells.
[0047] Example 1 (I) Preparation of Nanoparticles (1) Preparation of dual-response nanoparticles (1-1) Synthesis of DSPE-TK-PEG 2000 NH 2- PEG 2000 100 mg of NHS-TK-NHS (N-hydroxysuccinimide-ketothiol-N-hydroxysuccinimide, 3.0 equivalents) and triethylamine (2.0 equivalents) were reacted in 5 mL of CHCl3 solvent at room temperature for 30 min. The solvent was then removed by rotary evaporation under reduced pressure to obtain the crude product. The crude product was purified by recrystallization with ethanol and precipitation with ice ether, and then dried under vacuum to obtain NHS-TK-PEG2000. NHS-TK-PEG2000 (100 mg), DSPE-NH2 (1.0 equivalents) and triethylamine (2.0 equivalents) were dissolved together in 10 mL of CHCl3 solution and reacted with stirring at room temperature for 30 min. After removing the solvent and precipitating with ice ether, the product was dried under vacuum to obtain the final product DSPE-TK-PEG2000.
[0048] (1-2) Preparation of cationic nanoparticles (P@L / TK NPs) DPPC (dispalmitoylphosphatidylcholine) (12 mg), DSPE-TK-PEG2000 (4 mg), and DOTAP (1,2-dioleoyl-3-trimethylammonium propane (chloride)) (4 mg) were dissolved in 20 mL of chloroform (CHCl3) and evaporated under reduced pressure for 1 h on a rotary evaporator (YINOTAI) to form a uniform lipid film. The lipid film was then hydrated with 4 mL of PBS, and 400 μL of perfluoropentane (PFP) pre-cooled in an ice bath was added to obtain a suspension. The resulting suspension was placed in an ice-water bath and emulsified using a probe-type sonicator (Sonics & Materials) for 5 min (60 W, 5 s on / 5 s off cycle) to obtain a nano-suspension. The emulsified nano-suspension was centrifuged at 8000 rpm and 4°C for 10 min, and this step was repeated three times to obtain purified cationic nanoparticles (P@L / TK NPs).
[0049] (1-3) Preparation of dual-response nanoparticles To construct a dual-response siRNA-targeted phase transition nanoprobe, 10 mg of DS (dextran sulfate) was added to a cationic nanoparticle suspension (10 mg nanoparticles, concentration 2.5 mg / mL), and the suspension was incubated on an ice bath shaker for 1 h to achieve electrostatic adsorption and obtain nanoparticles P@L / TD NPs. Subsequently, the particles P@L / TD NPs were mixed with siRNA (control siRNA (as shown in SEQ ID NO:2, specific sequence: UUCUCCGAACGUGUCACGUTT) or effective siRNA (as shown in SEQ ID NO:1, specific sequence: CCACCACGCAGACAAGAAATT)) at a mass ratio of 10:1, washed, and resuspended in 5 mL PBS to obtain dual-response nanoparticles PSC@L / TD NPs (control siRNA) and PSH@L / TD NPs (effective siRNA), respectively.
[0050] (2) Preparation of fluorescently labeled dual-response nanoparticles The preparation method of fluorescently labeled dual-response nanoparticles is roughly the same as the preparation method of dual-response nanoparticles in (1) above. The difference is that 0.5 mg of DiI (1,1′-octadecyl-3,3,3′,3′-tetramethylindocyanine iodide) was added during the preparation of the lipid film in step (1-2). Specifically, DiI (0.5 mg), DPPC (dispalmitoylphosphatidylcholine) (12 mg), DSPE-TK-PEG2000 (4 mg), and DOTAP (1,2-dioleoyl-3-trimethylammonium propane (chloride)) (4 mg) were dissolved in 20 mL of chloroform (CHCl3) and evaporated under reduced pressure for 1 h on a rotary evaporator (YINOTAI) to form a uniform lipid film. The rest is the same as the preparation method in (1) above. Fluorescently labeled dual-response nanoparticles were prepared.
[0051] (II) Nanoparticle Characterization Tests The structural formula of the PSh@L / TD NPs prepared in (1) above is as follows: Figure 1 As shown.
[0052] The scanning electron microscope (SEM) image of the PSh@L / TD NPs prepared in (1) above is as follows: Figure 2 As shown in the results, PSh@L / TD NPs all exhibit a regular spherical structure with a smooth surface and no obvious aggregation, indicating that the prepared nanoparticles have good dispersibility. This regular spherical morphology and good dispersibility are important prerequisites for their stable particle size and excellent biological functions, verifying the success of the nanoparticle preparation from a microscopic morphology perspective.
[0053] The Zeta potential (surface charge) histograms of the P@L / TK NPs, P@L / TD NPs and PSH@L / TD NPs prepared in (1) above are shown in the figure below. Figure 3 As shown, the results indicate that all three types of particles exhibit specific charge properties. The differences in zeta potential reflect the different surface charge densities of the three particles, directly affecting their stability in solution and their electrostatic binding ability to siRNA.
[0054] The dynamic light scattering (DLS) particle size distribution curves of the P@L / TK NPs, P@L / TD NPs and PSH@L / TD NPs prepared in (1) above are shown in the figure below. Figure 4As shown, the horizontal axis represents particle size (nm), and the vertical axis represents particle size distribution intensity. The curves reveal that the particle size distribution peaks of the three nanoparticles are narrow and symmetrical, indicating good particle size uniformity for each type of particle. The peak positions on the curves represent the reference values for the average particle size of the corresponding nanoparticles. Comparison of these curves allows for a preliminary assessment of the relative sizes of the three nanoparticles' average particle sizes, laying the foundation for quantitative comparison of average particle sizes. Furthermore, the uniformity of particle size distribution ensures the reliability of subsequent biological experimental results.
[0055] The average particle size histograms of the P@L / TK NPs, P@L / TD NPs and PSH@L / TD NPs prepared in (1) above are shown below. Figure 5 As shown in the figure, the specific values and relative differences in the average particle size of the three types of nanoparticles are clearly presented. Among them, PSh@L / TD NPs have the highest column height, indicating that their average particle size is the largest. P@L / TK NPs and P@L / TD NPs have similar particle sizes. Average particle size is a core physical parameter of nanoparticles, and its size directly affects the cellular uptake efficiency of the particles (generally, particles of suitable size are more easily uptaken by cells), providing a physical parameter-level explanation for the subsequent differences in transfection efficiency.
[0056] (III) Nanoparticle Performance Testing The PSh@L / TD NPs prepared in (1) above were subjected to gel electrophoresis to test the encapsulation ability of the nanoparticles on siRNA. The results are as follows: Figure 6 As shown, the results indicate that the presence and intensity of nucleic acid fluorescent bands qualitatively demonstrate the encapsulation ability of nanoparticles on siRNA. Nanoparticles can effectively encapsulate siRNA through electrostatic interaction, preventing its migration in an electric field. At the same time, subtle differences in band intensity among different particles at the same mass ratio can be observed, preliminarily suggesting the relative strength of their encapsulation ability.
[0057] The siRNA transfection efficiency of the PSh@L / TD NPs and PSh@L / TK NPs (obtained by loading effective siRNA onto P@L / TK NPs according to the method in (1) above) prepared above was tested respectively, as follows: P@L / TDNPs of different concentrations (0.254 mg / mL, 0.54 mg / mL, 14 mg / mL, 24 mg / mL and 4 mg / mL) were co-incubated with 1OD siRNA for 20 min, and then centrifuged at 4°C and 8000×rpm for 5 min; in order to detect the siRNA release performance of PSh@L / TDNPs, the RNA concentration in the supernatant under the combined stimulation of LIFU and ROS was measured for evaluation. The specific testing method is as follows: Nanoparticles were dissolved in 6 mL of deionized water, 100 μmol of hydrogen peroxide was added, and the solution was irradiated with LIFU (power: 2 W / cm², focal length 1.5 cm, duty cycle 50%, pulsed wave mode) for 3 minutes. At 0, 1 h, 2 h, 4 h, 8 h, 12 h, 24 h, and 36 h, 1 mL of the solution was collected, and the RNA concentration was detected using a nanodrop2000 instrument to calculate the ROS / LIFU-induced siRNA release efficiency. The test results are as follows: Figure 7 As shown in the results, the relative expression level of siRNA after transfection with PSH@L / TD NPs was the lowest, indicating that it had the best gene silencing effect and the highest transfection efficiency.
[0058] The P@L / TKNPs, P@L / TDNPs, and PSH@L / TDNPs prepared in (2) above were used for targeting tests by detecting fluorescence intensity using flow cytometry. The specific steps are as follows: To evaluate the macrophage targeting ability of P@L / TD nanoparticles, these nanoparticles were labeled with DiI fluorescein dye; in vitro, RAW264.7 cells were induced to form different macrophage phenotypes (M1 type: stimulated with 100 ng / mL lipopolysaccharide (LPS) and 20 ng / mL interferon-γ (IFN-γ) for 24 hours; M2 type: stimulated with 20 ng / mL interleukin-4 (IL-4) for 24 hours); the uptake of P@L / TD nanoparticles by macrophages was evaluated by flow cytometry. The detection results are as follows. Figure 8 As shown in the figure, the results show that in the PSh@L / TDNPs figure, V1L (0.33%) indicates that only 0.33% of the particles have weak fluorescence intensity, while V1R (99.67%) indicates that almost all particles have strong fluorescence intensity, indicating that the group (PSh@L / TDNPs) has the highest fluorescence labeling efficiency.
[0059] In addition, the uptake of P@L / TD nanoparticles by macrophages was assessed using confocal microscopy. The results are as follows: Figure 9 As shown in the figure, the results indicate that the fluorescence signal of M2 macrophages (blue) gradually increased over time, while the signal of M1 macrophages (red) decreased, suggesting that the nanomaterial can induce macrophages to polarize towards the anti-inflammatory M2 phenotype, indicating its immunomodulatory potential. Furthermore, quantitative statistical analysis of the fluorescence signals was performed, and a curve showing the change in the M1 / M2 macrophage ratio over time was plotted, as shown in the figure. Figure 10 As shown, the results indicate that the proportion of M2 macrophages increased significantly over time, while the proportion of M1 macrophages decreased, consistent with the imaging results, quantitatively confirming the M2 polarization effect of macrophages induced by nanomaterials.
[0060] (iv) In vivo testing of nanoparticles Eight-week-old mice (C57BL / 6, male, 20g) were randomly divided into four groups: saline (NSS), P@L / TKNPs, P@L / TDNPs, and PSH@L / TDNPs, with three mice in each group. The NSS group was injected with sterile saline (1mL), while the P@L / TKNPs, P@L / TDNPs, and PSH@L / TDNPs groups were administered the corresponding nanoparticle suspensions (100μL, 750μg / mL) prepared in (1) via the tail vein. Four weeks after administration, peripheral blood was collected for routine hematological tests, and serum biochemical indicators were evaluated using standard kits. The mice were then sacrificed, and major organs such as the heart, liver, spleen, lungs, and kidneys were removed for histopathological evaluation by HE staining.
[0061] HE staining of major organs in mice from different treatment groups are as follows: Figure 11 As shown, the results indicate that, compared with the NSS group, the P@L / TK NPs group, P@L / TD NPs group, and PSH@L / TD NPs group did not show obvious pathological damage (such as inflammatory infiltration, cell necrosis, and structural destruction), indicating that the nanomaterial has no significant acute toxicity to major organs at the experimental dose.
[0062] In addition, heatmaps of blood biochemistry and routine blood parameters of mice in different treatment groups (obtained using a Toshiba fully automated biochemical analyzer for serum measurement) are shown below. Figure 12 As shown, the results indicate that the P@L / TK NPs group, P@L / TD NPs group, and PSH@L / TD NPs group showed no significant abnormal fluctuations compared to the NSS group, further verifying the biosafety of the nanomaterial and that it did not cause significant abnormalities in liver and kidney function or the blood system.
[0063] In addition, the fluorescently labeled P@L / TK NPs and P@L / TD NPs prepared in (2) above were tested in vivo according to the above method; specifically as follows: (a) The biodistribution of P@L / TK NPs and P@L / TD NPs in mice at different time points (0h–72h) after administration was tracked, and the results are as follows: Figure 13 As shown, the results indicate that the signal mainly accumulates in the liver, spleen, and tumor sites. Furthermore, the fluorescence signal at the tumor sites gradually increases over time, indicating that the nanomaterials have the characteristic of passively targeting tumors and are metabolized slowly and have a long retention time in vivo.
[0064] (b) Ex vivo fluorescence imaging was performed on major organs (kidney, lung, spleen, liver, and heart) to verify the in vivo imaging results. The results are as follows: Figure 14 As shown, the results indicate that the fluorescence intensity distribution of the ex vivo organs is consistent with that of the in vivo imaging, further confirming that the nanomaterials are mainly enriched in the liver, spleen and tumor tissues, and that the tumor targeting of P@BL / TD NPs is significantly better than that of the control group PL / TD NPs.
[0065] (c) Using lasers of different power densities (0–4 W / cm²) 2 Irradiate the tumor site and acquire photoacoustic signal images. The results are as follows: Figure 15 As shown, the results indicate that the photoacoustic signal intensity in the tumor area is significantly enhanced with increasing laser power, and the signal of the P@BL / TDNPs group is significantly stronger than that of the control group, indicating that the nanomaterial has a good photoacoustic imaging enhancement effect, and the effect is positively correlated with the laser dose.
[0066] (d) Quantitatively analyze the photoacoustic signal intensity of the liver at different time points (0-72h), and the results are as follows: Figure 16 As shown, the results indicate that the signal of the P@BL / TD NPs group reached its peak at 24h and remained at a high level, while the signal of the control group decayed rapidly, indicating that the nanomaterial has a longer retention time in the liver and a more durable photoacoustic imaging effect.
[0067] (e) Calculate the mean photoacoustic imaging contrast under different laser powers, and the results are as follows: Figure 17 As shown, the results indicate that the contrast of the P@BL / TD NPs group increased significantly with increasing laser power and was significantly higher than that of the control group, proving that the nanomaterial can significantly improve the contrast of liver in photoacoustic imaging and has excellent imaging performance.
[0068] (V) In vivo detection of HIRI efficacy using dual-response siHnf4αos nanoprobes Mice (8-12 weeks old, C57BL / 6, 20g) were divided into two groups: the PSH@L / TDNPs group and the PSC@L / TDNPs group, with 3 mice in each group. 48 hours before the establishment of the liver ischemia-reperfusion model, the mice in each group were injected via tail vein with the corresponding nanoparticle suspension prepared in (1) above (the amount of nanoparticles was 30mg / kg and the concentration of the nanoparticle suspension was 750μg / mL).
[0069] A mouse liver I / R model was then constructed (the left and middle lobes of the liver were clamped for 75 minutes, followed by reperfusion for 6 hours after the clamps were released). The specific construction was as follows: 48 hours after drug administration, mice in each group were anesthetized after a 12-hour fast. The middle and left lobes of the liver were exposed after abdominal surgery. The hepatic pedicle (the branches of the portal vein and hepatic artery) was meticulously dissected and freed under a dissecting microscope. Next, the blood vessels were blocked using non-invasive sutures with silicone tubing or micro-arterial clamps. At this point, the target liver lobe rapidly turned dark red or purplish-black, indicating the onset of ischemia, which was typically maintained for 75 minutes. After the predetermined time, the clamps were quickly released to restore blood flow. The liver color returned to bright red within 1-2 minutes, completing reperfusion. Finally, the abdomen was closed layer by layer, and the mice were placed on a 37°C warming pad for resuscitation and postoperative care was provided. To verify the success of the model, serum ALT and AST levels were collected at 0, 3, 6, 12, and 24 hours after reperfusion to detect elevated levels (indicating successful modeling). Liver tissue was also stained with hematoxylin and eosin (HE) to observe cell necrosis and inflammatory infiltration. At the same time, a sham surgery group (Sham, mice that only undergo laparotomy and closure but do not have their blood vessels clamped) must be set up as a control group; the entire operation must be carried out under constant temperature conditions and strictly follow the aseptic principle.
[0070] After LIFU (3W / cm) 2 After irradiation (the ischemic phase of the ischemia-reperfusion model was completed, and the peritoneal cavity was closed before irradiation), mouse liver histology and serology were performed 6 hours after reperfusion to evaluate the therapeutic effect of siRNA-loaded mice.
[0071] HE staining of liver tissue from each group of mice is as follows: Figure 18 As shown, the results indicate that PSh@L / TDNPs can significantly alleviate I / R-induced structural damage to liver tissue.
[0072] In addition, the ALT level (Jianglai Biotechnology, Mouse Aspartate Aminotransferase (AST) ELISA Detection Kit (JL13992-48T)) and AST level (Jianglai Biotechnology, Mouse Alanine Aminotransferase (ALT) ELISA Detection Kit (JL12668-48T)) in mouse serum were detected using kits according to the kit instructions. The detection methods were as follows. The results are shown below. Figure 19 and Figure 20As shown in the results, the serum ALT and AST levels of mice in each group decreased significantly, indicating a significant improvement in functional protection.
[0073] In addition, the expression levels of related proteins in the serum of mice in each group (detected using Western blot experiments) are as follows: Figure 21 As shown, the results indicated that with prolonged time, the expression of pro-apoptotic proteins (BAX, Cleaved-Caspase3) increased and the expression of anti-apoptotic protein (BCL-2) decreased in the experimental group, indicating that the nanoparticles could induce apoptosis. The expression of p-IRE1α and p-eIF2α increased with time, indicating that the endoplasmic reticulum stress pathway was activated. The expression of p-IκBα and p-P65 increased, indicating that the NF-κB inflammatory pathway was activated. The above data showed that the PSh@L / TDNPs group was significantly more effective than PSC@L / TDNPs, indicating that the nanoparticles loaded with effective siRNA (as shown in SEQ ID NO:1) had significant effects in inducing apoptosis, activating endoplasmic reticulum stress, and inflammation.
[0074] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention and not to limit it. Although the present invention has been described in detail with reference to preferred embodiments, those skilled in the art should understand that modifications or equivalent substitutions can be made to the technical solutions of the present invention without departing from the spirit and scope of the technical solutions of the present invention, and all such modifications or substitutions should be covered within the scope of the claims of the present invention.
Claims
1. Targeting liver macrophages Hnf4αos The application of gene inhibitors in the preparation of drugs for preventing and treating liver ischemia-reperfusion injury, among which, Inhibitors target and inhibit hepatic macrophages Hnf4αos The siRNA of the gene, the nucleotide sequence of the siRNA is shown in SEQ ID NO:
1.
2. The application according to claim 1, characterized in that, siRNA is loaded via lipid nanoparticles.
3. The application according to claim 2, characterized in that, Methods for preparing inhibitors include: (1) DSPE-TK-PEG2000, DPPC and DOTAP were dissolved in chloroform and evaporated under reduced pressure to obtain a lipid film; (2) The lipid film was hydrated and then emulsified with perfluoropentane to obtain cationic nanoparticles; (3) Inhibitors were obtained by combining cationic nanoparticles and siRNA.
4. The application according to claim 2, characterized in that, The lipid nanoparticles are also loaded with DS-targeting molecules.
5. The application according to claim 4, characterized in that, Methods for preparing inhibitors include: (1) DSPE-TK-PEG2000, DPPC and DOTAP were dissolved in chloroform and evaporated under reduced pressure to obtain a lipid film; (2) The lipid film was hydrated and then emulsified with perfluoropentane to obtain cationic nanoparticles; (3) Composite cationic nanoparticles were obtained by co-incubating cationic nanoparticles with DS-targeting molecules; (4) Inhibitors were obtained by combining composite cationic nanoparticles and siRNA.
6. The application according to any one of claims 3 to 5, characterized in that, The mass ratio of DSPE-TK-PEG2000, DPPC and DOTAP is (68-72): (23-27): (3-7).
7. The application according to claim 3 or 5, characterized in that, The mass ratio of cationic nanoparticles to siRNA is (9-11):1; or The mass ratio of the composite cationic nanoparticles to siRNA was (9-11):
1.
8. The application according to any one of claims 2 to 5, characterized in that, The lipid nanoparticles also contain fluorescent materials.
9. The application according to any one of claims 1 to 5, characterized in that, Drugs for preventing and treating hepatic ischemia-reperfusion injury have one or more of the following effects: (a) It has the effect of reducing the degree of hepatocellular damage after hepatic ischemia-reperfusion injury; or (b) It has the effect of reducing inflammatory cell infiltration and / or inflammatory factor levels after hepatic ischemia-reperfusion injury; or (c) It promotes M2 polarization of hepatic macrophages after hepatic ischemia-reperfusion injury and inhibits pro-inflammatory responses; or (d) It has the effect of enhancing the stress resistance of liver macrophage mitochondria.
10. The application according to any one of claims 1 to 5, characterized in that, Drugs for preventing liver ischemia-reperfusion injury are available in the form of injections, oral liquids, powders, tablets, or capsules.