Cacna1h Mutants and Their Applications
By introducing Cacna1h protein and gene mutants into animal models, an airway stenosis model that conforms to the human gene mutation method was constructed, which solved the problem of inaccurate existing models and achieved effective diagnosis and treatment of airway stenosis.
Patent Information
- Application Number
- CN202411376022.8
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-09-29
- Publication Date
- 2025-07-29
- Estimated Expiration
- 2044-09-29
AI Technical Summary
The existing animal models of airway stenosis do not conform to the human gene mutation method, resulting in the inability to effectively clarify the pathogenesis and drug development of airway stenosis.
Cacna1h protein mutant (p.S1436P) and Cacna1h gene mutant (c.T4036C) are provided. These mutations are introduced in animal models through gene editing technology to construct an airway stenosis model that is more in line with the human gene mutation method.
The established animal model more accurately simulates the human airway stenosis, which can be used for the diagnosis, monitoring, efficacy evaluation and prognosis evaluation of airway stenosis, and achieves the effect of preventing and treating airway stenosis by restoring the mutant to the wild type.
Smart Images

Figure HDA0005068868590000011 
Figure HDA0005068868590000021 
Figure HDA0005068868590000022
Abstract
Description
Technical Field
[0001] The present invention belongs to the field of biotechnology, and particularly relates to a Cacna1h mutant and its application. Background Art
[0002] The trachea starts from the laryngeal prominence and extends to the bronchi of the lungs. It is the only channel for mammals, including humans, to perform exhalation and gas exchange. The human trachea is composed of cartilage, smooth muscle, connective tissue and epithelium, about 13 cm long and about 2 cm in diameter, passing 30 to 120 liters of gas per minute, playing the role of purifying, moistening and warming the inhaled air. Trachea-related diseases include airway stenosis, airway collapse, etc., which are one of the main factors threatening human health. Currently, there are few animal models of airway stenosis. Establishing a new animal model of airway stenosis is of great significance for clarifying the pathogenesis of airway stenosis and drug development.
[0003] Mice are currently good models for studying mammalian airway stenosis: Mice are closely related to humans, and the structure and morphology of the trachea are very similar to those of humans; techniques such as gene knockout and chemical mutagenesis can quickly and effectively establish a series of animal models of airway diseases (including airway stenosis). Currently, the animal models of airway stenosis established by gene knockout methods include the airway stenosis animal model with Cacna1h gene knockout. However, it does not conform to the human gene mutation mode. In humans, gene point mutations mainly lead to abnormal gene functions. Therefore, it is necessary to find out the Cacna1h mutant or mutation site that causes airway stenosis. Summary of the Invention
[0004] The purpose of the first aspect of the present invention is to provide a Cacna1h protein mutant.
[0005] The purpose of the second aspect of the present invention is to provide a Cacna1h gene mutant.
[0006] The purpose of the third aspect of the present invention is to provide an expression cassette, vector or cell containing the Cacna1h gene mutant of the second aspect of the present invention.
[0007] The purpose of the fourth aspect of the present invention is to provide the application of a reagent for detecting the Cacna1h protein mutant of the first aspect of the present invention or the Cacna1h gene mutant of the second aspect of the present invention in the preparation of products for the diagnosis, monitoring, efficacy evaluation, or prognosis evaluation of airway stenosis.
[0008] The purpose of the fifth aspect of the present invention is to provide a product for the diagnosis, monitoring, efficacy evaluation, or prognosis evaluation of airway stenosis.
[0009] The object of the sixth aspect of the present invention is to provide the application of the Cacna1h protein mutant of the first aspect of the present invention, the Cacna1h gene mutant of the second aspect of the present invention, or the expression cassette, vector or cell of the third aspect of the present invention in constructing an animal model of airway stenosis or preparing a product for constructing an animal model of airway stenosis.
[0010] The object of the seventh aspect of the present invention is to provide a method for constructing an animal model of airway stenosis.
[0011] The object of the eighth aspect of the present invention is to provide the application of the animal model constructed according to the seventh aspect of the present invention.
[0012] The object of the ninth aspect of the present invention is to provide the application of a reagent that specifically modifies the Cacna1h protein mutant of the first aspect of the present invention or the Cacna1h gene mutant of the second aspect of the present invention in preparing a drug for preventing and / or treating airway stenosis.
[0013] The object of the tenth aspect of the present invention is to provide a pharmaceutical composition for preventing and / or treating airway stenosis.
[0014] In order to achieve the above object, the technical solution adopted by the present invention is:
[0015] The first aspect of the present invention provides a Cacna1h protein mutant, which has the following mutation compared with the wild-type Cacna1h protein: p.S1436P.
[0016] In some embodiments, the amino acid sequence of the wild-type Cacna1h protein is as shown in SEQ ID NO:1.
[0017] The second aspect of the present invention provides a Cacna1h gene mutant, and the nucleotide sequence of the mutant is the sequence of DNA encoding the Cacna1h protein mutant of the first aspect of the present invention.
[0018] In some embodiments, the mutant has the following mutation compared with the wild-type Cacna1h gene: c.T4036C.
[0019] In some embodiments, the nucleotide sequence of the wild-type Cacna1h gene is as shown in SEQ ID NO:2.
[0020] The third aspect of the present invention provides an expression cassette, vector or cell containing the Cacna1h gene mutant of the second aspect of the present invention.
[0021] In some embodiments, the vector includes a prokaryotic expression vector and a eukaryotic expression vector.
[0022] In some embodiments, the eukaryotic expression vector includes a yeast expression vector, a mammalian expression vector, an insect expression vector, etc.
[0023] In some embodiments, the cell does not contain reproductive materials.
[0024] In some embodiments, the cell is selected from prokaryotic cells and eukaryotic cells.
[0025] In some embodiments, the prokaryotic cells include bacterial cells, Escherichia coli, and Streptomyces.
[0026] In some embodiments, the eukaryotic cells include yeast cells, mammalian cells, insect cells, etc.
[0027] In some embodiments, the mammalian cells include CHO cells, 293 cells, 293T cells, Vero cells, BHK cells, NS0 cells, SP2 / 0 cells, YO myeloma cells, P3X63 mouse myeloma cells, PER cells, PER.C6 cells, or hybridoma cells.
[0028] The fourth aspect of the present invention provides the use of a reagent for detecting the Cacna1h protein mutant of the first aspect of the present invention or the Cacna1h gene mutant of the second aspect of the present invention in the preparation of a product for the diagnosis, monitoring, efficacy evaluation, or prognosis evaluation of airway stenosis.
[0029] In some embodiments, the reagent for detecting the Cacna1h protein mutant of the first aspect of the present invention or the Cacna1h gene mutant of the second aspect of the present invention includes a reagent for quantitatively detecting the Cacna1h protein mutant of the first aspect of the present invention or the Cacna1h gene mutant of the second aspect of the present invention.
[0030] In some embodiments, the reagent for the Cacna1h protein mutant of the first aspect of the present invention or the Cacna1h gene mutant of the second aspect of the present invention includes a reagent for detecting the Cacna1h protein mutant of the first aspect of the present invention or the Cacna1h gene mutant of the second aspect of the present invention at the gene level or protein level.
[0031] In some embodiments, the reagent includes reagents for one or more detection techniques or methods selected from the group consisting of immunohistochemistry, Western blotting, Northern blotting, PCR, biochip method, nucleic acid sequencing, amino acid sequencing, high performance liquid chromatography, capillary gel electrophoresis, near-infrared spectroscopy, mass spectrometry, surface plasmon resonance technology, immunological PCR technology, and biotin-avidin technology.
[0032] In some embodiments, the immunohistochemistry method includes at least one of enzyme-linked immunosorbent assay, immunofluorescence assay, radioimmunoassay, immunoprecipitation, immunochemiluminescence assay, colloidal gold immunotechnology, fluorescence immunochromatography technology, complement fixation analysis, flow cytometry fluorescence resolution, and single molecule detection technology.
[0033] In some embodiments, the reagents for detecting the Cacna1h protein mutant of the first aspect of the present invention or the Cacna1h gene mutant of the second aspect of the present invention are selected from:
[0034] An antibody, ligand protein, polypeptide, non-protein compound, or nucleic acid aptamer specific for the Cacna1h protein mutant of the first aspect of the present invention; or
[0035] A probe or primer specific for the Cacna1h gene mutant of the second aspect of the present invention.
[0036] In some embodiments, the antibody includes at least one of polyclonal antibody, monoclonal antibody, single-chain antibody, functional antibody fragment, antibody Fab region, nanobody, chimeric antibody, and multispecific antibody.
[0037] In some embodiments, the product is a reagent, kit, test plate, test strip, device, system, or chip.
[0038] In some embodiments, the product further includes reagents for detecting other aspects for the diagnosis, monitoring, efficacy evaluation, and / or prognosis evaluation of airway stenosis.
[0039] In some embodiments, the product further includes a reagent for assisting in detecting gene expression levels, and the reagent for assisting in detecting gene expression levels includes at least one of a reaction reagent for visualizing the amplicon corresponding to the primer, an RNA extraction reagent, a reverse transcription reagent, a cDNA amplification reagent, a standard for preparing a standard curve, and a positive control.
[0040] In some embodiments, the product further includes a reagent for assisting in detecting protein expression levels, and the reagent for assisting in detecting protein expression levels includes at least one of a chromogenic agent, a blocking solution, an antibody diluent, a washing buffer, a chromogenic termination solution, a standard for preparing a standard curve, and a positive control.
[0041] In some embodiments, the test sample of the product is selected from at least one of the body fluid, tissue, cell, and excrement of the subject to be tested.
[0042] In some embodiments, the body fluid includes at least one of blood, lymph fluid, pleural effusion, cerebrospinal fluid, synovial fluid, ascites, saliva, lymph fluid, and internal fluid accumulation.
[0043] In some embodiments, the blood includes at least one of serum, plasma, dried blood spot, and whole blood.
[0044] In some embodiments, the excrement includes at least one of urine, feces, and tears.
[0045] In some embodiments, the subject to be tested includes an animal; further includes a mammal, such as a human, a cat, a cow, a sheep, a pig, a dog, a chicken, a duck, a goose, a rabbit, a mouse; more specifically a mouse; even more specifically a small mouse.
[0046] A fifth aspect of the present invention provides a product for diagnosing, monitoring, evaluating the efficacy, or prognosticating airway stenosis, comprising: an antibody, a ligand protein, a polypeptide, a non-protein compound, or a nucleic acid aptamer that is specific for the Cacna1h protein mutant of the first aspect of the present invention; or
[0047] A probe or primer that is specific for the Cacna1h gene mutant of the second aspect of the present invention.
[0048] In some embodiments, the antibody includes at least one of a polyclonal antibody, a monoclonal antibody, a single-chain antibody, a functional antibody fragment, an antibody Fab region, a nanobody, a chimeric antibody, and a multispecific antibody.
[0049] In some embodiments, the product is a reagent, a kit, a test plate, a test strip, a device, a system, or a chip.
[0050] In some embodiments, the product further includes reagents for diagnosing, monitoring, evaluating the efficacy, and / or prognosticating other airway stenosis.
[0051] In some embodiments, the product further includes a reagent for assisting in detecting gene expression levels, and the reagent for assisting in detecting gene expression levels includes at least one of a reaction reagent for visualizing an amplicon corresponding to a primer, an RNA extraction reagent, a reverse transcription reagent, a cDNA amplification reagent, a standard for preparing a standard curve, and a positive control.
[0052] In some embodiments, the product further includes a reagent for assisting in detecting protein expression levels, and the reagent for assisting in detecting protein expression levels includes at least one of a chromogenic agent, a blocking solution, an antibody diluent, a washing buffer, a chromogenic termination solution, a standard for preparing a standard curve, and a positive control.
[0053] In some embodiments, the test sample of the product is selected from at least one of the body fluid, tissue, cell, and excrement of the subject to be tested.
[0054] In some embodiments, the body fluid includes at least one of blood, lymph, pleural effusion, cerebrospinal fluid, synovial fluid, ascites, saliva, lymph, and internal body fluid.
[0055] In some embodiments, the blood includes at least one of serum, plasma, dried blood spot, and whole blood.
[0056] In some embodiments, the excrement includes at least one of urine, feces, and tears.
[0057] In some embodiments, the object to be tested includes an animal; further includes a mammal, such as a human, a cat, a cow, a sheep, a pig, a dog, a chicken, a duck, a goose, a rabbit, a mouse; more specifically a mouse; even more specifically a small mouse.
[0058] The sixth aspect of the present invention provides the application of the Cacna1h protein mutant of the first aspect of the present invention, the Cacna1h gene mutant of the second aspect of the present invention, or the expression cassette, vector, or cell of the third aspect of the present invention in constructing an animal model of airway stenosis or preparing a product for constructing an animal model of airway stenosis.
[0059] In some embodiments, the animal is a non-human mammal.
[0060] In some embodiments, the non-human mammal is a cat, a cow, a sheep, a pig, a dog, a chicken, a duck, a goose, a rabbit, or a mouse; more specifically a mouse; even more specifically a small mouse.
[0061] The seventh aspect of the present invention provides a method for constructing an animal model of airway stenosis, enabling the animal to carry the Cacna1h protein mutant of the first aspect of the present invention or the Cacna1h gene mutant of the second aspect of the present invention.
[0062] In some embodiments, the animal carries a homozygous mutant.
[0063] In some embodiments, the animal is a non-human mammal.
[0064] In some embodiments, the non-human mammal is a cat, a cow, a sheep, a pig, a dog, a chicken, a duck, a goose, a rabbit, or a mouse; more specifically a mouse; even more specifically a small mouse.
[0065] The eighth aspect of the present invention provides the application of the animal model constructed according to the seventh aspect of the present invention in any one of a1)-a2):
[0066] a1) Screening or developing drugs;
[0067] a2) Preparing a product for screening or developing drugs;
[0068] The drug is used for preventing and / or treating airway stenosis.
[0069] In the ninth aspect of the present invention, there is provided the use of a reagent for specifically altering the Cacna1h protein mutant of the first aspect of the present invention or the Cacna1h gene mutant of the second aspect of the present invention in the preparation of a drug for preventing and / or treating airway stenosis; the specific alteration is to restore the Cacna1h protein mutant of the first aspect of the present invention or the Cacna1h gene mutant of the second aspect of the present invention to the wild type.
[0070] In some embodiments, the reagent is a reagent based on at least one of gene editing methods selected from single-base gene editing, zinc finger nucleases, transcription activator-like effector nucleases, CRISPR / Cas9, CRISPR / Cas9 combined with iPSC and AAV vector technology.
[0071] In the tenth aspect of the present invention, there is provided a pharmaceutical composition for preventing and / or treating airway stenosis, comprising: a reagent for specifically altering the Cacna1h protein mutant of the first aspect of the present invention or the Cacna1h gene mutant of the second aspect of the present invention; the specific alteration is to restore the Cacna1h protein mutant of the first aspect of the present invention or the Cacna1h gene mutant of the second aspect of the present invention to the wild type.
[0072] In some embodiments, the reagent is a reagent based on at least one of gene editing methods selected from single-base gene editing, zinc finger nucleases, transcription activator-like effector nucleases, CRISPR / Cas9, CRISPR / Cas9 combined with iPSC and AAV vector technology.
[0073] In some embodiments, the pharmaceutical composition further comprises: a pharmaceutically acceptable carrier.
[0074] In some embodiments, the pharmaceutical composition further comprises: other active ingredients for preventing and / or treating airway stenosis.
[0075] The beneficial effects of the present invention are:
[0076] The present invention discloses for the first time a Cacna1h protein mutant. Compared with the wild-type Cacna1h protein, the following mutations exist in this mutant: p.S1436P. This mutant is related to airway stenosis and can be used as a diagnosis and treatment target for airway stenosis. By detecting this mutant, airway stenosis can be diagnosed, monitored, evaluated for treatment efficacy, or prognosis. By reversing this mutant to the wild-type, the effect of preventing and treating airway stenosis can be achieved. Moreover, this mutant can be used to construct an animal model of airway stenosis. Different from the traditional method of large gene fragment deletion (such as the deletion of introns and exons, which can also inactivate genes and establish corresponding animal models, but this does not conform to the gene mutation mode in the human body and may bring some side effects caused by large fragment deletion, such as the deletion of some intron regions may lead to changes in the expression of regulated genes and then result in unpredictable gene expression disorders), it is more in line with the human gene mutation mode, and the obtained animal model is more in line with the animal disease model of human diseases. BRIEF DESCRIPTION OF THE DRAWINGS
[0077] Figure 1 Showing that mice with missense mutations in the Cacna1h gene (Cacna1h T4306C / T4306C ) exhibit obvious airway stenosis lesions: Among them, a shows the bright-field images of the tracheas of neonatal wild-type mice and neonatal mutant mice (Cacna1h T4306C / T4306C ) (scale bar: 1000 μm); b shows the Alcian blue staining images of the tracheas of neonatal wild-type mice and neonatal mutant mice (Cacna1h T4306C / T4306C ) (scale bar: 1000 μm); c shows the quantitative statistical results of the complete tracheal rings of neonatal wild-type mice and neonatal mutant mice (Cacna1h T4306C / T4306C ); d shows the hematoxylin-eosin (H&E) staining images of the frozen sections of the tracheas of neonatal wild-type mice and neonatal mutant mice (Cacna1h T4306C / T4306C ) (scale bar: 200 μm); e shows the quantitative statistical results of the tracheal width of neonatal wild-type mice and neonatal mutant mice (Cacna1h T4306C / T4306C ); f shows the quantitative statistical results of the relative area of the tracheal lumen of neonatal wild-type mice and neonatal mutant mice (Cacna1h T4306C / T4306C ); g shows the confirmation of the point mutation in the Cacna1h gene in neonatal airway stenosis mice by whole exome sequencing (Cacna1h T4306C / T4306C ); h shows the confirmation of the point mutation in the Cacna1h gene in neonatal airway stenosis mice by first-generation sequencing (Cacna1h T4306C / T4306C ); i shows the neonatal wild-type mice and neonatal Cacna1h gene knockout mice (Cacna1h - / -Alcian blue staining of the trachea of (scale bar: 1000 μm); j shows neonatal wild-type mice and neonatal Cacna1h double heterozygous mice (Cacna1h - / T4306C ) Alcian blue staining of the trachea (scale bar: 1000 μm); c, e, f are based on 5 wild-type animals and 5-6 mutant animals, and the experiments and statistics are repeated 3 times.
[0078] Figure 2 Showing that mice with missense mutations in the Cacna1h gene (Cacna1h T4306C / T4306C ) showed a significant reduction in airway smooth muscle area and contractile dysfunction: among them, a shows the staining results of the tracheal smooth muscle marker αSMA in neonatal wild-type mice and neonatal mutant mice (Cacna1h T4306C / T4306C ) (scale bar: 200 μm); b shows the tracheal contractility test of wild-type mice and mutant mice (Cacna1h T4306C / T4306C ) on the 14th day after birth; b is based on 4 wild-type animals and 4 mutant animals, and the experiments and statistics are repeated 3 times.
[0079] Figure 3 Showing a down-regulation of Cacna1h protein expression in the airway tissues of clinical patients with airway stenosis: among them, a shows the bronchoscopic airway images of healthy people and clinical patients with airway stenosis; b shows the HE staining of airway tissues of healthy people and clinical patients with airway stenosis (scale bar: 500 μm); c shows the Cacna1h antibody staining and nuclear DAPI staining of airway tissues of healthy people and clinical patients with airway stenosis (scale bar: 50 μm); d shows the quantitative analysis results of the fluorescence intensity of Cacna1h antibody staining in airway tissues of healthy people and clinical patients with airway stenosis; e shows the immunohistochemical staining of Cacna1h antibody in airway tissues of healthy people and clinical patients with airway stenosis (scale bar: 100 μm); d is based on 5 healthy people and 6 clinical patients with airway stenosis, and the experiments and statistics are repeated 3 times. Detailed implementation mode
[0080] The content of the present invention will be further described in detail below through specific examples.
[0081] It should be understood that these examples are only used to illustrate the present invention and not to limit the scope of the present invention.
[0082] The experimental methods without specific conditions noted in the following examples are usually carried out under conventional conditions or according to the conditions recommended by the manufacturer. The materials, reagents, etc. used in this example are, unless otherwise specified, reagents and materials obtained from commercial sources. For reagents with the manufacturer indicated, similar products from other manufacturers are substitutable.
[0083]
[0084] cccaggccacgggccaccagactctgagtctgtgcacagtatctaccatgctgactgccacgtggaggggccacaggaaagagcccgtgtg
[0085] gcgcacaccatagccactgctgccagcctcaagctggcctcaggcttgggcaccatgaactaccccaccatcctaccttcaggagcagtcaa
[0086] cagcaaaggcagtaccagctcgcgacccaaggggcttcggagtgctggcaccccaggggccacagcacacagccctctgagcctgggga
[0087] gccccagcccctatgagaagatccagcacgtggttggagaacaaggactaggccgagcctctagtcacctgtcaggcctgagtgtgccttgc
[0088] cccctgcccagcccccaggctggcacactgacctgtgagctgaagagctgcccatattgtgccagcgccctggaggaccccgagtttgagtt
[0089] cagtggctcagagagtggggactcggatgcccatggagtctatgagtttacacaggacgtacggcatggggattgccgagatcctgtgcagc
[0090] agccccatgaagggggcacgccgggccatggcaacgaacggtggcggccaccactgcggacagcctcacagccaggagggttaggccg
[0091] cctctgggcttcctttagtagcaagctgcgtcgcattgtagacagcaagtacttcaaccgaggcatcatggcagccatcctcgtcaatactctga
[0092] gcatgggtgttgagtatcatgagcagcctgatgagctgactaacgcgctggagataagcaacatcgtgttcaccagcatgtttgccttggagat
[0093] gctactgaagttgctggcctgtggcccgctgggctacattcggaacccctacaacatctttgatggcattgttgtcatcataagcgtctgggagat
[0094] tgtggggcaggcagatggtggcctgtcagtgctccgtacgttccggctgctgcgggtgctgaagctggtgcgcttcctgccagccctgcggc
[0095] ggcagctggtggtgctcatgaggaccatggacaatgtggccaccttctgcatgctgctaatgctcttcatcttcatcttcagcatcctgggcatgc
[0096] acctgtttggctgtaagttcagcctgaagacagactctggagacaccgtccctgacaggaagaacttcgactctctactgtgggccatcgtcact
[0097] gtgtttcagatcttgacacaggaagactggaatgtggttctttacaacggcatggcttccacctcgtcctgggctgccctttactttgtggccctcat
[0098] gacctttgggaactatgtgctcttcaacctgctggtagccatcctggtggaaggcttccaggcagagggtgatgccaccagatctgacaccgat
[0099] gaggataagacatctacccacctagaggaagatttcgataagctcagagacgttcaagccacagagatgaagatgtactcactggctgtgacc
[0100] cctaatgggcacctagagggccgaggcagtctgccgccgcctctcatcacgcacacagcggctacgcctatgcctacccccaagagctccc
[0101] ctcatctggacatggcccacactcttttggactcacggcgcagcagcagtggctctgtggacccccaactcggggaccagaagtctctggcta
[0102] gcctgcgcagctccccttgtgccccatggggccccaacagtgcaggaagcagccggcgctccagctggaacagcctgggccgcgcaccc
[0103] agcctcaaacgccgcagccagtgtggggagcgcgagtccctgctctctggtgaggggaagggcagcacggatgatgaggccgaggacag
[0104] cagaccaaactcagggacccacccaggagcttcacccgggccccgggccacacccctgcggcgggctgagtcgttgggccaccgcagca
[0105] caatggacctgtgccccccacggcctgccaccctcctgcccaccaagttccgtgactgcaacgggcagatggtggccctgcccagcgagttc
[0106] ttcctgcgcatcgacagccacaaggaggacgcagcagagtttgatgatgacatagaagatagctgctgcttccgcctgcacaaagtgctgga
[0107] gccctatgcaccccagtggtgcagcagccgggagtcctgggccctgtatctcttcccgccgcagaacaggctacgcgtctcctgccagaaag
[0108] tcatcgcacacaagatgtttgaccacgtggtccttgtcttcatcttcctcaactgtatcaccattgccctggagaggccagacatcgatccgggca
[0109] gcactgaacgggcctttctcagcgtctccaactacatcttcacagccatcttcgtggtggagatgatggtgaaggtggtagccctggggctgct
[0110] gtggggtgagcatgcctacctgcagagcagctggaatgtgctggacgggctgcttgtcctggtgtccctggttgacatcattgtggccgtggcc
[0111] tctgccggtggtgccaagatcctaggcgtcctgcgcgtgctgcgcctgctgcggaccctgaggcctctgagggtcatcagccgagctccagg
[0112] cctcaagctggtcgtggagactctgatatcatcgctcaggcccatcgggaacatcgtcctcatctgctgcgccttcttcattatctttggcatcctc
[0113] ggggtgcagcttttcaagggcaaattctactactgcgagggtacagataccaggaatatcaccaccaaggccgagtgccatgccgcccacta
[0114] ccgctgggtgaggcgcaaatacaactttgacaacctgggtcaggcgctgatgtctctgttcgtgctgtcatccaaggatggctgggtaaacatc
[0115] atgtacgacgggctggacgccgtgggcatcgaccagcagcctgtgcagaaccacaacccctggatgctgctctacttcatctccttcctgctca
[0116]
[0117] The antibodies involved in the examples of the present invention, their sources and dilution factors are as follows: αSMA-Cy3 antibody (1:1000, Sigma-Aldrich, C6198), CACNA1H antibody (1:400, Alomone Labs, ACC-025).
[0118] Example 1 screened and identified a point mutation, i.e., a missense mutation, of the Cacna1h gene in mice (Cacna1h T4306C / T4306C )
[0119] Eight-week-old C57BL / 6J wild male mice (purchased from Charles River) were selected and intraperitoneally injected with N-ethyl-N-nitrosourea at a dose of 100 mg / kg three times, once a week, to induce gene mutations in mouse sperm, and the mutations could be stably inherited by offspring. After 10 weeks of recovery, the injected mice were mated with C57BL / 6J wild female mice to produce G1-generation mice. The G1-generation male mice were mated with C57BL / 6J wild female mice again to generate G2-generation female mice. The G2-generation female mice were mated with their G1-generation fathers to produce G3-generation mice. The tracheas of G3-generation mice were dissected, and the Alcian blue staining (Alcain blue) and hematoxylin-eosin staining (H&E) methods were used to detect whether airway stenosis lesions occurred in the tracheas of the mice.
[0120] The specific steps of Alcian blue staining are as follows: The dissected tracheas were fixed in 95% ethanol for 12 hours, then stained overnight with 0.03% Alcian blue dissolved in 80% ethanol and 20% acetic acid, and the tracheas were washed in 2% KOH to remove background staining.
[0121] The specific steps of hematoxylin-eosin staining (H&E) are as follows: Frozen sections were stained in hematoxylin solution for 10 minutes, washed three times with deionized water for 5 minutes each time, differentiated with 1% hydrochloric acid ethanol, and the sections were washed three times with deionized water for 5 minutes each time. The sections were stained in eosin stain for 3 minutes, and then the tissue sample sections were dehydrated with gradients of 25%, 50%, 75%, 95% and absolute ethanol. The dehydrated tissue sample sections were soaked in xylene three times, and finally sealed with neutral gum.
[0122] For mice with airway stenosis lesions, tissue DNA was extracted for whole-exome sequencing and Sanger sequencing to find the mutation sites and mutant genes.
[0123] The specific steps of whole-exome sequencing analysis are as follows: Use the Agilent SureSelect Mouse All Exon kit V1 to capture the exons of wild-type and mutant mice, and sequence them using the Illumina HiSeq 2000. Align the sequence reads with the C57BL / 6J mouse genome (mm10), and use the CLCBio Genomic Workbench and GATK software for analysis to identify the mutation sites of genes in the mutants.
[0124] Newborn (day 0 after birth) mutant mice (Cacna1h T4306C / T4306C ) and bright-field images of the tracheas of newborn wild-type mice are shown in Figure 1 a as follows: The trachea of the newborn mutant mouse (Cacna1h T4306C / T4306C ) is significantly narrowed; the Alcian blue staining results of the tracheas of newborn mutant mice (Cacna1h T4306C / T4306C ) and newborn wild-type mice are shown in Figure 1 b as follows: Compared with newborn wild-type mice, there are more cartilage fractures in the tracheas of newborn mutant mice (Cacna1h T4306C / T4306C ), that is, the complete tracheal rings of newborn mutant mice (Cacna1h T4306C / T4306C ) are significantly smaller than those of newborn wild-type mice ( Figure 1 c); the hematoxylin-eosin staining (H&E) results of frozen sections of the tracheas of newborn mutant mice (Cacna1h T4306C / T4306C ) and newborn wild-type mice are shown in Figure 1 d as follows: Compared with newborn wild-type mice, the tracheal lumen of newborn mutant mice (Cacna1h T4306C / T4306C ) is significantly reduced. Among them, the tracheal width and the relative area of the tracheal lumen of newborn mutant mice (Cacna1h T4306C / T4306C ) are both significantly reduced ( Figure 1 e, f). Among them, the method for measuring the tracheal width is as follows: The isolated whole trachea is photographed under bright field using a Zeiss stereomicroscope (Zeiss AXIOZoom.V16), with the front end of the trachea on top and the back end at the bottom. The tracheal width is measured using the software Image J (https: / / imagej.net / ), that is, the width of the outer lumen of the tracheal projection in the photographed image; the method for measuring the tracheal lumen area is as follows: The tracheal section is stained with HE and photographed under bright field using a microscope (Leica DM6 B upright microscope). The tracheal lumen area is measured using the software Image J (https: / / imagej.net / ), that is, the area of the inner lumen of the tracheal projection in the photographed image. Whole-exome sequencing and Sanger sequencing confirmed that there is a point mutation (missense mutation, Cacna1h T4306C / T4306C ,Figure 1 h, g in Chinese; Cacna1h + / T4306C (without airway stenosis), the sequencing results showed that only this point mutation existed in the coding region and non-coding region of this gene; it can be seen that the Cacna1h gene point mutation homozygote (missense mutation, Cacna1h T4306C / T4306C ) can strongly inhibit the formation of the trachea in neonatal mice, leading to airway stenosis and tracheal cartilage fracture, that is, the mutant mice (Cacna1h T4306C / T4306C ) are airway stenosis mice.
[0125] At the same time, the existing Cacna1h gene knockout mice (Cacna1h - / - )(JAX, Strain#: 013770) were mated with each other, and the tracheas of the neonatal Cacna1h gene knockout mice (Cacna1h - / - ) were stained with Alcian blue, and the results are as Figure 1 shown in i: The neonatal Cacna1h gene knockout mice (Cacna1h - / - ) also showed airway stenosis and tracheal cartilage fracture. Further genetic complementation experiments were carried out, that is, using the above-mentioned induced Cacna1h point mutation heterozygous female mice (Cacna1h + / T4306C , without airway stenosis) and Cacna1h gene knockout heterozygous male mice (Cacna1h + / - , without airway stenosis, the Cacna1h gene knockout mice (Cacna1h - / - )(JAX, Strain#: 013770) female mice were mated with C57BL / 6J wild male mice to obtain) mated to produce neonatal Cacna1h double heterozygous mice (Cacna1h - / T4306C ), and the tracheas of the neonatal Cacna1h double heterozygous mice (Cacna1h - / T4306C ) were stained with Alcian blue, and the results are as Figure 1 shown in j: The Cacna1h double heterozygous mice (Cacna1h - / T4306C , on the first day after birth) showed obvious tracheal stenosis and tracheal cartilage fracture. This genetic complementation experiment finally confirmed that the Cacna1h point mutation (Cacna1h T4306C / T4306C ) led to the inactivation of the Cacna1h gene and airway stenosis.
[0126] α-SMA is a marker protein of smooth muscle cells. For neonatal mutant mice (Cacna1h T4306C / T4306C) and the whole tracheas of neonatal wild-type mice were immunostained as follows: the tracheas were fixed overnight at 4°C in 4% paraformaldehyde, the whole tracheas were incubated in a permeabilization solution (5% FBS / PBS / 0.5% Triton X-100 / 3% BSA) at 4°C for 12 hours, incubated overnight at 4°C in the primary antibody, washed, incubated overnight at 4°C in the secondary antibody, washed, and then mounted for imaging. The results are as shown in Figure 2 a: the tracheal smooth muscle area of neonatal mutant mice (Cacna1h T4306C / T4306C ) was significantly reduced.
[0127] To detect the physiological effects of the Cacna1h gene point mutation on the trachea, the acetylcholine-induced contractions of the tracheas of mutant mice (Cacna1h T4306C / T4306C ) and wild-type mice at postnatal day 14 were detected respectively. The specific steps for acetylcholine-induced tracheal contraction are as follows: the isolated tracheas were made into tracheal rings 2 mm thick and maintained in Krebs solution (119 mM NaCl, 4.7 mM KCl, 2.5 mM CaCl2, 1.17 mM MgSO4, 20 mM NaHCO3, 1.18 mM KH2PO4, 0.027 mM EDTA, 11 mM glucose). The tracheal rings were mounted on a linear electromyography system (610-M, Danish Myo Technology), and a resting tension of 2 mN was applied to each tracheal ring. Tracheal contraction was induced by adding acetylcholine, and the contractile force of the trachea was recorded simultaneously. The results are as shown in Figure 2 b: the contractile force of the tracheas of mutant mice (Cacna1h T4306C / T4306C ) at postnatal day 14 was significantly reduced.
[0128] Example 2.
[0129] The function of Cacna1h is evolutionarily conserved. Fiberoptic bronchoscopy was used to detect clinical patients with airway stenosis (Tracheostenosis) and healthy controls (Healthy controls) (the patients were from Guangzhou Women and Children's Medical Center, ethical approval number (120A01)), and the results are as shown in Figure 3 a: the airway lumen of clinical patients with airway stenosis was significantly narrowed.
[0130] The airways of clinical patients with airway stenosis and healthy controls were stained with hematoxylin-eosin (H&E) (the method is referred to Example 1), and the results are as shown in Figure 3 b: the airway lumen of clinical patients with airway stenosis was significantly narrowed.
[0131] The airways of clinical patients with airway stenosis and healthy controls were stained with Cacna1h antibody and nuclear DAPI, and the results are as shown inFigure 3 As shown in c and d in the figure: The expression level of Cacna1h protein in the airways of clinical patients with airway stenosis decreased significantly.
[0132] The airways of clinical patients with airway stenosis and healthy people were subjected to immunohistochemical staining with Cacna1h antibody (the method is shown in Example 1), and the results are as Figure 3 shown in e in the figure: The expression level of Cacna1h protein in the airways of clinical patients with airway stenosis decreased significantly.
[0133] The technical solution of the present invention is not limited to the limitations of the above specific embodiments. Any technical deformation made according to the technical solution of the present invention falls within the protection scope of the present invention.
Claims
1. The Cacna1h protein mutant, compared with the wild-type Cacna1h protein, has the following mutation: p.S1436P; the amino acid sequence of the wild-type Cacna1h protein is shown in SEQ ID NO:
1.
2. The Cacna1h gene mutant, the nucleotide sequence of which is the sequence of the DNA encoding the Cacna1h protein mutant as claimed in claim 1.
3. The Cacna1h gene mutant according to claim 2, wherein compared with the wild-type Cacna1h gene, the mutant has the following mutation: c.T4036C; the nucleotide sequence of the wild-type Cacna1h gene is shown in SEQ ID NO:
2.
4. An expression cassette, vector or cell comprising the Cacna1h gene mutant as claimed in any one of claims 2-3, and the cell does not contain propagation materials.
5. The expression cassette, vector or cell according to claim 4, characterized in that, The vector includes a prokaryotic expression vector and a eukaryotic expression vector.
6. Use of a reagent for detecting the Cacna1h protein mutant as claimed in claim 1 or the Cacna1h gene mutant as claimed in any one of claims 2-3 in the preparation of a product for the diagnosis, monitoring, efficacy evaluation, or prognosis evaluation of airway stenosis.
7. The use according to claim 6, wherein the reagent for detecting the Cacna1h protein mutant as claimed in claim 1 or the Cacna1h gene mutant as claimed in any one of claims 2-3 includes a reagent for detecting the Cacna1h protein mutant as claimed in claim 1 or the Cacna1h gene mutant as claimed in any one of claims 2-3 at the gene level or protein level.
8. The use according to claim 6 or 7, wherein the reagent includes a reagent for one or more detection techniques or methods selected from the following group: immunohistochemistry, Western blotting, Northern blotting, PCR, biochip method, nucleic acid sequencing, amino acid sequencing, high performance liquid chromatography, capillary gel electrophoresis, near-infrared spectroscopy, mass spectrometry, surface plasmon resonance technology, immunological PCR technology, biotin-avidin technology.
9. The use according to claim 8, wherein the immunohistochemistry includes at least one of enzyme-linked immunosorbent assay, immunofluorescence assay, radioimmunoassay, immunoprecipitation, immunochemiluminescence, colloidal gold immunotechnology, fluorescence immunochromatography technology, complement fixation analysis, flow cytometry fluorescence resolution, single molecule detection technology; or the reagent for detecting the Cacna1h protein mutant as claimed in claim 1 or the Cacna1h gene mutant as claimed in any one of claims 2-3 is selected from: an antibody, ligand protein, polypeptide, non-protein compound, or nucleic acid aptamer specific for the Cacna1h protein mutant as claimed in claim 1; or a probe or primer specific for the Cacna1h gene mutant as claimed in any one of claims 2-3.
10. The use according to claim 9, wherein The antibody includes at least one of polyclonal antibody, monoclonal antibody, single-chain antibody, functional antibody fragment, Fab region of antibody, nanobody, chimeric antibody, and multispecific antibody; or The product is a reagent, kit, test plate, test strip, device, system, or chip; or The product further includes reagents for detecting other diagnoses, monitoring, efficacy evaluation, and / or prognosis evaluation of airway stenosis; or The product further includes a reagent for assisting in detecting gene expression level, and the reagent for assisting in detecting gene expression level includes at least one of a reaction reagent for visualizing an amplicon corresponding to a primer, an RNA extraction reagent, a reverse transcription reagent, a cDNA amplification reagent, a standard product for preparing a standard curve, and a positive control product; or The product further includes a reagent for assisting in detecting protein expression level, and the reagent for assisting in detecting protein expression level includes at least one of a chromogenic agent, a blocking solution, an antibody diluent, a washing buffer, a chromogenic termination solution, a standard product for preparing a standard curve, and a positive control product; or The test sample of the product is selected from at least one of body fluids, tissues, cells, and excreta of a subject to be tested.
11. A method for constructing an animal model of airway stenosis, wherein the animal carries the Cacna1h protein mutant according to claim 1 or the Cacna1h gene mutant according to any one of claims 2-3.
12. According to the construction method of claim 11, characterized in that The animal is a non-human mammal; or The animal carries a homozygous mutant.
13. According to the construction method of claim 12, characterized in that The non-human mammal is a cat, cow, sheep, pig, dog, chicken, duck, goose, rabbit, or mouse.
14. According to the construction method of claim 13, characterized in that The non-human mammal is a mouse.
15. According to the construction method of claim 14, characterized in that The non-human mammal is a mouse.
16. Any one of b1)-b3) applications: b1) Application of the Cacna1h protein mutant according to claim 1, the Cacna1h gene mutant according to any one of claims 2-3, or the expression cassette, vector, or cell according to any one of claims 4-5 in constructing an animal model of airway stenosis or preparing a product for constructing an animal model of airway stenosis; b2) Application of the animal model constructed by the method according to any one of claims 11-15 in preparing a product for screening or developing a drug: The drug is used for preventing and / or treating airway stenosis; b3) Application of a reagent for specifically altering the Cacna1h protein mutant according to claim 1 or the Cacna1h gene mutant according to any one of claims 2-3 in preparing a drug for preventing and / or treating airway stenosis; the specific alteration is to restore the Cacna1h protein mutant according to claim 1 or the Cacna1h gene mutant according to any one of claims 2-3 to the wild type.
17. According to the application of claim 16, characterized in that The animal in b1) is a non-human mammal; or The reagent described in b3) is a reagent based on at least one of gene editing methods selected from single-base gene editing, zinc finger nuclease, transcription activator-like effector nuclease, CRISPR / Cas9, CRISPR / Cas9 combined with iPSC and AAV vector technology.
18. The application according to claim 17, wherein the non-human mammal is a cat, cow, sheep, pig, dog, chicken, duck, goose, rabbit, or mouse.
19. The application according to claim 18, wherein the non-human mammal is a mouse.
20. Any one of the products of c1)-c2): c1) A product for the diagnosis, monitoring, efficacy evaluation, or prognosis evaluation of airway stenosis, comprising: an antibody, ligand protein, polypeptide, non-protein compound, or nucleic acid aptamer specific for the Cacna1h protein mutant described in claim 1; or a probe or primer specific for the Cacna1h gene mutant described in any one of claims 2-3; c2) A product for preventing and / or treating airway stenosis, comprising: a reagent that specifically modifies the Cacna1h protein mutant described in claim 1 or the Cacna1h gene mutant described in any one of claims 2-3; the specific modification is to restore the Cacna1h protein mutant described in claim 1 or the Cacna1h gene mutant described in any one of claims 2-3 to the wild type; the product is a pharmaceutical composition.
21. The product according to claim 20, wherein the antibody described in c1) comprises at least one of polyclonal antibody, monoclonal antibody, single-chain antibody, functional antibody fragment, antibody Fab region, nanobody, chimeric antibody, multispecific antibody; or the product described in c1) is a reagent, kit, test plate, test strip, device, system, or chip; or the product described in c1) further comprises a reagent for detecting other aspects of the diagnosis, monitoring, efficacy evaluation, and / or prognosis evaluation of airway stenosis; or the product described in c1) further comprises a reagent for assisting in detecting gene expression levels, and the reagent for assisting in detecting gene expression levels includes at least one of a reaction reagent for visualizing the amplicon corresponding to the primer, RNA extraction reagent, reverse transcription reagent, cDNA amplification reagent, standard product for preparing a standard curve, positive control product; or the product described in c1) further comprises a reagent for assisting in detecting protein expression levels, and the reagent for assisting in detecting protein expression levels includes at least one of a chromogenic agent, blocking solution, antibody diluent, washing buffer, chromogenic termination solution, standard product for preparing a standard curve, positive control product; or the test sample of the product described in c1) is selected from at least one of body fluids, tissues, cells, and excreta of the subject to be tested; or the reagent described in c2) is a reagent based on at least one of gene editing methods selected from single-base gene editing, zinc finger nuclease, transcription activator-like effector nuclease, CRISPR / Cas9, CRISPR / Cas9 combined with iPSC and AAV vector technology; or The pharmaceutical composition described in c2) further comprises: a pharmaceutically acceptable carrier; or the pharmaceutical composition described in c2) further comprises: other active ingredients for preventing and / or treating airway stenosis.
Citation Information
Patent Citations
New pathogenic gene of Melkersson-Rosenthal syndrome, and coding protein and application thereof
CN104372009A
Nucleic acid for encoding SCN1A gene mutant and application thereof
CN109402132A