Fluorescent quantitative PCR reference dye as well as preparation method and application thereof

Abstract

The invention belongs to the technical field of chemical synthesis and biology, and particularly relates to a synthesis process scheme and an application method of a reference dye for fluorescent quantitative PCR (Polymerase Chain Reaction). If an accurate Ct value needs to be obtained in real-time fluorescent quantitative PCR, a fluorescent signal generated in a PCR thermal cycle process needs to be combined with a reference dye, and data analysis is performed after a signal of a sample is normalized. At present, ROX mixed dye has the best effect in the prior art, but objectively has the problems that two reagents are inconvenient to mix and the mixing ratio affects the result, and in order to solve the problems, the invention develops new dye which does not interact with components of nucleic acid amplification reaction, does not participate in DNA amplification and does not affect the amplification reaction efficiency. Particularly, ROX can be directly replaced on an instrument needing a reference dye, the ROX does not need to be mixed with other dyes for use, and the problem that only ROX mixed dyes can be adopted in the prior art is solved.

Description

Technical Field

[0001] The invention belongs to the field of chemical synthesis and biotechnology, and in particular relates to a synthesis process scheme and an application method for a fluorescent quantitative PCR reference dye. Background Art

[0002] The polymerase chain reaction (PCR) technology utilizes the denaturation and renaturation principle of DNA, and adopts temperature extension, high temperature denaturation and low temperature renaturation to achieve in vitro amplification of nucleic acid fragments. It can specifically amplify extremely small amounts of target DNA by millions of times, thereby improving the analysis and detection of DNA molecules. The real-time fluorescence quantitative polymerase chain reaction (Q-PCR) technology adds fluorescent groups to the PCR amplification reaction system, uses the accumulation of fluorescent signals to monitor the entire PCR process in real time, and measures the number of target sequences by detecting accurate Ct values. This technology has achieved a leap from qualitative to quantitative PCR, greatly promoting the development of molecular diagnostic technology.

[0003] To obtain accurate Ct values ​​in real-time fluorescence quantitative PCR, the fluorescent signal generated during the PCR thermal cycle needs to be combined with the reference dye, and the sample signal needs to be normalized before data analysis. Reference dyes are a type of fluorescent dye that does not interact with the components of the nucleic acid amplification reaction, does not participate in DNA amplification, and does not affect the efficiency of the amplification reaction, but can normalize the dye fluorescence signal to improve data accuracy and repeatability between repeated reactions. Due to the differences in excitation optical design between different instrument platforms, some instruments use high concentrations of reference dyes for normalization, while others use low concentrations of reference dyes. On instruments that use high concentrations of reference dyes, such as ABI Stepone, the light source is laser-based with an excitation wavelength of 480nm. When using ROX reference dyes with the maximum absorbance at 580nm for signal normalization, lasers with an excitation wavelength of 480nm cannot effectively excite it. In order to compensate for the low excitation efficiency of ROX reference dyes, very high concentrations of ROX reference dyes must be used to collect enough signals for normalization. On instruments that use low-concentration reference dyes, such as the ABI 7500, a broad-spectrum light source is used, which is then divided into four excitation wavelengths using filters for the corresponding channels. The collected emission signals are normalized to the appropriate channel for detection and analysis using the calibration file corresponding to the ROX reference dye. Therefore, the ROX reference dye can be maximally excited in the "ROX" channel and generate sufficient signals for normalization without the need for high-concentration ROX reference dyes. This results in the need to prepare reference dye ROX solutions of different concentrations according to different instruments, and they need to be stored separately from the Mix component of the original kit, which is very inconvenient to use.

[0004] To solve this problem, Bio-Rad proposed the use of a class of fluorescent dyes in 2011. The excitation wavelength of this type of long Stokes shift fluorescent dye is 470-560nm, and the emission wavelength is 590-620nm. This type of fluorescent dye needs to be mixed with a low concentration of ROX reference dye. When used on an instrument with a low concentration of reference dye, the fluorescence signal generated by this type of dye and the ROX reference dye will be normalized to the ROX channel through the calibration file corresponding to the ROX reference dye for detection and analysis. When used on an instrument with a high concentration of reference dye, the dye will be effectively excited to generate sufficient signal for normalization.

[0005] At present, the most effective existing technology is the ROX mixed dye, but it has the objective problem of inconvenience in mixing the two reagents and the mixing ratio affecting the results. Therefore, it is necessary to develop new dyes that do not interact with the components of the nucleic acid amplification reaction, do not participate in DNA amplification, and do not affect the efficiency of the amplification reaction. In particular, it can directly replace ROX on instruments that require reference dyes without mixing with other dyes. Summary of the invention

[0006] In view of the above-mentioned technical problems, the purpose of the present invention is to provide a synthesis process scheme and application method for a fluorescent quantitative PCR reference dye. The fluorescent quantitative PCR reference dye of the present invention is a fluorescent dye with a long Stokes shift, has an excitation wavelength of 480, and a large Stokes shift. The dye of the present invention does not interact with the components of the nucleic acid amplification reaction, does not participate in DNA amplification, does not affect the efficiency of the amplification reaction, and can directly replace ROX on instruments that require reference dyes without being mixed with other dyes.

[0007] The present invention adopts the following technical solution: A fluorescent quantitative PCR reference dye, whose chemical structure is as follows: ; Among them, n is 1-20, preferably, n is 2-18, more preferably, n is 3-15, more preferably, n is 4-12, more preferably, n is 5-10, and most preferably, n is 6-8.

[0008] The dye of the present invention does not interact with components of nucleic acid amplification reaction, does not participate in DNA amplification, and does not affect the efficiency of amplification reaction. In particular, the dye can directly replace ROX on instruments that require reference dyes without being mixed with other dyes.

[0009] The invention discloses a method for preparing the fluorescent quantitative PCR reference dye. The method uses 5-carboxyfluorescein succinimidyl ester and intermediate II as raw materials to react and prepare the fluorescent quantitative PCR reference dye.

[0010] In the above technical scheme, the molar ratio of 5-carboxyfluorescein succinimidyl ester to intermediate II is 1:(0.8-1.2), preferably, the molar ratio is 1:(0.9-1.1), and the most preferred molar ratio is 1:1.

[0011] In the above technical solution, the reaction is carried out in the presence of an organic base; the organic base is an amine compound, such as an alkylamine compound.

[0012] In the above technical solution, the reaction time is 0.1 to 5 hours, preferably, the reaction time is 0.2 to 4 hours, further preferably, the reaction time is 0.3 to 3 hours, and most preferably, the reaction time is 0.4 to 2 hours, such as 0.5 to 1 hour.

[0013] In the above technical solution, the reaction temperature is -10°C to room temperature, preferably, the reaction temperature is -5 to 10°C, and more preferably, the reaction temperature is an ice bath.

[0014] In the present invention, intermediate I and an amine compound are used as raw materials to react and prepare intermediate II.

[0015] In the above technical scheme, the molar ratio of intermediate I to amine compound is 1:(0.8-1.2), preferably, the molar ratio is 1:(0.9-1.1), and the most preferred molar ratio is 1:0.9.

[0016] In the above technical solution, the reaction is carried out in the presence of an organic base; the organic base is an amine compound, such as an alkylamine compound.

[0017] In the above technical solution, the reaction time is 0.1 to 5 hours, preferably, the reaction time is 0.2 to 4 hours, further preferably, the reaction time is 0.3 to 3 hours, and most preferably, the reaction time is 0.4 to 2 hours, such as 0.5 to 1 hour.

[0018] In the above technical solution, the reaction temperature is -10°C to room temperature, preferably, the reaction temperature is -5 to 10°C, and more preferably, the reaction temperature is an ice bath.

[0019] In the present invention, raw material A and succinimide compound are used as raw materials to react and prepare intermediate I. Preferably, the succinimide compound is N,N,N',N'-tetramethyl-O-(N-succinimide) urea tetrafluoroborate.

[0020] In the above technical solution, the molar ratio of raw material A to succinimide compound is 1:(0.8-1.2), preferably, the molar ratio is 1:(1-1.1), and the most preferred molar ratio is 1:1.1.

[0021] In the above technical solution, the reaction is carried out in the presence of an organic base; the organic base is an amine compound, such as an alkylamine compound.

[0022] In the above technical solution, the reaction time is 0.1 to 5 hours, preferably, the reaction time is 0.2 to 4 hours, further preferably, the reaction time is 0.3 to 3 hours, and most preferably, the reaction time is 0.4 to 2 hours, such as 0.5 to 1 hour.

[0023] In the above technical solution, the reaction temperature is -10°C to room temperature, preferably, the reaction temperature is -5 to 10°C, and more preferably, the reaction temperature is an ice bath.

[0024] In the present invention, the chemical formula of the amine compound is H2N(CH2) n NH2; The chemical structures of raw material A, intermediate I and intermediate II are as follows:

[0025]

[0026]

[0027] The object of the present invention is to provide a synthesis process scheme and application method for a fluorescent quantitative PCR reference dye. The fluorescent quantitative PCR reference dye of the present invention is a fluorescent dye with a long Stokes shift, has an excitation wavelength of 480, and a large Stokes shift. The dye of the present invention does not interact with the components of the nucleic acid amplification reaction, does not participate in DNA amplification, does not affect the efficiency of the amplification reaction, and can directly replace ROX on an instrument that requires a reference dye without being mixed with other dyes. BRIEF DESCRIPTION OF THE DRAWINGS

[0028] In order to more clearly illustrate the technical solution of the present invention in the prior art, some applications of the present invention will be briefly described below.

[0029] Figure 1 Schematic diagram of the dye reaction of the present invention.

[0030] Figure 2 The figure is the mass spectrum of the dye of the present invention.

[0031] Figure 3 The emission and excitation wavelength spectra of the dye of the present invention.

[0032] Figure 4 The figure shows the performance test results of the Sybr Green Q-PCR mix mixed with a reference dye on the ABI 7500. Mix A contains Chromeo 494+ROX, and mix B contains the reference dye of the present invention.

[0033] Figure 5 The performance test results of the Sybr Green Q-PCR mix mixed with a reference dye on the ABI Stepone are shown. Mix A contains Chromeo 494+ROX, and mix B contains the reference dye of the present invention.

[0034] Figure 6 The figure shows the performance test results of the Sybr Green Q-PCR mix mixed with a reference dye on Roche LC96. Mix A contains Chromeo 494+ROX, and mix B contains the reference dye of the present invention. DETAILED DESCRIPTION

[0035] The present invention provides a synthesis process scheme and application method of a fluorescent quantitative PCR reference dye. The dye does not interact with components of a nucleic acid amplification reaction, does not participate in DNA amplification, and does not affect the efficiency of the amplification reaction. In particular, the dye can directly replace ROX on an instrument that requires a reference dye without being mixed with other dyes.

[0036] The present invention first uses raw material A and succinimide compound as raw materials to react and prepare intermediate I. Preferably, the succinimide compound is N,N,N',N'-tetramethyl-O-(N-succinimide) urea tetrafluoroborate.

[0037] In the reaction, the molar ratio of raw material A and succinimide compound is 1: (0.8-1.2), preferably, the molar ratio is 1: (1-1.1), and the most preferred molar ratio is 1: 1.1; the reaction is carried out in the presence of an organic base, and the organic base is an amine compound, such as an alkylamine compound; the reaction time is 0.1-5 hours, preferably, the reaction time is 0.2-4 hours, further preferably, the reaction time is 0.3-3 hours, and most preferably, the reaction time is 0.4-2 hours, such as 0.5-1 hour; the reaction temperature is -10°C to room temperature, preferably, the reaction temperature is -5-10°C, and further preferably, the reaction temperature is an ice bath.

[0038] Secondly, intermediate I and amine compounds are used as raw materials to react and prepare intermediate II.

[0039] In the reaction, the molar ratio of intermediate I and amine compound is 1: (0.8-1.2), preferably, the molar ratio is 1: (0.9-1.1), and the most preferred molar ratio is 1: 0.9; the reaction is carried out in the presence of an organic base, and the organic base is an amine compound, such as an alkylamine compound; the reaction time is 0.1-5 hours, preferably, the reaction time is 0.2-4 hours, further preferably, the reaction time is 0.3-3 hours, and most preferably, the reaction time is 0.4-2 hours, such as 0.5-1 hour; the reaction temperature is -10°C to room temperature, preferably, the reaction temperature is -5-10°C, and further preferably, the reaction temperature is an ice bath.

[0040] Finally, the fluorescent quantitative PCR reference dye was prepared by reaction using 5-carboxyfluorescein succinimidyl ester and intermediate II as raw materials.

[0041] In the reaction, the molar ratio of 5-carboxyfluorescein succinimide ester to intermediate II is 1:(0.8-1.2), preferably, the molar ratio is 1:(0.9-1.1), and the most preferred molar ratio is 1:1; the reaction is carried out in the presence of an organic base, which is an amine compound, such as an alkylamine compound; the reaction time is 0.1-5 hours, preferably, the reaction time is 0.2-4 hours, further preferably, the reaction time is 0.3-3 hours, and most preferably, the reaction time is 0.4-2 hours, such as 0.5-1 hour; the reaction temperature is -10°C to room temperature, preferably, the reaction temperature is -5-10°C, and further preferably, the reaction temperature is an ice bath.

[0042] Specifically, the preparation method of the above-mentioned fluorescent quantitative PCR reference dye is as follows: (1) Mix the starting material A and the solvent, then add DIPEA (N,N-diisopropylethylamine), stir, and then add tstu (N,N,N′,N′-tetramethyl-O-(N-succinimidyl) urea tetrafluoroborate) to react to obtain intermediate I as a purple solid; (2) The intermediate I is mixed with a solvent, TEA is added, and after stirring, an amine compound is added to obtain intermediate II, a purple solid; (3) The intermediate II was mixed with a solvent, and TEA was added. After stirring, 5-FAM SE (5-carboxyfluorescein succinimidyl ester) was added to obtain the final product, a purple solid.

[0043] The above reaction was carried out in an ice bath.

[0044] In the above reaction, the solvent is an organic solvent, such as DMF.

[0045] After each step of the above reaction is completed, the corresponding product is obtained through conventional purification steps.

[0046] For example, after the reaction in step (1) is completed, the reaction solution is dried by spin drying, EA / ACN (preferably in a volume ratio of 10 / 1) solvent is added to slurry for 1 to 5 hours, centrifuged, the supernatant is discarded, and the slurry is repeated. The product is dried to obtain intermediate I as a purple solid.

[0047] For example, after the reaction in step (2) is completed, the reaction solution is dried by spin drying, and the liquid phase is freeze-dried to obtain intermediate II as a purple solid.

[0048] For example, after the reaction in step (3) is completed, the reaction solution is spin-dried and the liquid phase is freeze-dried to obtain the final product, a purple solid.

[0049] The invention discloses the application of a fluorescent quantitative PCR reference dye as a fluorescent dye.

[0050] The invention discloses a fluorescence quantitative PCR system, comprising the fluorescence quantitative PCR reference dye.

[0051] The invention discloses a fluorescence quantitative PCR detection method, which includes amplifying the fluorescence quantitative PCR system and then detecting the Ct value to complete the fluorescence quantitative PCR detection.

[0052] The invention discloses the application of the fluorescent quantitative PCR reference dye in fluorescent quantitative PCR.

[0053] The invention discloses the application of the fluorescent quantitative PCR reference dye in replacing ROX and its mixed dye, especially the application of the fluorescent quantitative PCR reference dye in replacing ROX and its mixed dye in fluorescent quantitative PCR detection.

[0054] The present invention is further described in detail below in conjunction with specific examples, which are only used to illustrate the present invention. The raw materials involved in the present invention are all conventional commercially available raw materials, and the methods for preparing the buffer solution and the reagents are conventional techniques.

[0055] Example 1 Preparation of fluorescent quantitative PCR reference dye Figure 1 , the product is as follows:

[0056] The specific preparation method comprises the following steps: In a 100 ml single-necked bottle, add starting material A (5.9 g) and 50 ml of DMF solvent. After ice bathing for 15 minutes, add 5 equivalents of DIPEA (N,N-diisopropylethylamine). After stirring for 15 minutes, add 1.1 equivalents of tstu (N,N,N′,N′-tetramethyl-O-(N-succinimidyl) uronium tetrafluoroborate, 3.3 g). The reaction is completed in one hour. The reaction solution is spin-dried, and 220 mL of EA / ACN=10 / 1 (EA: ethyl acetate; ACN: acetonitrile) mixed solvent is added to slurry for two hours. Centrifuge, pour off the supernatant, repeat slurrying once, and the product is vacuum dried at room temperature overnight to constant weight to obtain 4.1 g of intermediate I as a purple solid with a yield of 59%.

[0057] The intermediate I (0.69 g) was placed in a 100 ml single-mouth bottle and 25 ml of DMF was added. After ice bathing for 15 minutes, 5 equivalents of TEA (triethylamine) were added. After stirring for 20 minutes, 0.9 equivalents of hexamethylenediamine (0.12 g) were added. The reaction was completed in half an hour. The reaction liquid was spin-dried and the liquid phase was freeze-dried to obtain 0.35 g of intermediate II as a purple solid with a yield of 51%.

[0058] The intermediate II (0.35 g) was placed in a 100 ml single-mouth bottle and added with 10 ml of DMF. After ice bathing for 15 minutes, 2 equivalents of TEA were added. After stirring for 20 minutes, an equivalent of 5-FAM SE (5-carboxyfluorescein succinimidyl ester, 0.24 g) was added. The reaction was completed in half an hour. The reaction solution was spin-dried and liquid phase preparation was freeze-dried to obtain the final product (fluorescence quantitative PCR reference dye) 0.36 g, purple solid, with a yield of 66%; Figure 2 is the mass spectrum of the product, C 62 H 57 N5O 11 Molecular weight: 1047.40. Figure 3 The emission and excitation wavelength spectra of the final product are shown above, with the left one being the excitation and the right one being the emission.

[0059] Example 2 Q-PCR test using the reference dye of the present invention 1. Q-PCR amplification system:

[0060] This is a conventional Sybr Green Q-PCR mix. DY-510XL+ROX (A) and the dye of the present invention (B) are respectively prepared as A mix and B mix according to the amplification system in the above table. Except for the difference in fluorescent dyes, the preparation of the other components in the two mixes A and B is exactly the same. Except for the dye of the present invention, other reagents are existing commercially available products; wherein the ratio of DY-510XL to ROX is 5 (DY-510XL) : 1 (ROX), the forward primer is CACCCACACTGTGCCCATCTACGA, and the reverse primer is CAGCGGAACCGCTCATTGCCAATGG. The amount of DNA template added is usually less than 100 ng, and the amount of cDNA added as a template should not exceed 10% of the system.

[0061] 2. Q-PCR reaction conditions

[0062] Briefly describe the test steps Instruments and equipment: Fresco 17 high-speed refrigerated centrifuge, SPARK microplate reader, electrophoresis instrument, gene amplification instrument, LightCycler 96 fluorescence quantitative PCR instrument, 7500 real-time fluorescence quantitative PCR system, StepOnePlus real-time fluorescence quantitative PCR system (ABI), etc. are all conventional equipment.

[0063] Reagents: K562 human chronic myeloid leukemia cells (CL0130 from Wuhan Pronocell Life Science Co., Ltd.), total RNA extraction kit (DP419 from Tiangen Biotechnology Co., Ltd.), reverse transcription kit (R2020 from Suzhou Youyi Landi Biotechnology Co., Ltd.); all reagents are domestically produced analytical grade and are conventional products.

[0064] K562 cell RNA was extracted according to the kit instructions, and the extracted RNA was stored at -80°C. After obtaining the total RNA, the extraction concentration of the total RNA was detected using a SPARK microplate reader, and the integrity of the total RNA fragments was detected using an electrophoresis device. The results showed that the quality of the RNA extracted by the kit met the template quality requirements for the subsequent reverse transcription reaction; then cDNA reverse transcription was performed according to the reverse transcription kit instructions, the RNA transcription amount was 1 μg / tube, and the synthesized cDNA was stored at -20°C.

[0065] When preparing the qPCR amplification system, the initial cDNA positive template concentration was controlled at 10-100 ng / ul, and the template was gradiently diluted 10 times, 100 times, 1000 times, 10000 times, and 100000 times before the reaction.

[0066] Take 1 mg of DY-510XL, add 0.1 mL of anhydrous DMSO, vortex to dissolve, add 3.5 mL of diH2O, vortex to mix, and prepare a stock solution; take 1 mg of ROX, add 0.6 mL of anhydrous DMSO, vortex to dissolve, add 67 mL of diH2O, vortex to mix, and prepare a stock solution.

[0067] Specific test results are as follows Figure 4 , Figure 5 as well as Figure 6 shown.

[0068] According to the Q-PCR reaction amplification system, template cDNA / DNA, PCR Buffer, Sybr green, dNTP, Taq enzyme, fluorescent dye: (A) DY-510XL+ROX / (B) the present invention, primer-F, primer-R, and water were added for preparation.

[0069] The qPCR system configured above was divided into 96-well plates. For each sample, 18 μl was added to each well, and finally 2 μl of cDNA was added to each well. Mark the wells in the gradient order and centrifuge at 2000 rpm for 2 minutes.

[0070] Turn on the qPCR instrument and set the reaction program according to the table above to perform real-time fluorescence quantitative PCR amplification reaction. After the amplification is completed, analyze the amplification curve and melting curve and other information.

[0071] Figure 4 The figure shows the performance test results of the Sybr Green Q-PCR mix mixed with two reference dyes on ABI 7500. A mix (blue) is mixed with DY-510XL+ROX, and B mix (red) is mixed with the reference dye of the present invention.

[0072] Figure 5 The figure shows the performance test results of the Sybr Green Q-PCR mix mixed with two reference dyes on the ABI Stepone. A mix (purple) is mixed with DY-510XL+ROX, and B mix (green) is mixed with the reference dye of the present invention.

[0073] Figure 6 The performance test results of the Sybr Green Q-PCR mix mixed with a reference dye on the Roche LC 96 are shown in Figure 1. A mix (red) is mixed with DY-510XL+ROX, and B mix (blue) is mixed with the reference dye of the present invention.

[0074] From the test results, it can be seen that the technical effect of the fluorescent dye produced by the present invention is equivalent to or even slightly better than the effect of DY-510XL+ROX, which is considered the best in the prior art, and neither DY-510XL nor ROX is suitable for single use. It can be seen that the present invention synthesizes a new dye compound, and the technical effect achieved by using it for real-time fluorescence quantitative PCR is equivalent to or even better than the technical effect of the dye considered good in the prior art. In particular, the present invention overcomes the technical prejudice of the prior art that only mixed dyes can achieve universal and good technical effects, and uses only one dye in a variety of test scenarios, and each test result is excellent.

Claims

1. A fluorescent quantitative PCR reference dye, whose chemical structure is as follows: ； in, n is 1 to 20.

2. The method for preparing the fluorescent quantitative PCR reference dye according to claim 1, characterized in that: The fluorescent quantitative PCR reference dye is prepared by reaction using 5-carboxyfluorescein succinimidyl ester and intermediate II as raw materials; the intermediate II is as follows: 。 3. The method for preparing the fluorescent quantitative PCR reference dye according to claim 2, characterized in that: Intermediate I and amine compounds are used as raw materials to react and prepare intermediate II; the chemical formula of the amine compound is H2N (CH2) n NH2; the intermediate I is as follows: 。 4. The method for preparing the fluorescent quantitative PCR reference dye according to claim 3, characterized in that: Using raw material A and succinimide compound as raw materials, intermediate I is prepared by reaction; the raw material A is as follows: 。 5. The method for preparing the fluorescent quantitative PCR reference dye according to claim 2, claim 3 or claim 4, characterized in that: The reaction time is 0.1 to 5 hours; the reaction temperature is -10°C to room temperature.

6. Use of the fluorescent quantitative PCR reference dye according to claim 1 as a fluorescent dye.

7. A fluorescent quantitative PCR system, characterized in that: It comprises the fluorescent quantitative PCR reference dye as claimed in claim 1.

8. A fluorescent quantitative PCR detection method, characterized in that: Amplify the fluorescent quantitative PCR system described in claim 7, and then detect the Ct value to complete the fluorescent quantitative PCR detection.

9. Use of the fluorescent quantitative PCR reference dye according to claim 1 in fluorescent quantitative PCR.

10. Use of the fluorescent quantitative PCR reference dye according to claim 1 in replacing ROX and its mixed dye.

Images