Skin care composition and application thereof

Abstract

The invention provides a skin care composition and application thereof. Specifically, provided is a composition comprising: (A) a ginseng root extract; (B) hydrolyzing the sheep placenta extract; and an optional pharmaceutically or cosmetically acceptable carrier; wherein the weight ratio of the ginseng root extract to the hydrolyzed sheep placenta extract is 1: (0.5-5) based on the dry weight of the extract. The composition disclosed by the invention is safe and non-irritant, and has remarkable anti-inflammatory, soothing and repairing effects.

Description

Technical Field

[0001] The present invention belongs to the technical field of biomedicine, and in particular relates to a skin care composition and application thereof. Background Art

[0002] Skin problems such as sensitivity, acne, eczema, dryness and aging are common problems in modern life. These problems may be caused by a variety of internal and external factors, including environmental stress (such as ultraviolet rays, pollution), bad living habits, genetic factors and immune system reactions. In order to effectively solve these skin problems, the research and development of skin care products has continued to advance, focusing on providing anti-inflammatory, soothing, repairing and preventive functions.

[0003] When developing skin care products, it is crucial to choose the right active ingredients. For people with sensitive skin or specific skin problems (such as acne, eczema, contact dermatitis, etc.), it is especially important to choose gentle skin care products. For example, for infants and young children, their skin is particularly delicate, their stratum corneum is thin, and the sebaceous gland function has not yet fully developed. Therefore, the barrier function is relatively weak and is easily affected by external factors and has problems. Diaper rash (also known as red buttocks or diaper area dermatitis) is one of the common skin problems in infants and young children. Usually, large areas of erythema, papules or erosions with clear boundaries occur in the diaper area, and even secondary bacterial or Candida infections may occur. In severe cases, especially malnourished infants with chronic diarrhea, skin ulcers may occur, causing serious pain to the baby.

[0004] Therefore, this area is in urgent need of developing new safe, gentle and effective skin care products. Summary of the invention

[0005] The purpose of the present invention is to provide a safe and mild skin care composition having anti-inflammatory, soothing and repairing effects and its application.

[0006] The first aspect of the present invention provides a composition comprising: (A) Ginseng root extract; (B) hydrolyzed sheep placenta extract; and Optional pharmaceutically or cosmetically acceptable carrier; Wherein, the weight ratio of the ginseng root extract to the hydrolyzed sheep placenta extract is 1:(0.5-5), calculated on the basis of the dry weight of the extract.

[0007] In another preferred embodiment, the weight ratio of the ginseng root extract to the hydrolyzed sheep placenta extract is 1:(1-5), preferably 1:(2-4), such as 1:1, 1:1.2, 1:1.5, 1:1.8, 1:2, 1:2.2, 1:2.5, 1:2.8, 1:3, 1:3.2, 1:3.5, 1:3.75 or 1:4, based on the dry weight of the extract.

[0008] In another preferred example, in the composition, the content of ginseng root extract is 0.05-0.16 wt %, preferably 0.08-0.13 wt %, based on the dry weight of ginseng root extract.

[0009] In another preferred embodiment, in the composition, the content of the hydrolyzed sheep placenta extract is 0.18-0.6wt%, preferably 0.03-0.05wt%, based on the dry weight of the hydrolyzed sheep placenta extract.

[0010] In another preferred embodiment, the carrier comprises one or more substances selected from the following group: petrolatum, lanolin, dipentaerythritol tri-polyhydroxystearate, beeswax, a preservative (such as phenoxyethanol), ethylhexylglycerin and water.

[0011] In another preferred embodiment, the carrier comprises one or more substances selected from the following group: glycerin, cetyl ethylhexanoate, cetearyl alcohol, caprylic / capric triglyceride, shea butter (BUTYROSPERMUM PARKII) fruit butter, mineral oil, petrolatum, lanolin, polydimethylsiloxane, cetearyl glucoside, 1,2-hexanediol, PEG-100 stearate, p-hydroxyacetophenone, glyceryl stearate, tocopheryl acetate, dioctyldodecyl lauroyl glutamate, ammonium acryloyldimethyltaurate / VP copolymer, stearyl alcohol, a preservative (such as phenoxyethanol), xanthan gum, hydrogenated lecithin, phytosterols, ethylhexylglycerin, phytosphingosine, ceramide NP, ceramide AP, ceramide EOP and water.

[0012] In another preferred embodiment, the composition comprises: .

[0013] In another preferred embodiment, the composition comprises: In another preferred embodiment, the water content in the above composition is 5-15 or 8-12, calculated by wt % or parts by weight.

[0014] In another preferred embodiment, each component in the above composition is optionally independently used in an amount of ±10 wt%, ±8 wt%, ±5 wt%, ±3 wt% or ±2 wt% of the corresponding components in the composition of Example 2, an optional pH adjuster, and the amount of water is used to make up the balance to 100wt%.

[0015] In another preferred embodiment, the composition comprises: .

[0016] In another preferred embodiment, the composition comprises: .

[0017] In another preferred embodiment, the water content in the above composition is 65-73 or 68-72, calculated by wt % or parts by weight.

[0018] In another preferred embodiment, each component in the above composition is optionally independently used in an amount of ±10 wt%, ±8 wt%, ±5 wt%, ±3 wt% or ±2 wt% of the corresponding components in the composition of Example 3, an optional pH adjuster, and the amount of water is used to make up the balance to 100wt%.

[0019] In another preferred embodiment, the dosage form of the drug or cosmetic is selected from the following group: solution, gel, ointment, cream, emulsion, liposome, microemulsion, nanoemulsion, nanoparticle, nanomicrosphere, liquid crystal, transfersome, alcohol liposome, vesicle, microneedle array, patch (transdermal patch), or a combination thereof.

[0020] The second aspect of the present invention provides use of the composition according to the first aspect of the present invention in the preparation of a medicament for preventing or treating inflammatory diseases of the skin.

[0021] In another preferred embodiment, the skin inflammatory disease is contact dermatitis, such as diaper rash.

[0022] The third aspect of the present invention provides use of the composition as described in the first aspect of the present invention in the preparation of cosmetics for anti-inflammatory, soothing and / or repairing effects.

[0023] In another preferred example, the cosmetic is also used for moisturizing.

[0024] In another preferred embodiment, the composition is suitable for people with sensitive skin.

[0025] In another preferred embodiment, the medicine or cosmetic is used to prevent, alleviate or repair diaper rash (such as diaper cream).

[0026] It should be understood that within the scope of the present invention, the above-mentioned technical features of the present invention and the technical features specifically described below (such as embodiments) can be combined with each other to form a new or preferred technical solution. Due to space limitations, they will not be described one by one here. BRIEF DESCRIPTION OF THE DRAWINGS

[0027] Figure 1 This is the standard curve of nitric oxide (NO).

[0028] Figure 2 It is a bar graph of NO release content in each group.

[0029] Figure 3 The bar graph shows the relative expression of IL-6 mRNA in each group.

[0030] Figure 4 It is a bar graph of the moisture retention rate of the samples at different times.

[0031] Figure 5 Comparison of hyaluronidase inhibition rate of blank group / diaper cream of this application.

[0032] Figure 6 These are the appearance pictures of the back skin of the modeling group and the treatment group.

[0033] Figure 7 These are the appearance pictures of the left ears in the model group and the treatment group.

[0034] Figure 8 It is the moisture content of the skin's stratum corneum.

[0035] Fig. 9 It is the rate of change of moisture content in the stratum corneum of the skin.

[0036] Fig.10 It is the amount of water lost through the skin.

[0037] Fig.11 It is the rate of change of transepidermal water loss.

[0038] Fig.12 is the mean optical density of skin erythema.

[0039] Fig.13 is the mean change rate of skin erythema optical density.

[0040] Fig.14 Score the lactic acid sting.

[0041] Fig.15 The rate of change in lactic acid sting score. DETAILED DESCRIPTION

[0042] The present inventors have conducted extensive and in-depth research, and through a large number of screenings and tests, have provided a skin care composition and its application. The present inventors unexpectedly discovered for the first time that ginseng extract and sheep placenta extract have significant synergistic effects in anti-inflammatory, soothing and repairing, and are very suitable for preparing skin cosmetics or medicines, and further provided a skin care composition comprising these two active ingredients. On this basis, the present invention was completed.

[0043] the term Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs.

[0044] As used herein, when used in reference to a specific recited value, the term "about" means that the value may vary by no more than 1% from the recited value. For example, as used herein, the expression "about 100" includes all values ​​between 99 and 101 (e.g., 99.1, 99.2, 99.3, 99.4, etc.).

[0045] As used herein, the term "comprising" or "including (comprising)" may be open, semi-closed and closed. In other words, the term also includes "consisting essentially of" or "consisting of".

[0046] As used herein, the term "room temperature" or "normal temperature" refers to a temperature of 4-40 o C, preferably, 25±5 o C.

[0047] Combination of active ingredients Ginseng Root Extract The ginseng root extract of the present invention refers to a product obtained by solvent extraction of the root of the Araliaceae plant ginseng. The ginseng root extract of the present invention is water-soluble. The ginseng root extract is commercially available as a commonly used drug or cosmetic raw material (serial number 05483 in the List of Used Cosmetic Raw Materials (2015 Edition)) or is obtained by extraction using ginseng roots as raw materials by methods known in the art (such as extraction by solvents (water and / or ethanol), filtration, concentration, sterilization and other production processes), and its main active ingredient is ginsenosides.

[0048] Hydrolyzed Placenta (Sheep) Extract In the present invention, the terms "hydrolysis of placenta (sheep) extract" or "sheep placenta extract" or "hydrolyzed sheep placenta extract" can be used interchangeably. Hydrolyzed placenta (sheep) extract can be commercially obtained as a cosmetic raw material (serial number 06349 in the List of Used Cosmetic Raw Materials (2015 Edition)) or extracted from sheep placenta as a raw material by methods known in the art (such as fresh or frozen sheep placenta as a raw material, washed, pulped, homogenized, hydrolyzed, centrifuged to form an extract, and then concentrated, dried, and refined), and its main component is polypeptide protein.

[0049] The present invention firstly finds that the combined use of ginseng root extract and hydrolyzed placenta (sheep) extract has significant synergistic effects on skin anti-inflammatory, soothing, and repairing effects, thereby providing a composition with the two as main active ingredients.

[0050] Composition and use The present invention provides a pharmaceutical or cosmetic composition, comprising (A) a ginseng root extract; (B) a hydrolyzed sheep placenta extract; and optionally (C) a pharmaceutically or cosmetically acceptable carrier or excipient.

[0051] Preferably, the weight ratio of the ginseng root extract to the hydrolyzed sheep placenta extract is 1:(1-5), more preferably 1:(2-4), such as 1:1, 1:1.2, 1:1.5, 1:1.8, 1:2, 1:2.2, 1:2.5, 1:2.8, 1:3, 1:3.2, 1:3.5, 1:3.75 or 1:4, calculated on a dry weight basis.

[0052] Typically, in the composition, the amount of ginseng root extract may be 0.02-0.2 wt %, preferably 0.05-0.16 wt %, preferably 0.08-0.13 wt %, based on the dry weight of the ginseng root extract.

[0053] Preferably, in the composition, the content of the hydrolyzed sheep placenta extract may be 0.18-0.6 wt %, preferably 0.03-0.05 wt %, based on the dry weight of the hydrolyzed sheep placenta extract.

[0054] The combination of active ingredients of the present invention can be used as anti-inflammatory, soothing, and repairing active ingredients in pharmaceutical or cosmetic compositions, and can be used to prevent or treat skin inflammatory diseases (such as irritant contact dermatitis and allergic contact dermatitis). The combination of active ingredients of the present invention or the composition can be used to prevent and / or treat skin problems selected from the group consisting of dryness, tightness, redness, stinging, dry itching, allergy, inflammation (such as skin redness, blisters, pustules, ulcers), skin barrier damage, or a combination thereof.

[0055] The combination of active ingredients of the present invention as a whole can be used alone or in combination with other active ingredients, such as anti-acne, antibacterial, anti-inflammatory and other active ingredients for treating skin and mucosal inflammation or other skin diseases. In a preferred case, the composition of the present invention does not contain other plant / animal extracts with anti-inflammatory, soothing and repairing activities. In a preferred case, the composition of the present invention does not contain other anti-inflammatory active ingredients.

[0056] The composition of the present invention can select a suitable carrier according to different dosage forms and uses.

[0057] "Pharmaceutically acceptable carrier" refers to: one or more compatible solid or liquid fillers or gel substances, which are suitable for human use and must have sufficient purity and sufficiently low toxicity. "Compatibility" here means that the components in the composition can be mixed with the active ingredients of the present invention and with each other without significantly reducing the efficacy of the active ingredients. Some examples of pharmaceutically acceptable carriers include cellulose and its derivatives (such as sodium carboxymethyl cellulose, sodium ethyl cellulose, cellulose acetate, etc.), gelatin, talc, solid lubricants (such as stearic acid, magnesium stearate), calcium sulfate, vegetable oils (such as soybean oil, sesame oil, peanut oil, olive oil, etc.), polyols (such as propylene glycol, glycerol, mannitol, sorbitol, etc.), emulsifiers (such as Tween®), wetting agents (such as sodium lauryl sulfate), colorants, flavoring agents, stabilizers, antioxidants, preservatives, pyrogen-free water, etc. There is no particular limitation on the administration of the active ingredients or pharmaceutical compositions of the present invention, and representative administration methods include, but are not limited to: topical, oral, rectal, parenteral (intravenous, intramuscular or subcutaneous), etc. Solid dosage forms include capsules, tablets, pills, powders and granules. Liquid dosage forms include pharmaceutically acceptable emulsions, solutions, suspensions, syrups or tinctures.

[0058] Typically, the cosmetically acceptable carrier can be selected from one or more of the following groups (but not limited to): humectants, antioxidants, chemical peeling agents, skin penetrants, UV inhibitors, preservatives, film formers, oil-soluble gelling agents, organic modified clay minerals, resins, antimicrobial agents, essences, salts, pH regulators, skin conditioners, thickeners, emollients, emulsifiers, chelating agents, cooling agents, anti-inflammatory agents, skin beautifying ingredients, vitamins, amino acids, nucleic acids, hormones, inclusion compounds, solvents (such as water), or combinations thereof. The composition can also include liposomes and nano-microsphere forming agents, such as phospholipids, lecithin, cholesterol, monoolein or combinations thereof.

[0059] In another preferred embodiment, the carrier comprises one or more substances selected from the group consisting of petrolatum, lanolin, dipentaerythritol tri-polyhydroxystearate, beeswax, preservatives (such as phenoxyethanol), ethylhexylglycerin; optional pH regulator, and water. Preferably, the components of the composition are optionally independently used in the corresponding amounts of the corresponding components in the composition of Example 2, ±50 wt%, ±20 wt%, ±10 wt%, ±8 wt%, ±5 wt%, ±3 wt% or ±2 wt%, optional pH regulator, and the amount of water is to make up the balance to 100 wt%.

[0060] In another preferred embodiment, the carrier comprises one or more substances selected from the following group: glycerin, cetyl ethylhexanoate, cetearyl alcohol, caprylic / capric triglyceride, shea butter (BUTYROSPERMUM PARKII) fruit butter, mineral oil, petrolatum, lanolin, polydimethylsiloxane, cetearyl glucoside, 1,2-hexanediol, PEG-100 stearate, p-hydroxyacetophenone, glyceryl stearate, tocopheryl acetate, dioctyldodecyl lauroyl glutamate, ammonium acryloyldimethyltaurate / VP copolymer, stearyl alcohol, a preservative (such as phenoxyethanol), xanthan gum, hydrogenated lecithin, phytosterols (phytosterols, 08605), ethylhexylglycerin, phytosphingosine, ceramide NP, ceramide AP, ceramide EOP; optional pH adjuster, and water. Preferably, the components of the composition are optionally independently used in an amount of ±50 wt%, ±20 wt%, ±10 wt%, ±8 wt%, ±5 wt%, ±3 wt% or ±2 wt% of the corresponding components in the composition of Example 3, an optional pH adjuster, and the amount of water is to make up the balance to 100 wt%.

[0061] Preferably, the pH of the composition of the present invention is preferably between 4.5-7.5, such as pH 5.0, pH 6.0 or pH 7.0, and the pH can be further adjusted to the above range using a pH adjuster (such as hydrochloric acid, NaOH) as needed.

[0062] The amount of the carrier can be selected according to the dosage form according to its recommended amount. The composition of the present invention can be prepared by conventional methods, such as mixing the active ingredient and the carrier thoroughly. More preferably, the oil-soluble components are mixed with each other to form an oil phase, the water-soluble components are mixed with each other to form an aqueous phase, and then the oil phase and the aqueous phase are mixed and fixed to volume, thereby obtaining the composition of the present invention.

[0063] The composition of the present invention is preferably in the following dosage form: transdermal dosage form, percutaneous dosage form, and subcutaneous dosage form.

[0064] Preferably, the dosage form of the composition is selected from the following group (but not limited to): solution, gel, ointment, cream, emulsion, liposome, microemulsion, nanoemulsion, nanoparticle, nanomicrosphere, liquid crystal, transfersome, alcohol liposome, vesicle, microneedle array, patch (transdermal patch), or a combination thereof.

[0065] In particular, the composition of the present invention is suitable for infants (such as children aged 0-12 years, preferably children aged 0-6 years or 0-3 years) or subjects with sensitive skin.

[0066] The composition of the present invention can be applied to the skin all over the body, such as the face and trunk.

[0067] The main advantages of the present invention include: The inventors unexpectedly discovered for the first time that ginseng extract and sheep placenta extract have significant synergistic effects in anti-inflammatory, soothing and repairing, and are very suitable for preparing skin cosmetics. The inventors further provided a composition comprising these two active ingredients. The composition of the invention is safe, mild and non-irritating, and is particularly suitable for preparing cosmetic compositions for infants or subjects with sensitive skin.

[0068] The present invention will be further described below in conjunction with specific implementation. It should be understood that these embodiments are only used to illustrate the present invention and are not intended to limit the scope of the present invention. The experimental methods in the following examples without specifying specific conditions are usually based on conventional conditions or the conditions recommended by the manufacturer. Unless otherwise stated, percentages and parts are calculated by weight.

[0069] Example 1 1. Research purpose: To prove that the complex prepared from ginseng extract and sheep placenta extract has synergistic anti-inflammatory and soothing effects.

[0070] 2. Experimental methods: Lipopolysaccharides (LPS) were used to induce mouse mononuclear macrophages (RAW264.7) to construct an in vitro inflammatory cell model to test the anti-inflammatory effect.

[0071] 1. Materials and Methods 1.1 Required reagents: RAW264.7 cells, LPS, DMEM high glucose medium, fetal bovine serum, Griess reagent, ginseng (PANAX GINSENG) root extract (2.0wt% aqueous solution, Huzhou Zhenlu Biological Products Co., Ltd.), hydrolyzed placenta (sheep) extract (2.5wt% aqueous solution, Huzhou Zhenlu Biological Products Co., Ltd.).

[0072] Option 1: Anti-inflammation (NO concentration measurement) Day 1: RAW264.7 cells cultured to the logarithmic phase were cultured at 1×10 4 / well was inoculated in a 96-well plate and cultured for 24h.

[0073] The next day: observe the cell status, add LPS and drug intervention (ginseng extract (A); sheep placenta extract (B)) when the cell density reaches 80%, and discard the old culture medium.

[0074] Control group: 100 μL of fresh culture medium was added to each well.

[0075] Model group (LPS group): 100 μL LPS was added to each well, with a final concentration of 1 μg / mL.

[0076] Treatment group: Add different ratios of A+B for 2 hours before intervention and co-culture with LPS for 24 hours LPS + 1% A: Add 1% A and LPS to a final concentration of 1 μg / mL in a total volume of 100 μL.

[0077] LPS+3% B: Add 3% B and LPS to a final concentration of 1 μg / mL in a total volume of 100 μL.

[0078] LPS+0.5% A+1.5% B: Add 0.5% A+1.5% B and LPS at a final concentration of 1 μg / mL in a total volume of 100 μL.

[0079] LPS+ 1% A+ 1%B group: 1% A+ 1%B and LPS with a final concentration of 1 μg / mL were added in a total volume of 100 μL.

[0080] LPS + 1% A + 2% B group: 1% A + 2% B and LPS with a final concentration of 1 μg / mL were added to a total volume of 100 μL.

[0081] LPS+1% A +3% B group: 1% A +3% B and LPS with a final concentration of 1 μg / mL were added in a total volume of 100 μL.

[0082] Among them, 1%A means that the final concentration of A is 1% of the stock solution of ginseng (PANAX GINSENG) root extract. Similarly, 1%B means that the final concentration of B is 1% of the stock solution of hydrolyzed placenta (sheep) extract.

[0083] Day 3: Pipette the supernatant, add 50 μL of Griess I and Griess II respectively, and then detect the absorbance of each group using a 540 nm wavelength microplate reader.

[0084] The NO standard curve is shown in Table 1 and Figure 1 The results of NO release are shown in Table 2 and Figure 2 As shown (P<0.05 is marked as “*”; P<0.0001 is marked as “****”):

[0085] from Figure 2 It can be clearly seen from Table 2 that compared with the use of ginseng extract (A) or sheep placenta extract (B) alone, the combined use of ginseng extract and sheep placenta extract has a significant synergistic effect in inhibiting the release of NO in LPS-induced inflammatory cells, which also shows that the combination of active ingredients of the present invention has significant anti-inflammatory, antioxidant and soothing activities.

[0086] Solution 2: Anti-inflammatory and repair (Q-PCR detection of IL-6 inflammatory factor) 1. Materials and Methods 1.1 Reagents required: Enzyme-free EP tube, enzyme-free pipette tip, chloroform, 75% ethanol, DEPC water, isopropanol, Trizol, HiScript® II QRT SuperMix for qPCR (+gDNA wiper) kit, ChamQ Universal SYBR qPCR Master Mix kit; Primers: IL-6: forward primer CTGCAAGAGACTTCCATCCAG (SEQ ID No: 1); reverse primer AGTGGTATAGACAGGTCTGTTGG (SEQ ID No: 2).

[0087] 1.2 Experimental methods: 1.%2.%3 Trizol method to extract total RNA The cell density of the 6-well plate culture was about 90%. The supernatant was discarded, and the cells were washed once with PBS. 1 mL of Trizol was added to each well at room temperature. After repeated pipetting, the cells were allowed to stand at room temperature for 5 min. After repeated pipetting again, the cells were transferred to a 1.5 mL EP tube and lysed on ice for 10 min.

[0088] Add 200 μL of chloroform to each tube, shake and mix for 30 seconds, and place on ice for 5 minutes. Centrifuge at 4°C, 12,000 rpm, for 20 minutes; the resulting solution is divided into three layers, 400ul of the supernatant (aqueous phase) is taken and mixed with 600ul of isopropanol, and incubated on ice for 10 minutes; Centrifuge at 4℃, 12000 rpm, for 10 minutes. A small precipitate can be seen at the bottom of the EP tube. Discard the supernatant and add 1 mL of 75% ethanol (it is best if the RNA precipitate floats slightly). Centrifuge at 7500 rpm for 5 minutes at 4°C, discard the supernatant, and dry on ice for 5-10 minutes to dry the precipitate; The concentration and purity of RNA were measured by Nanodrop 2000 ultra-micro spectrophotometer and recorded.

[0089] 2.%2.%3 RNA reverse transcription, cDNA synthesis:

[0090] The experimental results are shown in Table 3 and Figure 3As shown, it can be seen that compared with the use of ginseng extract (A) and sheep placenta extract (B) alone, the combined use of ginseng extract and sheep placenta extract has a significant synergistic effect in anti-inflammatory and repair promotion (P < 0.0001: "****", "ns" no statistical significance). In fact, the use of sheep placenta extract (B) alone has almost no effect on inhibiting IL-6. Unexpectedly, when used in combination with ginseng extract (A), the two have a significant synergistic effect.

[0091] Example 2 A diaper cream composition, comprising the following components:

[0092] This diaper cream is a leave-on cosmetic. Under normal, reasonable and foreseeable use, it will not cause harm to human health.

[0093] How to use: After changing the diaper and cleaning the urine and feces, keep the skin surface of the buttocks dry, apply an appropriate amount evenly, and gently massage for an appropriate time.

[0094] 2.1 Moisturizing test The gravimetric method for determining the moisturizing rate of moisturizing cosmetics is also known as the in vitro weighing method. Generally, glass plates, bionic materials or medical breathable tapes are used as sample carriers. The use of cosmetics is simulated by directly applying the sample on the carrier. The carrier with the sample to be tested is placed under constant temperature and humidity conditions for a certain period of time, and the mass of the sample before and after is weighed. The moisturizing rate is calculated according to the formula. The gravimetric method for determining the moisturizing rate of moisturizing cosmetics is based on the fact that different moisturizer molecules in cosmetics have different forces on water molecules, and their ability to absorb and retain moisture is also different.

[0095] The moisturizing rate results of the test sample group and the control group (blank, positive) at different time points were compared. Repeat three times, calculate the mean and standard deviation, and use mean comparison and variance analysis between in vitro moisturizing test groups. If the moisturizing rate of the test group is better than that of the control group and the significance analysis P value is less than 0.05, it can be considered that the test sample has a certain moisturizing effect. (Note: P < 0.05 is marked as: "*"; P < 0.01 is marked as: "**"; P < 0.001 is marked as: "***")

[0096] Test index: Moisturizing rate; the higher the moisturizing rate, the stronger the moisturizing effect of the sample.

[0097] Experimental methods 1. Materials: BPS-50CB constant temperature and humidity chamber (Shanghai Yiheng), analytical balance (precision 0.0001g), glass plate (7.6cm x2.6cm), breathable medical tape, glass rod, positive control (0.5mg / mL HA).

[0098] 2. Methods: Set the parameters of the constant temperature and humidity chamber: temperature 20℃, relative humidity 40%; wash and dry the glass plate, and stick it with breathable medical tape; use a pipette or a pipette to take a certain amount of the sample to be tested (50uL for emulsions, pastes, and liquids), and use a glass rod to evenly spread the sample on the breathable medical tape. The sample dosage is about 2 mg / cm2; place the glass plate with the sample in a constant temperature and humidity chamber, and the placement time gradient is 0, 30 min, 1 h, 2h, 4h, and 6 h; quickly take it out and weigh it, conduct three parallel experiments, take the average value, calculate the moisture retention rate Rr, and draw a moisture retention rate bar graph.

[0099] Formula for determining moisture retention rate by gravimetric method (Rr - moisture retention rate; m0 - mass of glass plate tape (g); m1 - mass of glass plate tape after adding sample (g); m2 - mass of glass plate tape at each time point after adding sample (g)): Rr (%) = (m2-m0) / (m1-m0) × 100%

[0100] in conclusion The test results of the moisture retention rate of the test samples at different times are shown in Table 5. Figure 4 The moisturizing rate bar graph of the samples at different time points shows that the moisturizing rate of the test sample group at each time point (30min / 1h / 2h / 4h) is better than that of the blank control group, and P < 0.05 is statistically significant. In summary, under the conditions of this experiment, the test sample has obvious moisturizing effect.

[0101] 2.2 Relief Test 1. Experimental purpose and principle The soothing effect is mainly characterized by evaluating the inhibition rate of the test sample on hyaluronidase. High molecular weight hyaluronic acid plays an important role in regulating skin repair and can significantly reduce inflammatory reactions. However, the degradation products of hyaluronic acid are one of the causes of skin inflammatory reactions. The degradation reaction of hyaluronic acid depends on the activity of hyaluronidase. Hyaluronidase is also involved in the process of tissue inflammation and is a participant in type I allergic reactions. It participates in the reaction in the third stage of allergic reactions, leading to mast cell degranulation. Therefore, the inhibition of hyaluronidase activity can be used as an indicator of the anti-inflammatory and anti-allergic reaction of the sample. The experimental principle of inhibiting hyaluronidase is that hyaluronidase catalyzes the reaction with the enzyme substrate, and the absorbance changes after the active substance is added. The magnitude of the absorbance change reflects the inhibition rate of the hyaluronidase inhibitor.

[0102] 2 Scope of application and relevance This test method is an in vitro method, which is suitable for evaluating cosmetic products and raw materials that claim to achieve soothing effects by inhibiting hyaluronidase. As a supplement to the subjective and objective evaluation method of the human body, the in vitro method is one of the in vivo inflammatory pathways and has a certain correlation with the results of the in vivo method for testing soothing efficacy. Through the experimental design, the hyaluronidase inhibition rate results of the test sample group and the blank group were compared. Repeat three times, calculate the mean and standard deviation, and use mean comparison and variance analysis between the in vitro soothing test groups. If the hyaluronidase inhibition rate of the test group is better than that of the blank group and the significance analysis P < 0.05, it can be considered that the test sample has a certain soothing effect. (Note: P < 0.05 is marked as: "*"; P < 0.01 is marked as: "**"; P < 0.001 is marked as: "***")

[0103] 3. Test indicator: hyaluronidase inhibition rate. The higher the hyaluronidase inhibition rate, the stronger the soothing effect of the sample.

[0104] 4. Test methods: 4.1 Reagents and instruments: Hyaluronidase: concentration 500 U / mL, freshly prepared and used, not overnight, use acetate buffer as solvent; Sodium hyaluronate: 0.5 mg / mL, one-time preparation, multiple use, using acetate buffer as solvent; Buffer: Solution A (0.2 mol / L acetic acid 11.55 mL glacial acetic acid dissolved in 1 L distilled water) 4.8 mL; Solution B (0.2 mol / L sodium acetate 16.4 g anhydrous sodium acetate or 27.2 g sodium acetate trihydrate dissolved in 1 L distilled water) 45.2 mL, mixed and diluted to 100 mL, to prepare an acetate buffer with pH=5.6; Acetylacetone solution: 50 mL 1.0 mol / L sodium carbonate solution and 3.5 mL acetylacetone solution are mixed evenly (prepare before use); P-DAB color developer: 0.8 g p-dimethylaminobenzaldehyde dissolved in 15 mL concentrated hydrochloric acid and 15 mL anhydrous ethanol and mixed evenly; calcium chloride solution CaCl2: 2.5 mol / L; sodium hydroxide solution NaOH: 5 mol / L; sample reference concentration: 1.2 mg / mL.

[0105] 4.2 Test steps

[0106] 4.3 Calculation Hyaluronic acid phytase inhibition rate (%) = [(CD)-(AB)] / (CD)x100% Where: A——OD value of (hyaluronidase + sample + sodium hyaluronate) sample solution B——OD value of (acetate buffer + sample + acetate buffer) sample blank C——OD value of (hyaluronidase + deionized water + sodium hyaluronate) control solution D——OD value of (acetic acid buffer + deionized water + acetate buffer) control blank

[0107] The test results of the test samples are shown in Table 7-1 and Figure 5 (P<0.001: “***”), when the sample is the original solution of the composition of the present invention, the hyaluronidase inhibition rate is 34.77%; compared with the blank group, the hyaluronidase inhibition rate of the sample group is better than that of the blank group, and the statistical difference P value is 0.000, which is significantly different (P<0.05).

[0108] In summary, under the conditions of this experiment, the test sample has a significant soothing effect.

[0109] 2.3. Evaluation of the effect of the diaper cream composition of Example 2 on diaper rash Neonatal diaper rash is a skin inflammatory reaction caused by failure to change diapers that are soiled with urine and feces in time or bacterial infection, which causes redness, swelling, blisters, pustules, and even ulceration in the diaper wrapping area of ​​the newborn. It belongs to the category of allergic contact dermatitis (ACD). When the skin at the lesion site contacts the allergen again or repeatedly, specific T cells gather in large numbers at the contact site, secrete excessive cytokines, and trigger an inflammatory response. At present, the incidence of diaper rash is as high as 43.8%. Due to the difficulty in screening allergens, clinical medication is very arbitrary and blind.

[0110] The present invention uses a mouse ACD model induced by 2,4-dinitrochlorobenzene (DNCB) to explore whether the composition of the present invention can solve the problem of diaper rash.

[0111] 1. Materials and Instruments Experimental animals: SPF KM mice, female, 3 mice per group, body weight 18-20 g. Raised in a 12 h light / 12 h dark environment, room temperature controlled at 18-24 ℃, humidity controlled at 50%-70%, light exposure time 8:00-20:00, free access to water and food.

[0112] Reagents: 2,4-dinitrochlorobenzene (DNCB): (Shanghai Aladdin Biochemical Technology Co., Ltd., catalog number: C465514-25g), ready-to-use 1.25% avertin solution: (Nanjing Aibei Biotechnology Co., Ltd., M2910).

[0113] Materials: Antibacterial fiber surface layer: brand, item number, ordinary surface layer, medical non-woven paper tape: 2cm×300cm 1 roll / bag, Haishi Hainuo, item number: 2007530.

[0114] Instruments: Vernier caliper: Deli, item number: DL91150B, hole puncher: 6mm, COMIX, item number: 1666136.

[0115] 2. Model Construction Preparation stage: SPF KM female mice were adaptively raised for 3 days before the experiment. All mice were anesthetized with Avertin 6 days before the experiment, and the back and abdomen of the mice were shaved with a razor, with the shaved area of ​​2cm×2cm. Then, a cotton swab was dipped in Veet depilatory cream and evenly applied to the shaved area of ​​the mice. After standing for 4-5 minutes, the shed hair was wiped off with a cotton swab dipped in warm water. After the end, they were divided into 2 groups according to the random number table method. Five days before the experiment, the abdomen of the mice was sensitized with 5% DNCB acetone-olive oil (4:1) solution, and 25μL was applied to each mouse.

[0116] ① Model group (modeling group): On the first day of the experiment, the back and left ear of mice were stimulated with 0.25% DNCB acetone-olive oil (4:1) solution, 30 μL was applied to each back, 10 μL was applied to the left ear, and the same amount of acetone-olive oil (4:1) was applied to the right ear as a control.

[0117] ② Treatment group: The rats were given the composition of Example 2 of the present invention at 24h, 48h, 72h and 96h after DNCB stimulation, with the dosage of 2.4g on the back and 0.3g on the left ear. The rats were photographed and sampled every 24h.

[0118] 3. Evaluation of detection indicators (evaluation of inflammation and relief indicators) 3.1 Appearance evaluation 24 hours after DNCB stimulation, the changes in the physiological conditions of the mice were observed, including the activity level, weight and coat color of the mice. The hair removal sites and the left and right ears of the mice were observed for erythema, edema, erosion, scab, bleeding, scratches, etc., where no erythema was graded as 0, mild erythema was graded as 1, obvious erythema without scab was graded as 2, moderate to severe erythema with mild to moderate scab was graded as 3, and severe erythema with severe scab was graded as 4.

[0119] The results of back administration are as follows Figure 6 The model group was grade 4, with severe scabs and redness and swelling. The treatment group had reduced redness and swelling and scabs over time, indicating that the composition of Example 2 of the present invention has anti-inflammatory and soothing effects.

[0120] 3.2 Appearance evaluation of ear swelling Ear swelling degree (mg) = left ear mass - right ear mass; ear swelling inhibition rate (%) = (average ear swelling degree of model group - average ear swelling degree of treatment group) / average ear swelling degree of model group × 100%.

[0121] Table 7-2 Test results

[0122] The results in Table 7-2 show that the ear swelling inhibition rate in the group treated with the composition of Example 2 was 56%; Figure 7 The results showed that the redness and swelling of the mice in the treatment group were reduced, indicating that the composition had good anti-inflammatory and soothing effects, which suggests that the composition of the present invention can be used to prevent or treat diaper rash in children.

[0123] Example 3 A cosmetic composition comprising the following components:

[0124] This product is a leave-on cosmetic. Under normal, reasonable and foreseeable conditions of use, it will not cause harm to human health.

[0125] The basic functions of this product are repairing, soothing and moisturizing, and the formula does not use any added ingredients with other functions beyond these basic functions.

[0126] This product uses hydrolyzed placenta (sheep) extract and ginseng (PANAX GINSENG) root extract as the main active ingredients, and the oils are mainly safe petrolatum, lanolin, and shea butter, which are safe and gentle; it has good occlusive properties and can effectively isolate sweat; multiple ceramide components (ceramide EOP / ceramide NP / ceramide AP) and phytosphingosine and phytosterols together constitute the liposome component, giving the composition a more excellent moisturizing and repairing ability.

[0127] The entire composition has a liquid crystal structure, which makes the product safer, gentler, and more stable. Acid, alkali and electrolyte resistance are greatly improved. The liquid crystal structure refers to the directional arrangement of molecules at the oil-water interface to form a long-range ordered and short-range disordered liquid crystal structure, usually a lamellar liquid crystal. This structure can be observed to have obvious lamellar liquid crystals under a polarizing microscope. Because the lamellar liquid crystal structure it forms is similar to the structure of the skin's stratum corneum, it has good stability, a fresh and natural skin feel, can prolong hydration and closure, and control the sustained release of active ingredients. In addition, the liquid crystal emulsification system can also provide good water-locking and moisturizing properties and penetration-promoting properties. A thin film is formed on the skin surface to protect the skin from irritation and damage, and repair the sebum barrier of damaged skin.

[0128] The design principle of this formula complies with the standards of children's cosmetics and is mild and safe. No fragrance ingredients and very small amounts of preservatives are added to the formula; allergens are effectively controlled.

[0129] 3.1 Efficacy evaluation Purpose of the test: To test the product using a human efficacy evaluation test, measure the corresponding parameters of the skin on the inner forearm of subjects with sensitive skin through instruments, and conduct a clinical evaluation of the safety and efficacy of the test product.

[0130] Number of subjects: Select qualified subjects to ensure that the final number of valid cases is not less than 30.

[0131] Subject restrictions: During the test period, the test product of the present invention should be used on the test area, and no other products with the same efficacy or that may affect the test results should be used. The use habits of other daily necessities such as soap, shower gel, etc. must be consistent.

[0132] Sample usage instructions: After cleansing the skin, take an appropriate amount of the product and apply it evenly on the inner side of the arm, and gently massage to help it be absorbed; once in the morning and once in the evening).

[0133] 3.1.1 Test methods The subjects were subjected to a lactic acid sting test. At room temperature, 50 µL of 10% lactic acid solution was applied to the inner forearm of the arm. The subjects were asked about their subjective symptoms at 30 s, 2.5 min, 5.0 min and 10 min. The symptoms were scored using a 4-point scale (0 for no tingling, 1 for mild tingling, 2 for moderate tingling, and 3 for severe tingling). The total score of lactic acid sting at each time point was 3 or 3, indicating a positive lactic acid sting reaction. The subjects signed an informed consent form. The subjects were asked relevant questions according to the entry and exclusion criteria, and the questions were recorded together with the test screening results.

[0134] Cleaning: Before starting the test, clean the test area with the designated facial cleanser and wipe it dry with a non-woven cloth; the cleaning process and water temperature should remain consistent for each follow-up visit.

[0135] Test: The subjects were tested with instruments at the first visit and at each visit point after use. They sat quietly in a standard environment for 30 minutes, marked the test site with a positioning card on the inner side of the forearm, tested the moisture content of the stratum corneum, the amount of transepidermal water loss, and took photos of the red area on the inner side of the forearm. The basic values ​​of each index in the first visit test were recorded as DO; the subjects used the test product at home according to the usage requirements, and conducted follow-up tests on the 7th, 14th, and 28th days, recorded as D7, D14, and D28. During the follow-up visit on the 28th day, they filled out the questionnaire and performed the lactic acid sting test.

[0136] The moisturizing / repairing / soothing effects on the human body can be characterized by changes in the moisture content of the skin stratum corneum, the amount of transepidermal water loss, the mean optical density of skin erythema, and the lactic acid stinging score. This clinical evaluation test is suitable for evaluating cosmetics that claim to achieve moisturizing / repairing / soothing effects through changes in the moisture content of the skin stratum corneum, the amount of transepidermal water loss, the mean optical density of skin erythema, and the lactic acid stinging score.

[0137] Test site: inner forearm Evaluation indicators

[0138] Safety and adverse reaction evaluation During the trial, adverse reaction observation and evaluation were conducted 4 times, including follow-up visits at D0, D7, D14 and D28. Professional dermatologists asked the subjects whether they had symptoms such as itching, burning, tightness, fever, tingling, dryness, etc. on the inner forearm of the arm during the use of the test product, and observed and recorded whether there were erythema, wheal and desquamation. Then, after using the product, the score was scored according to the scoring criteria in Table 10, and the score was recorded in the trial study event report form, and the correlation evaluation was performed according to the criteria listed in Table 11.

[0139]

[0140] Data analysis: Descriptive statistics were performed on the analysis parameters, including mean, standard deviation, median, etc. The basic values ​​of the analysis parameters and the values ​​of other measurement time points were calculated and analyzed using professional statistical software. If the data were normally distributed, the t-test was used for data analysis and statistics; if the data were non-normally distributed, the rank sum test method was used for statistics. The statistical methods all used two-tailed tests, and the test level α = 0.05. ("ns" means no statistical difference, P>0.05; "*" means significant difference, 0.01≤P<0.05, recorded as "*"; 0.001≤P<0.01, recorded as "**"; P<0.001, recorded as "***").

[0141] The difference after using the product = the value after use - the value before use Change rate after using the product (%) = (value after use - value before use) / value before use × 100% Subject information: A total of 33 subjects were recruited, of which 1 subject withdrew and 2 subjects were eliminated due to abnormal data. Finally, 30 subjects completed the test, all of whom were female, aged 22 to 54 years old, with an average age of 39.43±10.67 years old, meeting the voluntary inclusion criteria.

[0142] 3.1.2 Analysis of moisture content in the stratum corneum Use the skin moisture test probe CM825 to measure the moisture content of the skin stratum corneum. The larger the test value, the higher the moisture content of the skin stratum corneum.

[0143] Test group: Composition of Example 3 The results of the moisture content of the skin stratum corneum before and after using the test product are as follows Figure 8-9 shown.

[0144] The larger the moisture content of the stratum corneum, the more moisture the stratum corneum contains. Figure 8 (P<0.001, marked as "***") It can be seen that after using the composition of Example 3, the moisture content of the stratum corneum of the subjects' skin increased at D7, D14, and D28 compared with D0, indicating that the composition of Example 3 can increase the moisture content of the stratum corneum of the skin.

[0145] The greater the change rate of the moisture content of the stratum corneum, the better the improvement of the moisture content of the stratum corneum. Fig. 9 It can be seen that after using the composition of Example 3, the increase rates of the moisture content of the stratum corneum of the subjects' skin at D7, D14, and D28 were 46.39%, 64.77%, and 63.59%, respectively, which were significantly different from D0 (P<0.001), indicating that the composition of Example 3 can improve the moisture content of the stratum corneum of the skin and has a moisturizing effect.

[0146] 3.1.2 Analysis of transepidermal water loss The skin water loss probe TewameterTM300 is used to measure the skin water loss. The smaller the test value, the less the transepidermal water loss per unit time and unit cross-sectional area.

[0147] Test group: Composition of Example 3 The results of transepidermal water loss before and after using the test product are as follows Figure 10-11 As shown: The smaller the value of transepidermal water loss, the less water loss in the stratum corneum of the skin. Fig.10 (P<0.001, marked with "***") It can be seen that after using the composition of Example 3, the transepidermal water loss of the subjects' skin at D7, D14, and D28 decreased compared with D0, indicating that the composition of Example 3 can reduce the water loss of the stratum corneum of the skin.

[0148] The greater the change rate of transepidermal water loss, the better the improvement of skin stratum corneum water loss and the better the skin barrier repair. Fig.11It can be seen that after using the composition of Example 3, the decrease rates of transepidermal water loss of the subjects' skin at D7, D14, and D28 were 16.24%, 22.39%, and 24.70%, respectively, which were significantly different from D0 (P<0.001), indicating that the composition of Example 3 can effectively repair the skin barrier.

[0149] 3.1.3 Analysis of mean optical density of skin erythema Use VISIA 7 to take pictures + IPP skin erythema optical density mean analysis to measure the skin erythema index. The skin erythema index reflects the condition of skin capillaries and the degree of skin inflammation. The lower the value, the less skin erythema.

[0150] Test group: Composition of Example 3 The average optical density of skin erythema before and after using the test product is as follows Figure 12-13 As shown: The smaller the mean optical density of skin erythema, the less skin erythema. Fig.12 (P<0.001, marked with "***") It can be seen that after using the composition of Example 3, the mean optical density of skin erythema of the subjects at D7, D14, and D28 decreased compared with D0, indicating that the composition of Example 3 can reduce skin erythema.

[0151] The greater the change rate of the mean optical density of skin erythema, the better the improvement of skin erythema. Fig.13 It can be seen that after using the composition of Example 3, the mean decrease rates of the optical density of skin erythema of the subjects at D7, D14, and D28 were 6.07%, 11.01%, and 11.88%, respectively, which were significantly different from D0 (P<0.001), indicating that the composition of Example 3 can effectively improve skin erythema.

[0152] 3.1.4 Lactic acid stinging score analysis Lactic acid sting test (LAST): At room temperature, 50 μL of 10% lactic acid solution was applied to the inner forearm, and the subjects were asked about their subjective symptoms at 30 s, 2.5 min, 5.0 min and 10 min; the symptoms were scored using a 4-point scale (0 for no tingling, 1 for mild tingling, 2 for moderate tingling, and 3 for severe tingling). A total score of 3 or more at each time point indicated a positive lactic acid sting reaction.

[0153] The subjects' lactic acid stinging test was scored and analyzed, and the smaller the score, the lower the sensitivity of the subject's skin to lactic acid stimulation.

[0154] Test group: Composition of Example 3 The lactic acid sting score results before and after using the test product are as follows Figure 14-15 As shown: The smaller the lactic acid stinging score, the less sensitive the subject's skin is to lactic acid stimulation. Fig.14 (P<0.001, marked with "***") It can be seen that after using the composition of Example 3, the lactic acid stinging score of the subjects at D28 decreased compared with D0, indicating that the composition of Example 3 can reduce the sensitivity of the skin to lactic acid stimulation.

[0155] The greater the change rate of lactic acid stinging score, the better the improvement of skin sensitivity. Fig.15 It can be seen that after using the composition of Example 3, the lactic acid stinging score of the subjects decreased by 50.76% on D28, which was significantly different from that on D0 (P<0.001), indicating that the composition of Example 3 can relieve skin sensitivity.

[0156] 3.1.5 Analysis of consumer test results After using the product for 28 days, the effect evaluation of 30 subjects using the test samples was collected; the evaluation levels were strongly agree / somewhat agree / average / somewhat disagree / strongly disagree, and the number of people who relatively agree and strongly agree was included in the data for calculating the recognition rate. Recognition rate = (number of people who relatively agree + number of people who strongly agree) / total number of people * 100%. The results are shown in Tables 12 and 13 below.

[0157]

[0158] 3.1.6 Conclusion A clinical moisturizing / repairing / soothing efficacy test was conducted on 30 subjects with sensitive skin who used the composition of Example 3 of the present invention continuously to evaluate the moisture content of the stratum corneum, transepidermal water loss, mean optical density of skin erythema, lactic acid stinging score and other indicators. The results showed that: The composition of Example 3 is mild and non-irritating, easy to apply and absorb when used, and feels refreshing and non-sticky after use; it can enhance the skin's hydration, improve skin dryness, tightness, redness, stinging, dryness and itching, and soothe the skin; after using the product, the subjects' skin stratum corneum moisture content, skin transepidermal water loss, skin erythema optical density mean, and lactic acid stinging score were significantly improved (P<0.001); the product can increase the skin stratum corneum moisture content, repair the skin barrier, reduce skin erythema, and soothe the skin; that is, the product is suitable for sensitive skin and has moisturizing / repairing / soothing effects.

[0159] 3.2 Anti-inflammatory test 1. Purpose of the test The 3D epidermal skin model is composed of human keratinocytes to form a 3D structural reorganization model with a structure and function similar to natural human skin. It is widely used in skin irritation testing. Using an in vitro skin model, the model is treated with chemical reagents to create a state of discomfort, and the expression of inflammatory factors is detected. The reduced expression of inflammatory factors indicates that the product has the ability to inhibit the expression of inflammatory factors and has a soothing effect to a certain extent. This experiment is based on the 3D epidermal skin model in vitro evaluation model. PolyI:C+LPS is used to stimulate the 3D epidermal skin model to prepare an epidermal injury model. After adding the test substance, the soothing effect is evaluated by analyzing the expression of inflammatory factors.

[0160] 2. Samples and control group are shown in Table 14:

[0161] The positive control WY14643 (Pirinixic Acid) is a small molecule PPARα receptor agonist with anti-inflammatory and antioxidant activities.

[0162] 3. Main reagents, consumables and instrument skin models 3D epidermal skin model Reagents: EPISKIN skin model growth medium, PolyI:C (Sigma), lipopolysaccharide LPS (E.Coli.Sigma), PBS (Solaibao), WY14643 (Sigma), Human TNF-α kit, Human IL-1α kit; Instruments: microplate reader, CO2 cell culture incubator, constant temperature water bath, inverted microscope, clean bench, disposable sterile tweezers.

[0163] 4. Experimental Design and Methods 4.1 Preparation for skin model resuscitation: Add 0.9 mL of maintenance culture medium to each well, use sterile tweezers to clip the model along the upper wall of the Transwell, and gently wipe off the agar or other liquid at the bottom of the model on absorbent paper. When placing the model in the 6-well plate with culture medium, the model should be in full contact with the culture medium to prevent the formation of bubbles. Culture in an incubator (37°C, 5% CO2) for 18-24 h.

[0164] 4.2 Sample addition: For the negative group, model group and sample group, the original culture medium was discarded and 0.9 mL of model culture medium was added to each well. The working solution was added to the positive control group (50 μM). For the sample group, the original sample (0.1 g) was evenly applied to the surface of the model and incubated in a CO2 incubator (37°C, 5% CO2) for 24 h.

[0165] 4.3 After incubation, remove the 6-well plate from the incubator. Gently wipe the surface of the model with a sterile cotton swab. Aspirate the remaining culture medium in the well, add PolyI:C and LPS induction working solution to the model group, positive group and sample group, and add model culture solution to the negative group. After the end, transfer all 6-well plates to a CO2 incubator (37℃, 5% CO2) and incubate for 24 hours.

[0166] 4.4 Absorb the supernatant for inflammation detection 4.5 Analysis formula of inflammatory factor inhibition rate Inhibition rate (%) = (1-sample group / model group) * 100% 5 Experimental Results 5.1 TNF-α inhibition test results are shown in Table 15 5.2 IL-1α inhibition test results are shown in Table 16

[0167] It can be seen from Tables 15-16 that the composition of Example 3 of the present invention has significant anti-inflammatory and soothing activity on human skin cells.

[0168] All documents mentioned in the present invention are cited as references in this application, just as each document is cited as reference individually. In addition, it should be understood that after reading the above teachings of the present invention, those skilled in the art can make various changes or modifications to the present invention, and these equivalent forms also fall within the scope defined by the claims attached to this application.

Claims

1. A composition, characterized in that include: (A) Ginseng root extract; (B) hydrolyzed sheep placenta extract; and Optional pharmaceutically or cosmetically acceptable carrier; Wherein, the weight ratio of the ginseng root extract to the hydrolyzed sheep placenta extract is 1:(0.5-5), calculated on the basis of the dry weight of the extract.

2. The composition according to claim 1, characterized in that The weight ratio of the ginseng root extract to the hydrolyzed sheep placenta extract is 1:(1-4), calculated on the basis of the dry weight of the extract.

3. The composition according to claim 1, characterized in that The carrier comprises one or more substances selected from the group consisting of petrolatum, lanolin, dipentaerythritol tri-polyhydroxystearate, beeswax, a preservative, ethylhexylglycerin and water.

4. The composition according to claim 1, characterized in that The carrier comprises one or more substances selected from the following group: glycerin, cetyl ethylhexanoate, cetearyl alcohol, caprylic / capric triglyceride, shea butter, mineral oil, petrolatum, lanolin, polydimethylsiloxane, cetearyl glucoside, 1,2-hexanediol, PEG-100 stearate, p-hydroxyacetophenone, glyceryl stearate, tocopheryl acetate, dioctyldodecanol lauroyl glutamate, ammonium acryloyldimethyltaurate / VP copolymer, stearyl alcohol, preservatives, xanthan gum, hydrogenated lecithin, phytosterols, ethylhexylglycerin, phytosphingosine, ceramide NP, ceramide AP, ceramide EOP and water.

5. The composition according to claim 1, characterized in that The composition comprises: Components are calculated by wt % or weight Ginseng root extract 0.0243-0.0729 Hydrolyzed sheep placenta extract 0.094625-0.283875 Petrolatum 55-67 Lanolin 12-21 Dipentaerythritol tri-polyhydroxystearate 2.5-6.5 Beeswax 2-5 Preservatives 0.0243-0.0729 Ethylhexylglycerin 0.0035-0.0105; and Water 0-30.

6. The composition according to claim 1, characterized in that The composition comprises: Components are calculated by wt % or weight Ginseng root extract 0.03888-0.05832 Hydrolyzed sheep placenta extract 0.1514-0.2271 Petrolatum 58-66 Lanolin 14.4-20 Pentaerythritol tri-polyhydroxystearate 4-6 Beeswax 3.2-4.8 Preservatives 0.03888-0.05832 Ethylhexylglycerin 0.0056-0.0084; and Water 2-25.

7. The composition according to claim 1, characterized in that The composition comprises: Components are calculated by wt % or weight Hydrolyzed sheep placenta extract 0.19875-0.59625 Ginseng root extract 0.051-0.153 Glycerol 3-9 Cetyl Ethylhexanoate 2-6 Cetearyl alcohol 1.53155-4.59465 Caprylic / capric triglyceride 1.5-4.5 Avocado Butter 1-3 Mineral oil 1-3 Petrolatum 1-3 Lanolin 1-3 Polydimethylsiloxane 1-3 Cetearyl Glucoside 0.27-0.81 1,2-Hexanediol 0.25-0.75 PEG-100 Stearate 0.25-0.75 p-Hydroxyacetophenone 0.25-0.75 Glyceryl stearate 0.25-0.75 Tocopheryl acetate 0.25-0.75 Dioctyldodecyl lauroyl glutamate 0.21-0.63 Ammonium acryloyldimethyltaurate / VP copolymer 0.2-0.6 Stearyl alcohol 0.09-0.27 Preservatives 0.06615-0.19845 Xanthan gum 0.05-0.15 Hydrogenated lecithin 0.03-0.09 Phytosterols 0.015-0.045 Ethylhexylglycerin 0.00735-0.02205 Phytosphingosine 0.0015-0.0045 Ceramide NP 0.0015-0.0045 Ceramide AP 0.000375-0.001125 Ceramide EOP 0.000075-0.000225; and Water 54.3295-84.7765.

8. The composition according to claim 1, characterized in that The composition comprises: Components are calculated by wt % or weight Hydrolyzed sheep placenta extract 0.318-0.477 Ginseng root extract 0.0816-0.1224 Glycerol 4.8-7.2 Cetyl Ethylhexanoate 3.2-4.8 Cetearyl alcohol 2.45048-3.67572 Caprylic / capric triglyceride 2.4-3.6 Avocado Butter 1.6-2.4 Mineral oil 1.6-2.4 Petrolatum 1.6-2.4 Lanolin 1.6-2.4 Polydimethylsiloxane 1.6-2.4 Cetearyl Glucoside 0.432-0.648 1,2-Hexanediol 0.4-0.6 PEG-100 Stearate 0.4-0.6 p-Hydroxyacetophenone 0.4-0.6 Glyceryl stearate 0.4-0.6 Tocopherol acetate 0.4-0.6 Dioctyldodecyl lauroyl glutamate 0.336-0.504 Ammonium acryloyldimethyltaurate / VP copolymer 0.32-0.48 Stearyl alcohol 0.144-0.216 Preservatives 0.10584-0.15876 Xanthan gum 0.08-0.12 Hydrogenated lecithin 0.048-0.072 Phytosterols 0.024-0.036 Ethylhexylglycerin 0.01176-0.01764 Phytosphingosine 0.0024-0.0036 Ceramide NP 0.0024-0.0036 Ceramide AP 0.0006-0.0009 Ceramide EOP 0.00012-0.00018; and Water 63.4636-75.6424.

9. The composition according to claim 1, characterized in that The dosage form of the composition is selected from the group consisting of solution, gel, ointment, cream and lotion.

10. Use of the composition according to any one of claims 1 to 9 in the preparation of a medicament for preventing or treating inflammatory diseases of the skin.

11. Use of the composition according to any one of claims 1 to 9 in the preparation of cosmetics for anti-inflammatory, soothing and / or repairing effects.

Images