Dengue virus typing detection kit based on multiplex fluorescent quantitative PCR and detection method thereof
By designing a dengue virus typing kit based on multiplex real-time PCR, and utilizing specific probes and primers, the problem of insufficient sensitivity in existing detection methods was solved, enabling rapid and accurate typing detection of dengue virus.
Patent Information
- Application Number
- CN202411666160.X
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-11-20
- Publication Date
- 2025-11-18
- Estimated Expiration
- 2044-11-20
AI Technical Summary
Existing quantitative fluorescence detection methods lack sufficient sensitivity when detecting dengue virus, making it difficult to achieve rapid and accurate typing detection.
A dengue virus typing kit based on multiplex quantitative PCR was designed, including specific probes and primers. By optimizing the design of the fluorescent probes and the detection process, the sensitivity and accuracy of the detection were improved.
It achieves accurate and absolute quantitative typing of dengue virus types I-IV, improving detection efficiency and sensitivity. The detection time is only 4 hours, making it suitable for rapid detection of large numbers of samples.
Smart Images

Figure CN119433100B_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of molecular diagnostic biology technology, specifically to a dengue virus typing detection kit and detection method based on multiplex quantitative PCR. Background Technology
[0002] Dengue virus (DENV) belongs to the genus Flaviviridae in the family Flaviviridae. DENV was first isolated from human blood samples in Japan in 1943, and since then, it has been classified into four serotypes (DENV1-4) based on phylogenetic and epitope analysis. In China, all four serotypes of DENV have caused dengue fever outbreaks. DENV is carried and transmitted by mosquitoes of the genus Aedes, with Aedes aegypti being the primary vector. Dengue outbreaks in China are mainly transmitted by Aedes aegypti and Aedes albopictus; under suitable climatic conditions, imported DENV may infect vector populations. Symptoms of DENV infection typically include high fever, headache, vomiting, muscle and joint pain, and rash. In a small percentage of cases, the disease progresses to severe dengue hemorrhagic fever or dengue shock syndrome, leading to a high mortality rate. Currently, there is no specific vaccine or antiviral treatment for dengue virus.
[0003] Currently, the isolation and culture of DENV virus is an important indicator for virus identification. However, this method has a long incubation period and is not suitable for rapid virus isolation. Furthermore, virus isolation and culture can only identify live viruses, samples need to be kept at low temperatures during transportation, and the process is very time-consuming. Samples often have low viral loads, and cytopathic effects are often not obvious, requiring multiple blind passages, and the virus species is difficult to determine. The existing ELISA method can provide early diagnosis of dengue fever. This method has high sensitivity and specificity and is recommended by the World Health Organization as the gold standard for detecting mosquito-borne viruses. However, this technique requires a live host and live virus, and its high experimental safety requirements limit its application in ordinary laboratories.
[0004] Polymerase chain reaction (PCR) is a widely used molecular method for detecting and identifying pathogenic viruses. It is an in vitro enzymatic process that exponentially amplifies single or a few copies of DNA to thousands or millions of copies. Due to its speed, low cost, and simplicity, it has become one of the most widely used techniques in molecular biology. However, existing quantitative fluorescence detection methods suffer from insufficient sensitivity when detecting dengue virus.
[0005] In view of this, there is an urgent need for a new method to improve the sensitivity and accuracy of dengue virus detection. Summary of the Invention
[0006] In view of the technical problems existing in the background art, this application provides a dengue virus typing detection kit and detection method based on multiplex quantitative PCR, which significantly improves the sensitivity and accuracy of detection by optimizing the design of fluorescent probes and detection process.
[0007] In one aspect, embodiments of this application provide a dengue virus typing detection kit based on multiplex quantitative PCR, including multiplex PCR reaction solution, dengue virus positive control and negative control; the multiplex PCR reaction solution includes four specific probes and four pairs of specific primers for detecting dengue virus type I, dengue virus type II, dengue virus type III and dengue virus type IV respectively.
[0008] In the technical solution of this application embodiment, four non-interfering specific probes and four pairs of specific primers are designed for dengue virus types I-IV, which can accurately and absolutely quantify dengue virus types I-IV and improve detection efficiency.
[0009] In some embodiments, the four specific probes include:
[0010] Dengue virus type I probe as shown in SEQ ID NO:1:
[0011] SEQ ID NO: 1: CAGTTGATTGGGTCCCAACCAGC;
[0012] Dengue virus type II probe as shown in SEQ ID NO:2:
[0013] SEQ ID NO:2: TGGTGYTGCCGATCYTGCACATT;
[0014] Dengue virus type III probe as shown in SEQ ID NO:3:
[0015] SEQ ID NO:3: TGCGGAACCAGAAACACCCAACA;
[0016] Dengue virus type IV probe as shown in SEQ ID NO:4:
[0017] SEQ ID NO:4:ACCACCTTTTCAATATGCTGAAACGCG.
[0018] In this embodiment, by sequence alignment of dengue virus types I-IV genes, after screening conserved regions, and setting parameters such as temperature, length, and GC value, four specific probes targeting types I-IV genes were designed. Compared with conventional probes, this effectively improved specificity and had higher sensitivity.
[0019] In some embodiments, the 5' fluorescent reporter group of the dengue virus type I probe is VIC, and the 3' fluorescent quencher group is MGB, as specifically represented below:
[0020] 5'-VIC-CAGTTGATTGGGTCCCAACCAGC-MGB-3';
[0021] The 5' fluorescent reporter group of the dengue virus type II probe is Cy5, and the 3' fluorescent quencher group is MGB, as specifically represented below:
[0022] 5'-Cy5-TGGTGYTGCCGATCYTGCACATT-MGB-3';
[0023] The 5' fluorescent reporter group of the dengue virus type III probe is FAM, and the 3' fluorescent quencher group is MGB, as specifically represented below:
[0024] 5'-FAM-TGCGGAACCAGAAACACCCAACA-MGB-3';
[0025] The 5' fluorescent reporter group of the dengue virus type IV probe is ROX, and the 3' fluorescent quencher group is MGB, as specifically represented below:
[0026] 5'-ROX-ACCACCTTTTCAATATGCTGAAACGCG-MGB-3'.
[0027] In this embodiment, by specifically designing the 5' fluorescent reporter group and the 3' fluorescent quencher group of each probe, the detection efficiency and detection sensitivity can be further improved.
[0028] In some embodiments, the four pairs of specific primers include:
[0029] For example, the upstream primer for dengue virus type I shown in SEQ ID NO:5 and the downstream primer for dengue virus type I shown in SEQ ID NO:6:
[0030] SEQ ID NO:5: CTGTTCAGCCGTTCCAGTTG;
[0031] SEQ ID NO:6: TCCTCTATCCAAACCCTATTCCA;
[0032] For example, the upstream primer for dengue virus type II shown in SEQ ID NO:7 and the downstream primer for dengue virus type II shown in SEQ ID NO:8:
[0033] SEQ ID NO:7:TTCTGCGAAGGAACCACAGT;
[0034] SEQ ID NO:8:GTACCAGCATCCGTCCTCAC;
[0035] For example, the upstream primer for dengue virus types I and II shown in SEQ ID NO:9 and the downstream primer for dengue virus types I and II shown in SEQ ID NO:10:
[0036] SEQ ID NO:9: GACACACAGAAGACCCACCA;
[0037] SEQ ID NO:10: ATCCATGGTAAGCCCACGTTT;
[0038] For example, the upstream primer for dengue virus type IV shown in SEQ ID NO:11 and the downstream primer for dengue virus type IV shown in SEQ ID NO:12:
[0039] SEQ ID NO: 11: CCGACAAGGACAGTTCTAAA;
[0040] SEQ ID NO:12: GGTTGATACGCGGTTTTCCT;
[0041] The above sequences are all labeled in a 5'-3' format.
[0042] In this embodiment, based on the combined action of the four pairs of specific primers and four specific probes, dengue virus types I-IV can be specifically identified, and accurate quantitative typing of dengue virus types I-IV can be achieved, thereby improving detection efficiency and detection sensitivity.
[0043] In some embodiments, the dengue virus positive control includes positive control I, positive control II, positive control III, and positive control IV; positive control I is a plasmid solution carrying a dengue virus type I gene fragment; positive control II is a plasmid solution carrying a dengue virus type II gene fragment; positive control III is a plasmid solution carrying a dengue virus type III gene fragment; and positive control IV is a plasmid solution carrying a dengue virus type IV gene fragment.
[0044] In some embodiments, the negative control is nuclease-free water.
[0045] In some embodiments, the multiplex PCR reaction solution further includes 2×PerfeCT qPCR ToughMix UNG.
[0046] Secondly, embodiments of this application provide a method for dengue virus typing and quantitative detection based on multiplex quantitative PCR, comprising the following steps:
[0047] S1. Extract the RNA template from the sample to be tested, reverse it to a DNA template, and use it as the sample to be tested;
[0048] S2. Add the multiplex PCR reaction solution from the above kit to the sample to be tested to prepare the PCR mixture of the drug to be tested;
[0049] S3. Perform PCR amplification on the PCR mixture of the drugs to be tested;
[0050] S4. After completing the PCR amplification, read the fluorescence signal and calculate the copy number of dengue virus type I, dengue virus type II, dengue virus type III, and dengue virus type IV.
[0051] In the technical solution of this application embodiment, by using the above method, combined with external standards and standard curves, the four serotypes of dengue virus can be classified and quantitatively detected. The detection efficiency is high, it can be stably implemented, and it is simple and fast to operate. The detection time is only 4 hours, which is suitable for rapid detection of a large number of samples.
[0052] In some embodiments, the volume concentration of the test sample in the PCR mixture of the test drug is 20%; the concentration of dengue virus type I probe is 0.2 μM, and the concentrations of both the upstream and downstream primers of dengue virus type I are 0.2 μM; the concentration of dengue virus type II probe is 0.4 μM, and the concentrations of both the upstream and downstream primers of dengue virus type II are 0.1 μM; the concentration of dengue virus type III probe is 0.3 μM, and the concentrations of both the upstream and downstream primers of dengue virus type III are 0.1 μM; the concentration of dengue virus type IV probe is 0.2 μM, and the concentrations of both the upstream and downstream primers of dengue virus type IV are 0.1 μM.
[0053] In some embodiments, the annealing temperature is set to 60–63°C during the PCR amplification.
[0054] In the above embodiments, by controlling the primer concentration, probe concentration, and annealing temperature during the detection process, the sensitivity of the detection results can be improved.
[0055] The above description is only an overview of the technical solution of this application. In order to better understand the technical means of this application and to implement it in accordance with the contents of the specification, and to make the above and other objects, features and advantages of this application more obvious and understandable, the following are specific embodiments of this application. Attached Figure Description
[0056] To more clearly illustrate the technical solutions of this application, the accompanying drawings used in this application will be briefly described below. Obviously, the drawings described below are merely some embodiments of this application. For those skilled in the art, other drawings can be obtained from these drawings without any creative effort.
[0057] Figure 1 Results of primer concentration optimization for dengue virus types I-IV;
[0058] Figure 2 Results of probe concentration optimization for dengue virus types I-IV;
[0059] Figure 3 Results of optimized annealing temperatures for dengue virus types I-IV;
[0060] Figure 4 Standard curves for quantitative real-time PCR of dengue virus types I-IV;
[0061] Figure 5 The results are the real-time quantitative PCR amplification curves and PCR gel images of dengue virus types I-IV.
[0062] Figure 6 This is a bar chart showing the specific results for dengue virus types I-IV. Detailed Implementation
[0063] The embodiments of the technical solution of this application will now be described in detail with reference to the accompanying drawings. These embodiments are only used to more clearly illustrate the technical solution of this application and are therefore merely examples, and should not be used to limit the scope of protection of this application.
[0064] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this application pertains; the terminology used herein is for the purpose of describing particular embodiments only and is not intended to limit the application; the terms “comprising” and “having”, and any variations thereof, in the specification, claims, and foregoing description of the drawings are intended to cover non-exclusive inclusion.
[0065] In this document, the term "embodiment" means that a particular feature, structure, or characteristic described in connection with an embodiment may be included in at least one embodiment of this application. The appearance of this phrase in various places throughout the specification does not necessarily refer to the same embodiment, nor is it a separate or alternative embodiment mutually exclusive with other embodiments. It will be explicitly and implicitly understood by those skilled in the art that the embodiments described herein can be combined with other embodiments.
[0066] To address the low sensitivity and accuracy of existing dengue virus typing methods, this application designs four non-interfering specific probes and four pairs of specific primers targeting dengue virus types I-IV for precise and absolute quantitative typing of dengue virus types I-IV, thereby improving detection efficiency, sensitivity, and accuracy. Specific embodiments are described below. It should be noted that the embodiments described below are exemplary and are only used to explain this application, and should not be construed as limiting it. Where specific techniques or conditions are not specified in the embodiments, they should be performed according to the techniques or conditions described in the literature in this field or according to the product instructions. Reagents or instruments whose manufacturers are not specified are all commercially available conventional products.
[0067] Example 1
[0068] This embodiment provides a dengue virus genotyping detection kit based on multiplex quantitative PCR, including multiplex PCR reaction solution, dengue virus positive control, and negative control. The multiplex PCR reaction solution includes 2×PerfeCT qPCR ToughMix UNG, upstream and downstream primers for dengue virus type I, dengue virus type II, dengue virus type III, and dengue virus type IV, as well as probes for dengue virus type I, dengue virus type II, dengue virus type III, and dengue virus type IV, as detailed below:
[0069] Upstream primer for dengue virus type I: 5'-CTGTTCAGCCGTTCCAGTTG-3';
[0070] Downstream primer for dengue virus type I: 5'-TCCTCTATCCAAACCCTATTCCA-3';
[0071] Upstream primer for dengue virus type II: 5'-TTCTGCGAAGGAACCACAGT-3';
[0072] Downstream primer for dengue virus type II: 5'-GTACCAGCATCCGTCCTCAC-3';
[0073] Upstream primer for dengue virus type III: 5'-GACACACAGAAGACCCACCA-3';
[0074] Downstream primer for dengue virus type III: 5'-ATCCATGGTAAGCCCACGTTT-3';
[0075] Upstream primer for dengue virus type IV: 5'-CCGACAAGGACAGTTCTAAA-3';
[0076] Downstream primer for dengue virus type IV: 5'-GGTTGATACGCGGTTTCTCT-3';
[0077] Dengue virus type I probe: 5'-VIC-CAGTTGATTGGGTCCCAACCAGC-MGB-3';
[0078] Dengue virus type II probe: 5'-Cy5-TGGTGYTGCCGATCYTGCACATT-MGB-3';
[0079] Dengue virus type III probe:
[0080] 5'-FAM-TGCGGAACCAGAAACACCCAACA-MGB-3';
[0081] Dengue virus type IV probe:
[0082] 5'-ROX-ACCACCTTTTCAATATGCTGAAACGCG-MGB-3'.
[0083] The dengue virus positive control includes positive control I, positive control II, positive control III, and positive control IV; positive control I is a plasmid solution carrying a dengue virus type I gene fragment; positive control II is a plasmid solution carrying a dengue virus type II gene fragment; positive control III is a plasmid solution carrying a dengue virus type III gene fragment; and positive control IV is a plasmid solution carrying a dengue virus type IV gene fragment. The negative control is nuclease-free water.
[0084] Example 2
[0085] This embodiment provides the operating procedure and detection condition optimization method for dengue virus typing detection based on multiplex quantitative PCR, in order to obtain the optimal detection conditions and further improve the accuracy and sensitivity of the detection results.
[0086] First, this embodiment describes the construction and validation of standard plasmids. Virus was cultured and RNA extracted, followed by reverse transcription and amplification of the target gene. The amplification product was then detected, purified, and recovered to obtain the PCR product. The PCR product was then ligated into the PMD-19T vector system, transformed, and the plasmid was extracted to obtain the plasmid standard.
[0087] Next, sample preparation was performed: the product concentration of the plasmid standard was determined, and its copy number was calculated; after calculating the copy number, 2 μL was taken as the test sample, and a negative control was set up for each test. The formula for calculating the copy number is:
[0088] Product RNA copy number (copies / μL) = (6.02 × 10⁻⁶) 23 )×(purified product concentration ng / μL×10 -9 (RNALength × 340 Daltons / base)
[0089] Product DNA copy number (copies / μL) = (6.02 × 10⁻⁶) 23 )×(plasmid concentration ng / μL×10 -9 (DNALength × 660 Daltons / bases)
[0090] Among them, 6.02×10 23 is Avogadro's constant, DNA Length is the number of bases remaining in the target fragment after enzyme digestion, and 660 Daltons / base is the average molecular weight of each DNA base.
[0091] Next, the annealing temperature, primer working concentration, and probe working concentration were initially determined. The working concentrations of primers and probes for singleton fluorescence quantitative quantification were optimized according to the reaction array method. Singleton primers and probes were selected and diluted with nuclease-free water to an initial concentration of 20 μM. The amounts used are shown in Table 1. Sterile water was used as a negative control.
[0092] Table 1. Amounts of each reagent in the reaction system
[0093]
[0094] To investigate the effects of different annealing temperatures and primer and probe concentrations on PCR reactions, these two conditions were optimized to obtain the best reaction conditions and provide guidance for various reaction conditions in multiplex PCR. Specific optimization items are as follows:
[0095] (1) Adjust the annealing temperature and optimize it in 8 gradients (53.6℃~63.6℃).
[0096] (2) Adjust the primer concentration by adding (0.05μL to 0.2μL) to a 10μL system in four gradients for optimization.
[0097] (3) Adjust the probe concentration by adding (0.05μL~0.2μL) to a 10μL system in four gradients for optimization.
[0098] The experimental results are shown in Tables 2-1 to 2-5. The optimal temperatures for dengue virus type I (55.6℃, primer concentration 0.1μM, probe concentration 0.4μM), dengue virus type II (61.9℃, primer concentration 0.2μM, probe concentration 0.3μM), dengue virus type III (60.0℃, primer concentration 0.2μM, probe concentration 0.4μM), and dengue virus type IV (63.6℃, primer concentration 0.1μM, probe concentration 0.2μM) were determined using reaction arrays. These values differed significantly from neighboring values, necessitating further optimization.
[0099] Table 2-1 Optimization of DENV I-IV type annealing temperature
[0100]
[0101] Table 2-2 Optimization of DENV Type I primer and probe concentrations
[0102]
[0103] Table 2-3 Optimization of DENV II primer and probe concentrations
[0104]
[0105] Table 2-4 Optimization of DENVⅢ primer and probe concentrations
[0106]
[0107] Table 2-5 Optimization of DENVⅣ primer and probe concentrations
[0108]
[0109] Based on the results in Tables 2-1 to 2-5, primer concentration ranges (0.1-0.3 μM) and probe concentration ranges (0.2-0.4 μM) with lower CT values for four viral genotypes were selected. A single-factor analysis was performed, establishing 81 concentration combinations, and the optimal concentration ratio was selected. Six annealing temperature gradients (55.6℃–63.6℃) were then used for optimization. The optimized primer concentration, probe concentration, and annealing temperature results are shown below. Figures 1 to 3 As shown.
[0110] according to Figures 1 to 3 The results showed that the concentrations of dengue virus type I primers (0.2 μM, probe concentration 0.2 μM), dengue virus type II primers (0.1 μM, probe concentration 0.4 μM), dengue virus type III primers (0.1 μM, probe concentration 0.3 μM), and dengue virus type IV primers (0.1 μM, probe concentration 0.2 μM) were selected, and the annealing temperature was 61.9℃.
[0111] Based on the above optimization conditions, a concentration of 1×10⁻⁶ was selected. 0 ~1×10 10 Using standard plasmids of copies / μL as templates, a standard curve for real-time PCR was established, and the results are as follows: Figure 4 As shown in the figure. The X-axis represents the copy number logarithm of the plasmid standard, and the Y-axis represents the CT value detected by the plasmid standard.
[0112] Figure 4 In the DENVⅠ standard curve, Y = -3.0631X + 34.662, R0 2 =0.9935; DENVⅡ standard curve Y = -2.9208X + 33.47, R 2 =0.9906; DENVⅢ standard curve Y = -3.1838X + 36.887, R 2 =0.9903; DENVⅣ standard curve Y = -2.8961X + 33.622, R 2 =0.9923.
[0113] Example 3
[0114] This embodiment, based on the kit provided in Example 1, performs typing and quantitative detection of DENV type I-IV virus samples, including the following steps:
[0115] I. Materials and Methods
[0116] 1. Sample preparation and viral DNA acquisition
[0117] Sample preparation: All dengue virus type I-IV plasmid standards were constructed in our laboratory, and the plasmids were successfully bidirectionally sequenced by Qingke Biotechnology Co., Ltd. The method for preparing virus samples was as follows: Culture virus-susceptible cells at 25 cm⁻¹ 2 After the cells form a dense monolayer in the culture flask, they are inoculated with the virus, cultured until the virus proliferates, and then cell samples are collected.
[0118] Viral DNA Acquisition: RNA template was extracted using the Trizol method: Cells in each 6-well plate were lysed with 1 ml of Trizol reagent to extract RNA. The concentration of the extracted RNA was determined, and the following were added sequentially to a PCR tube: 2 μL of ABScript II Enzyme Mix (10X), 10 μL of ABScript II Reaction Mix (2X), 1 μL of 10 mM dNTPs, 2 μL of Primer, and 1 μg of RNA template. Water was then added to a final volume of 20 μL. The tube was incubated at 25°C for 5 min and then at 42°C for 1 h. The cDNA was collected and stored at 20°C for later use. 2 μL of cDNA was used as template DNA for the test samples. Positive and negative controls were included in each test.
[0119] 2. Prepare the PCR reaction system: Prepare the PCR reaction system according to the dosage shown in Table 3. The total volume of the reaction system is 10 μL.
[0120] Table 3 PCR reaction system
[0121]
[0122]
[0123] Add the PCR reaction mixture prepared using the above ratio to a 384-well plate and centrifuge briefly.
[0124] 3. Quantitative Real-Time PCR Amplification
[0125] Place the sealed PCR reaction plate in QuantStudio TM PCR amplification was performed using the Real-Time PCR Software amplification system. The quantitative PCR amplification reaction conditions were: incubation at 50℃ for 2 min, denaturation at 95℃ for 10 min; denaturation at 95℃ for 15 s, annealing at 61.9℃ for 1 min, for a total of 40 cycles.
[0126] 4. Read the fluorescence signal
[0127] After the PCR amplification reaction, in QuantStudio TM In the Real-Time PCR Software reading and analysis system, dengue virus types I, II, III, and IV were detected in the VIC, Cy5, FAM, and ROX channels, respectively, using the instrument's QuantStudio... TM Real-Time PCR Software was used for quantitative analysis to calculate the copy numbers of dengue virus type I, dengue virus type II, dengue virus type III, and dengue virus type IV.
[0128] II. Judgment of Results
[0129] 1. Quality control standards
[0130] Negative control: The negative control is defined as having no signal or a CT value ≥35 in the VIC, FAM, Cy5 and ROX channels.
[0131] Positive controls: Positive control I was detected in the VIC channel, indicating dengue virus type I; positive control II was detected in the Cy5 channel, indicating dengue virus type II; positive control III was detected in the FAM channel, indicating dengue virus type III; and positive control IV was detected in the ROX channel, indicating dengue virus type IV. Based on a quantitative fluorescence CT value <35, and using the instrument's QuantStudio... TM The Real-Time PCR Software was used to construct standard curves and calculate the copy numbers of dengue virus types I, II, III, and IV.
[0132] If either the positive or negative control fails to meet the standard, the test is invalid.
[0133] 2. Judgment Results
[0134] Standard curve:
[0135] A standard curve was plotted with the measured CT value of the standard sample on the ordinate and the logarithm of the copy number of the standard sample on the abscissa. Linear regression was then performed to obtain the regression equation.
[0136] Calculation of viral copy number in sample:
[0137] The CT value of the sample was measured and substituted into the regression equation of the standard curve to calculate the viral copy number in the sample. The results are shown in Table 4.
[0138] Table 4. DENV I-IV Virus Typing Detection
[0139]
[0140] Example 4
[0141] This embodiment tests the sensitivity, specificity, and repeatability of the kit provided in Example 1. The specific methods are as follows:
[0142] 1. Sensitivity test of the reagent kit
[0143] Based on the previously optimized conditions, a concentration of 1×10⁻⁶ was selected. 0 ~1×10 10 Using standard plasmids of copies / μL as templates, the sensitivity of each virus to quantitative real-time PCR was detected. Quantitative real-time PCR and conventional PCR experiments were performed simultaneously. Copy number results are shown in Table 5, and amplification curves and PCR gel images are shown below. Figure 5 As shown.
[0144] Table 5. Quantitative PCR and PCR Sensitivity of Dengue Virus Types I-IV
[0145]
[0146] As shown in Table 5, using the standard plasmid as a template, the limit of detection for DENVⅠ real-time PCR is 1×10⁻⁶. 0 copies / μL, the lowest detectable value for conventional PCR is 1×10⁻⁶ copies / μL. 1 copies / μL; the limit of detection for DENVⅡ quantitative PCR is 1×10⁻⁶ copies / μL; 0 copies / μL, the lowest detectable value for conventional PCR is 1×10⁻⁶ copies / μL. 2 copies / μL; the limit of detection for DENVⅢ quantitative PCR is 1×10⁻⁶ copies / μL; 0 copies / μL, the lowest detectable value for conventional PCR is 1×10⁻⁶ copies / μL. 0 copies / μL; the limit of detection for DENVⅣ quantitative PCR is 1×10⁻⁶ copies / μL; 0 copies / μL, the lowest detectable value for conventional PCR is 1×10⁻⁶ copies / μL. 5 The copies / μL indicates that the detection method provided in this application has a significantly lower limit of detection than conventional PCR, and thus exhibits higher sensitivity.
[0147] 2. Specificity test of the kit
[0148] Plasmid standards for dengue virus types I-IV, West Nile virus, yellow fever virus, Japanese encephalitis virus, Zika virus, vesicular stomatitis virus, Rift Valley fever virus, Chikungunya virus, Banna virus, and Geita virus were diluted to appropriate concentrations. DNA templates for dengue virus types I-IV, Zika virus, Japanese encephalitis virus, and vesicular stomatitis virus were obtained. The specificity of quantitative real-time PCR for the plasmid standards and viruses was detected. The average Ct values and copy numbers are shown in Table 6. The specificity results are illustrated in the bar chart below. Figure 6 As shown.
[0149] Table 6 Results of dengue virus type I-IV specificity tests
[0150]
[0151]
[0152] From Table 6 and Figure 6 It can be seen that, except for the target gene which has a low CT value, the other templates have high CT values or are not detected, indicating that the probe has good specificity.
[0153] 3. Repeatability test of the kit
[0154] Take a concentration of 1×10 8 copies / μL, 1×10 6copies / μL, 1×10 4 Using the standard sample of copies / μL as a template, repeatability tests were conducted, and the coefficients of variation within and between plates were calculated. The results are shown in Table 7.
[0155] Table 7 Repeatability Tests for Multiplex Quantitative PCR
[0156]
[0157] As shown in Table 7, the coefficient of variation within groups is between 0.22% and 1.55%, and the coefficient of variation between groups is between 0.34% and 2.31%, both less than 3%, indicating that the detection method provided in this application has good repeatability.
[0158] In summary, this application provides a dengue virus typing detection kit and method based on multiplex quantitative PCR, belonging to the field of molecular diagnostic biology technology. The multiplex quantitative PCR dengue virus typing detection kit includes a multiplex PCR reaction solution, a dengue virus positive control, and a negative control. The multiplex PCR reaction solution includes four specific probes and four pairs of specific primers for detecting dengue virus type I, dengue virus type II, dengue virus type III, and dengue virus type IV, respectively. Based on this kit, through sample processing, reaction system preparation, PCR amplification, fluorescence signal reading, and quantitative analysis, accurate quantitative detection of dengue virus typing and copy number can be achieved simply and efficiently. Furthermore, this application significantly improves the sensitivity and accuracy of detection by optimizing the design of the fluorescent probes and the detection process.
[0159] It should be noted that this application is not limited to the above-described embodiments. The above embodiments are merely examples, and any embodiments with the same structure and effect as the technical concept within the scope of this application are included in the technical scope of this application. Furthermore, various modifications that can be conceived by those skilled in the art to the embodiments, and other ways of constructing by combining some of the constituent elements of the embodiments, without departing from the spirit of this application, are also included in the scope of this application.
Claims
1. A dengue virus typing detection kit based on multiplex quantitative PCR, characterized in that, It includes a multiplex PCR reaction solution, a dengue virus positive control, and a negative control; the multiplex PCR reaction solution includes four specific probes and four pairs of specific primers for detecting dengue virus type I, dengue virus type II, dengue virus type III, and dengue virus type IV, respectively. The four specific probes include: As shown in SEQ ID NO:1, a dengue virus type I probe; Such as the dengue virus type II probe shown in SEQ ID NO:2; Such as the dengue virus type III probe shown in SEQ ID NO:3; Such as the dengue virus type IV probe shown in SEQ ID NO:4; The four pairs of specific primers include: For example, the dengue virus type I upstream primer shown in SEQ ID NO:5 and the dengue virus type I downstream primer shown in SEQ ID NO:6; For example, the upstream primer for dengue virus type II shown in SEQ ID NO:7 and the downstream primer for dengue virus type II shown in SEQ ID NO:8; For example, the upstream primer for dengue virus type III shown in SEQ ID NO:9 and the downstream primer for dengue virus type III shown in SEQ ID NO:10; The upstream primer for dengue virus type IV, as shown in SEQ ID NO:11, and the downstream primer for dengue virus type IV, as shown in SEQ ID NO:
12.
2. The dengue virus typing detection kit based on multiplex quantitative PCR according to claim 1, characterized in that, The 5' fluorescent reporter group of the dengue virus type I probe is VIC, and the 3' fluorescent quencher group is MGB. The 5' fluorescent reporter group of the dengue virus type II probe is Cy5, and the 3' fluorescent quencher group is MGB. The 5' fluorescent reporter group of the dengue virus type III probe is FAM, and the 3' fluorescent quencher group is MGB. The 5' end fluorescent reporter group of the dengue virus type IV probe is ROX, and the 3' end fluorescent quencher group is MGB.
3. The dengue virus typing detection kit based on multiplex quantitative PCR according to claim 1, characterized in that, The dengue virus positive control includes positive control I, positive control II, positive control III, and positive control IV; positive control I is a plasmid solution carrying a dengue virus type I gene fragment; positive control II is a plasmid solution carrying a dengue virus type II gene fragment; positive control III is a plasmid solution carrying a dengue virus type III gene fragment; and positive control IV is a plasmid solution carrying a dengue virus type IV gene fragment.
4. The dengue virus typing detection kit based on multiplex quantitative PCR according to claim 1, characterized in that, The negative control was nuclease-free water.
5. The dengue virus typing detection kit based on multiplex quantitative PCR according to claim 1, characterized in that, The multiplex PCR reaction solution also includes 2×PerfeCT qPCR ToughMix UNG.
6. A method for dengue virus typing and quantitative detection based on multiplex quantitative PCR, using the kit described in any one of claims 1 to 5, characterized in that, The detection method is for non-diagnostic purposes and includes the following steps: S1. Extract the RNA template from the sample to be tested, reverse it to a DNA template, and use it as the sample to be tested; S2. Add the multiplex PCR reaction solution from the above kit to the sample to be tested to prepare the PCR mixture of the drug to be tested; S3. Perform PCR amplification on the PCR mixture of the drugs to be tested; S4. After completing the PCR amplification, read the fluorescence signal and calculate the copy number of dengue virus type I, dengue virus type II, dengue virus type III, and dengue virus type IV.
7. The dengue virus typing and quantitative detection method based on multiplex quantitative PCR according to claim 6, characterized in that, In the PCR mixture of the test drug, the volume concentration of the test sample is 20%; the concentration of dengue virus type I probe is 0.2 μM, and the concentrations of both the upstream and downstream primers of dengue virus type I are 0.2 μM; the concentration of dengue virus type II probe is 0.4 μM, and the concentrations of both the upstream and downstream primers of dengue virus type II are 0.1 μM; the concentration of dengue virus type III probe is 0.3 μM, and the concentrations of both the upstream and downstream primers of dengue virus type III are 0.1 μM; the concentration of dengue virus type IV probe is 0.2 μM, and the concentrations of both the upstream and downstream primers of dengue virus type IV are 0.1 μM.
8. The dengue virus typing and quantitative detection method based on multiplex quantitative PCR according to claim 6, characterized in that, When performing the PCR amplification, the annealing temperature is set to 60~63℃.
Citation Information
Patent Citations
Methods for detecting and typing dengue virus, as well as dedicated chips and reagent kits.
CN102286636A
Multiple real-time fluorescent quantitative PCR primers, probes and kit for dengue virus typing detection and use method of kit
CN113430304A