Molecular marker ms_chr4_73090327 related to stomatal density of alfalfa and application thereof

Abstract

The application belongs to the technical field of molecular markers, and discloses a molecular marker Ms_Chr4_73090327 related to stoma density of Medicago sativa and application. The application uses GWAS whole genome association analysis combined with molecular marker development to analyze the stoma density of Medicago sativa, and obtains an InDel molecular marker Ms_Chr4_73090327 which is closely linked to the stoma density, has polymorphism, is stable and reliable, at the 73090327 locus on the 4th chromosome of Medicago sativa, an insertion / deletion fragment TTTTCTTTCTTTGTTAGTAGAGTGTTTGGGA, and a primer pair corresponding to the molecular marker Ms_Chr4_73090327 is designed. The application further provides a method for rapidly identifying the stoma density of Medicago sativa by using the InDel molecular marker, which is simple and fast, accurate in identification result, and has a good application prospect.

Description

Technical Field

[0001] The invention belongs to the field of biotechnology, and particularly relates to a molecular marker Ms_Chr4_73090327 closely related to the stomatal density of alfalfa and an application thereof. Technical Background

[0002] Alfalfa (Medicago sativa L.) is a perennial forage crop rich in crude protein and amino acids, boasting high nutritional value, good palatability, and strong environmental adaptability, making it an excellent forage for livestock. Due to its excellent agronomic characteristics and outstanding economic value, particularly its high biomass yield and low production costs, it is widely cultivated in my country, primarily in northern my country and the Yangtze and Huaihe River basins. However, the arid climate, water shortages, and abiotic stresses such as soil salinization and low temperatures in northern China pose serious threats to the growth and development of alfalfa, thereby affecting its yield and quality. Therefore, strengthening research on stress-resistant alfalfa breeding is crucial to ensuring the long-term sustainable development of my country's animal husbandry.

[0003] Stomata, located on the surface of most plant leaves, are key structures for gas exchange and water transpiration, directly influencing photosynthesis, respiration, and water status. Under stressful conditions such as drought and high salinity, stomatal regulation is crucial for maintaining plant water balance and reducing evaporation. Studies across various species have shown that altering stomatal density can potentially improve plant survival in drought and other stressful conditions, thereby increasing alfalfa yield and quality. Plants with low stomatal density, through physiological and developmental adaptations, can maintain growth in variable environments. Reducing stomatal density helps plants reduce transpiration and maintain water balance under drought conditions, improving water use efficiency under non-stress conditions. Under high CO₂ conditions, plants reduce stomatal density to minimize water loss while maintaining photosynthesis. In response to heavy metal stress, plants reduce stomatal conductance and intercellular CO₂ concentration to reduce heavy metal absorption. Reducing stomatal density also affects photosynthesis and respiration, minimizing water loss while ensuring photosynthesis. Therefore, in the actual alfalfa breeding process, it is of great significance to select alfalfa materials with low stomatal density.

[0004] Genome-Wide Association Study (GWAS) can simultaneously detect genetic variations within large populations across the entire genome, thereby identifying key genes or sites associated with traits. Molecular markers are selected based on the association between genetic markers and target traits to identify individuals or genotypes with target traits. Currently, a large number of molecular markers have been successfully developed and applied to crop genetic breeding and genetic diversity analysis. Among them, InDel (insertion or deletion fragments in the genome) markers are designed with specific primers based on the sequences on both sides of the target site, and PCR amplification is performed to show polymorphism in the length of the amplified fragment. These markers have the characteristics of clear bands, strong stability, and economic convenience, and are being used in more and more crops.

[0005] Therefore, this study combined whole-genome association analysis to develop molecular markers related to stomatal density, which is one of the effective means to accelerate the breeding process of new alfalfa materials and is conducive to promoting the cultivation of new stress-resistant alfalfa varieties. Summary of the Invention

[0006] One of the objectives of the present invention is to provide an InDel molecular marker related to the stomatal density of alfalfa.

[0007] A second object of the present invention is to provide an application of the above-mentioned InDel molecular marker related to the stomatal density of alfalfa.

[0008] To achieve the above object, the present invention adopts the following technical solutions:

[0009] The stomatal density-related InDel molecular marker disclosed in the present invention is located on chromosome 4 of alfalfa, and the molecular marker is named Ms_Chr4_73090327.

[0010] The primer pair for amplifying the InDel molecular marker related to the stomatal density of alfalfa, the primer pair sequence corresponding to the molecular marker Ms_Chr4_73090327 is:

[0011] Ms_Chr4_73090327-F: CACTGCCAGCTTTGCTG (shown in SEQ ID NO. 1);

[0012] Ms_Chr4_73090327-R: GCTTCAAGGACTCACTTAAATAGTC (shown in SEQ ID NO. 2).

[0013] The present invention also discloses the use of the aforementioned molecular marker primer pair in molecular marker-assisted breeding related to stomatal density in alfalfa. Specifically, the molecular markers of the present invention can be used in future molecular marker-assisted breeding. By extracting DNA from seedling leaves and detecting the presence of the molecular markers of the present invention, the stomatal density of the alfalfa material can be identified, thereby determining the level of alfalfa stomatal density. The detection can be performed using PCR, specifically the aforementioned molecular marker primer pair. The detection can also be performed using sequencing.

[0014] The present invention also discloses the use of the above-mentioned molecular markers in identifying alfalfa stomatal density, particularly in screening and identifying alfalfa stomatal density. Specifically, the specific steps for identifying alfalfa stomatal density are as follows:

[0015] (1) The DNA of the test germplasm was used as a template for PCR amplification, and the primer pair corresponding to the molecular marker Ms_Chr4_73090327 was used for PCR amplification. The PCR amplification reaction system is shown in Table 1:

[0016] Table 1 PCR amplification reaction system

[0017]

[0018] Pre-denaturation at 94°C for 4 min; 40 cycles of denaturation at 94°C for 30 s, annealing at 55°C for 24 s, and extension at 72°C for 24 s; extension at 72°C for 10 min; and storage at 4°C.

[0019] (2) Agarose gel electrophoresis detection of PCR products: Take 2.5 μL and judge the stomatal density of alfalfa based on the results of the bands.

[0020] PCR amplification was performed using primer pairs Ms_Chr4_73090327-F and Ms_Chr4_73090327-R. If the PCR amplification product contained only one characteristic band of 250 bp in length as shown in SEQ ID NO. 4, the alfalfa was of a low stomatal density type; or if the PCR amplification product contained both one characteristic band of 250 bp in length as shown in SEQ ID NO. 4 and one characteristic band of 219 bp in length as shown in SEQ ID NO. 5, the alfalfa was of a high stomatal density type.

[0021] In addition, the present application also protects a kit for identifying the stoma density of Medicago sativa, wherein the kit comprises primer pair Ms_Chr4_73090327-F and Ms_Chr4_73090327-R. Other components of the kit belong to conventional reagents. Specifically, the kit further comprises 10x PCR Buffer, dNTP and Taq DNA polymerase. The present application does not have special limitations on the concentration of the primer pair, and the primer concentration known in the art can be used. The present application does not have special limitations on the source of the 10x PCR Buffer, dNTP and Taq DNA polymerase, and the common PCR amplification reagents known in the art can be used.

[0022] The kit of the present application can quickly identify the stoma density of Medicago sativa and can also quickly identify the stoma density genotype of Medicago sativa. The specific method is referred to the specific steps for identifying the stoma density of Medicago sativa, and the PCR amplification product is detected by electrophoresis and / or sequencing. If the PCR amplification product has only one characteristic band with a length of 250 bp as shown in SEQ ID NO. 4, then the Medicago sativa is a homozygous low stoma density genotype. If the PCR amplification product has both a characteristic band with a length of 250 bp as shown in SEQ ID NO. 4 and a characteristic band with a length of 219 bp as shown in SEQ ID NO. 5, then the Medicago sativa is a heterozygous high stoma density genotype.

[0023] The present application has the following advantages:

[0024] (1) The present application screens a molecular marker Ms_Chr4_73090327 related to the stoma density of Medicago sativa, which is located on chromosome 4. The molecular marker Ms_Chr4_73090327 of the present application can quickly identify the stoma density of Medicago sativa.

[0025] (2) The use of the marker linked to the stoma density for screening is beneficial to molecular marker-assisted selection breeding, which is simple and feasible, and is beneficial to improving the efficiency and saving the cost.

[0026] (3) The molecular marker of the present application has the characteristics of convenient detection, stable amplification product and high specificity, and can be simply, quickly and high-throughput applied to the practice of molecular marker-assisted breeding related to the stoma density of Medicago sativa and material identification. BRIEF DESCRIPTION OF DRAWINGS

[0027] Figure 1 The Manhattan plot obtained based on EMMAX software analysis is the whole genome association analysis result of the stoma density of Medicago sativa, and the red dots represent the InDel positions associated in the present application.

[0028] Figure 2 This is a boxplot of the stomatal density distribution corresponding to the genotype at the Ms_Chr4_73090327 locus in the alfalfa population described in Example 1. 0 / 0 indicates a homozygous low-stomatal density genotype at the Ms_Chr4_73090327 locus, and 0 / 1 indicates a heterozygous high-stomatal density genotype at the Ms_Chr4_73090327 locus. Circles represent extreme values ​​of the data, and **** indicates P < 0.0001.

[0029] Figure 3 This is the partial sequence alignment result of low pore density materials and high pore density materials in the pore density related region. Figure 4 This is the electrophoresis diagram of the molecular marker amplified at the Chr4_73090327 site of 20 alfalfa germplasm resources. The concentration of the agarose gel is 3%.

[0030] In the figure, M represents DNA marker. DETAILED DESCRIPTION

[0031] The present invention will be further described below with reference to specific examples, and the advantages and features of the present invention will become more apparent as the description proceeds. However, the specific experimental methods involved in the following examples, unless otherwise specified, are all conventional methods or are performed under the conditions recommended by the manufacturer's instructions.

[0032] Unless otherwise specified, the technical means used in the examples are conventional means well known to those skilled in the art. The experimental methods in the following examples are all conventional methods unless otherwise specified. Unless otherwise specified, the reagents and materials used can be purchased from the market.

[0033] Unless otherwise defined, all technical and scientific terms used herein have the same meanings as those familiar to those skilled in the art. Furthermore, any methods and materials similar or equivalent to those described herein can be applied to the present invention. The preferred embodiments and materials described herein are for illustrative purposes only.

[0034] Example 1 Development of molecular markers related to stomatal density in alfalfa

[0035] The present invention measures the stomatal density of alfalfa by the stomatal density at the initial flowering stage. The higher the value, the higher the stomatal density of the alfalfa material; the lower the value, the lower the stomatal density of the alfalfa material. The stomatal density of the alfalfa population at the initial flowering stage was measured, and through GWAS analysis, an InDel site was located in alfalfa ( Figure 1The red locus is named Ms_Chr4_73090327. This locus is located at the 73090327th locus on chromosome 4 of the alfalfa reference genome. The first allele type is 0 / 0; the second allele type is 0 / 1. The stomatal density distribution box plot corresponding to the genotype of the population Ms_Chr4_73090327 locus ( Figure 2 ), indicating that the stomatal density of alfalfa materials with genotype 0 / 1 was significantly different from that of alfalfa materials with genotype 0 / 0. At position 73090327 on chromosome 4 of alfalfa, the insertion / deletion fragment TTTTCTTTCTTTGTTAGTAGAGTGTTTGGGA (shown in SEQ ID NO.3) ( Figure 3 ), which has an impact on the stomatal density of alfalfa. The alfalfa with the fragment shown in SEQ ID NO.3 inserted is a low-stomatal density alfalfa; the alfalfa without the fragment shown in SEQ ID NO.3 is a high-stomatal density alfalfa.

[0036] Based on the InDel variant and its upstream and downstream sequences, the following primers were designed using SnapGene:

[0037] Ms_Chr4_73090327-F: CACTGCCAGCTTTGCTG (shown in SEQ ID NO. 1);

[0038] Ms_Chr4_73090327-R: GCTTCAAGGACTCACTTAAATAGTC (shown in SEQ ID NO. 2).

[0039] PCR amplification of the test samples using this primer showed that the PCR product of the homozygous alfalfa material with low stomatal density had only a characteristic band of 250bp, while the PCR product of the heterozygous alfalfa material with high stomatal density had both a characteristic band of 250bp and a characteristic band of 219bp.

[0040] Example 2 Verification of the Accuracy of the Molecular Markers Described in the Present Invention

[0041] 233 germplasms were identified, and the specific germplasm materials used are shown in Table 2:

[0042] Table 2 Stomatal density at initial flowering stage and genotypes corresponding to Chr4_73090327 locus of 233 germplasm materials

[0043]

[0044]

[0045]

[0046]

[0047] 1) using the genomic DNA of alfalfa to be identified as a template, performing PCR amplification using the primer pair to obtain a PCR product;

[0048] The PCR amplification reaction system is as follows: 10-100 ng of template DNA, 1 μL of 10 μM forward primer, 1 μL of 10 μM reverse primer, 10 μL of 2× TaqPCR Master Mix, and deionized water to 20 μL. The PCR amplification reaction procedure is preferably as follows: pre-denaturation at 94°C for 4 min, followed by 40 cycles of denaturation at 94°C for 30 s, annealing at 55°C for 24 s, and extension at 72°C for 20 s, followed by extension at 72°C for 10 min, and storage at 4°C. Separation was performed by electrophoresis on a 3% agarose gel, and after spotting, electrophoresis was conducted at 120 V DC for 60 min. PCR banding patterns for each sample were then determined.

[0049] 2) judging the stomatal density of alfalfa based on the size of the PCR product: when the fragment shown in SEQ ID NO. 3 is missing from the PCR product of the alfalfa to be identified, the alfalfa to be identified is alfalfa with a high stomatal density;

[0050] When the fragment shown in SEQ ID NO. 3 is inserted into the PCR product of the alfalfa to be identified, the alfalfa to be identified is alfalfa with low stomatal density;

[0051] Specifically, when the fragment shown in SEQ ID NO. 3 is inserted into the PCR product of the alfalfa to be identified, the band length of the PCR product is 250 bp (SEQ ID NO. 4), then the alfalfa to be identified is a homozygous low stomatal density alfalfa.

[0052] The sequence of SEQ ID NO.4 is as follows:

[0053]

[0054] When the PCR product of the alfalfa to be identified is two bands, namely a band in which the fragment shown in SEQ ID NO.3 is inserted and a band in which the fragment shown in SEQ ID NO.3 is deleted, and one of the PCR product bands is 250 bp (SEQ ID NO.4) in length and the other is 219 bp (SEQ ID NO.5), then the alfalfa to be identified is a hybrid alfalfa with high stomatal density.

[0055] The sequence of SEQ ID NO.5 is as follows:

[0056]

[0057] Furthermore, as shown in Table 2, 160 alfalfa materials were identified in this study with a genotype of 0 / 0 at the Chr4_73090327 locus. The average stomatal density of these 160 alfalfa materials was 239.03 per mm. 2 , which is a low stomatal density type alfalfa; 73 alfalfa materials have a genotype of 0 / 1 at the Chr4_73090327 locus. The average stomatal density of these 73 alfalfa materials is 255.63 / mm 2 , which is a type of alfalfa with high stomatal density. Variance analysis showed that the stomatal density of alfalfa with low stomatal density was significantly different from that of alfalfa with high stomatal density (P<0.0001). Twenty accessions ('PI631977', 'CF005594', 'Algonquin', 'Beilin 201', 'CF050248', 'Pioneer', 'CF050058', 'CF039769', 'CF040664', 'P610821619', 'Plato MS', 'Hulunbuir', 'CF031928', 'Wisfal', 'Gongnong 6', 'CF040403', 'CF048304', 'Arc', 'CF049890', and 'Zhonglan 2') were randomly selected and tested by PCR. The test results were consistent with the genotypes at the Chr4_73090327 locus and the actual stomatal density measurement results ( Figure 4 ), therefore, the InDel molecular marker of the present invention can effectively identify the high and low stomatal density of alfalfa and can be used for the prediction and screening of alfalfa materials with low stomatal density.

[0058] The embodiments described above are only preferred embodiments of the present invention and are only used to explain the present invention, not to limit the scope of implementation of the present invention. For those skilled in the art, it is of course possible to easily make other implementation methods by replacing or changing the technical content disclosed in this specification. Therefore, all changes and improvements made on the principles of the present invention should be included in the scope of the patent application of the present invention.

Claims

1. An InDel molecular marker related to stomatal density in alfalfa, characterized in that: The nucleotide sequence of the InDel molecular marker is shown in SEQ ID NO.4 or SEQ ID NO.

5. The molecular marker is an insertion / deletion fragment TTTTCTTTCTTTGTTAGTAGAGTGTTTGGGA on chromosome 4 of the alfalfa reference genome. The primer pair sequence corresponding to the InDel molecular marker is: F: CACTGCCAGCTTTGCTG; R:GCTTCAAGGACTCACTTAAATAGTC.

2. Use of the primer pair corresponding to the InDel molecular marker according to claim 1 in identifying or assisting in identifying the stomatal density of alfalfa.

3. The use according to claim 2, characterized in that The method for identifying the stomatal density of alfalfa comprises the following steps: (1) Extracting genomic DNA from alfalfa to be tested; (2) using the genomic DNA extracted in step (1) as a template, performing PCR amplification using the primer pair corresponding to the InDel molecular marker described in claim 1, and performing electrophoresis detection and / or sequencing on the PCR amplification product; (3) Determine based on the electrophoresis bands and / or sequencing results of step (2). The specific criteria are: PCR amplification is performed using the primer pair. If the PCR amplification product has only one characteristic band with a length of 250 bp as shown in SEQ ID NO.4, the alfalfa is a low stomatal density type; if the PCR amplification product has both a characteristic band with a length of 250 bp as shown in SEQ ID NO.4 and a characteristic band with a length of 219 bp as shown in SEQ ID NO.5, the alfalfa is a high stomatal density type.

4. A kit for identifying stomatal density genotypes of alfalfa, characterized in that: The kit comprises a primer pair corresponding to the InDel molecular marker according to claim 1.

5. The use according to claim 4, characterized in that The method for identifying the stomatal density genotype of alfalfa using the kit is as follows: (1) Extracting genomic DNA from alfalfa to be tested; (2) using the genomic DNA extracted in step (1) as a template, performing PCR amplification using the primer pair corresponding to the InDel molecular marker described in claim 1, and performing electrophoresis detection and / or sequencing on the PCR amplification product; (3) The PCR amplification products were subjected to electrophoresis detection and / or sequencing. If the PCR amplification product had only one characteristic band of 250 bp in length as shown in SEQ ID NO. 4, the alfalfa was a low stomatal density genotype; if the PCR amplification product had both one characteristic band of 250 bp in length as shown in SEQ ID NO. 4 and one characteristic band of 219 bp in length as shown in SEQ ID NO. 5, the alfalfa was a high stomatal density genotype.

Images