A polymer fixed phase carrier for DNA synthesis and its preparation method and application

Abstract

The present invention discloses a polymer fixed phase carrier for DNA synthesis and a preparation method and application thereof. The polymer fixed phase carrier comprises a polymer substrate, the surface of the polymer substrate has active functional groups such as ester groups, carboxyl groups, halogens or hydroxyl groups, so that the polymer substrate can be modified; the surface of the polymer substrate is modified with a first functional group, the first functional group reacts with the polymer substrate to covalently bind, and the first functional group is a functional group that can react with an ester group, a carboxyl group or a halogen; the surface of the polymer substrate is also modified with a functional group, and the functional group is a group that can undergo a click reaction; the polymer fixed phase carrier also includes an initiator chain coupled to the polymer substrate through the functional group; the initiator chain is coupled to the surface of the polymer substrate modified with the functional group through a second functional group. The fixed phase carrier of the present invention can be used to carry out biological DNA synthesis reaction, and has a high yield and accuracy.

Description

Technical Field

[0001] The invention belongs to the fields of bioengineering, biotechnology and molecular biology, and specifically relates to a polymer fixed phase carrier for DNA synthesis and a preparation method and application thereof. Background Art

[0002] With the rapid development of genetic engineering technology, DNA synthesis has become an important part of bioengineering. Due to the high efficiency, high accuracy, low substrate consumption and environmental protection of biological DNA synthesis, it is expected to solve the problems faced by current DNA synthesis and is considered to be a third-generation DNA synthesis technology that may break through the limitations of current chemical synthesis. In the process of biological DNA synthesis, the reaction solution of the previous step needs to be washed away to ensure the next reaction. Therefore, it is necessary to couple the initiator chain on the surface of the stationary phase carrier to synthesize the subsequent DNA through the initiator chain. In order to improve the efficiency and selectivity of enzyme-catalyzed reactions, it is necessary to develop a new type of stationary phase carrier. The stationary phase carriers currently on the market still have certain limitations in practical applications, such as poor stability, high reaction steric hindrance, and high cost. Summary of the invention

[0003] The purpose of the present invention is to provide a polymer fixed phase carrier for DNA synthesis and a preparation method thereof.

[0004] To achieve the above object, the present invention adopts the following technical solutions:

[0005] A polymer fixed phase carrier for DNA synthesis, the carrier comprising a polymer substrate, the material of which comprises any one of an ester polymer compound, a carboxylic acid polymer compound, a polymer halide and a polyhydroxy polymer compound;

[0006] The surface of the polymer substrate is modified with a first functional group, and the first functional group reacts with the polymer substrate to covalently bond; the first functional group is a functional group that can react with an active functional group on the surface of the polymer substrate, such as an ester group, a carboxyl group, a halogen group or a hydroxyl group;

[0007] The surface of the polymer substrate is also modified with functional groups, and the functional groups are groups that can undergo click reactions;

[0008] The polymer stationary phase carrier also includes an initiator chain coupled to the polymer substrate through the functional group; the initiator chain is coupled to the surface of the polymer substrate modified with the functional group through the second functional group contained in the initiator chain.

[0009] Furthermore, the ester polymer compound includes at least one of polymethyl methacrylate, polyethylene glycol diacrylate, and hydroxypropyl methacrylate; the carboxylic acid polymer compound includes at least one of polyacrylic acid, polyvinyl acid, and polybutenoic acid; the polymer halide is a polymer containing halogen, and the halogen is any one of fluorine, chlorine, and bromine, and the polymer halide is specifically any one of polytetrafluoroethylene, polyvinyl chloride, chlorinated polyvinyl chloride, chlorinated polypropylene, or brominated polypropylene; the polyhydroxy polymer includes at least one of polyvinyl alcohol, polyester polyol, polycellulose, polysaccharide, and polyamino acid.

[0010] Furthermore, the first functional group can be selected from any of the following groups: amino, hydroxyl, alkoxy, thiol, active ester, alkyl selenyl, phosphate, azido, metal alkyl, etc.

[0011] Furthermore, the functional group may be a thiol group or an azide group; preferably an azide group.

[0012] Furthermore, the second functional group is a functional group capable of reacting with an azide group or a thiol group, such as a vinyl group, a cycloalkenyl group, a cycloalkadienyl group, a heterocycloalkenyl group, or an alkynyl group; preferably an alkynyl group.

[0013] According to one embodiment of the present invention, the alkynyl group may be provided by a DBCO group (diphenylcyclooctyne group).

[0014] Furthermore, the initiator strand can be a single-stranded DNA that binds to DNA polymerase and guides DNA synthesis. The 5' end of the single-stranded DNA is modified with the second functional group and can be covalently bound to the surface of the polymer substrate.

[0015] The polymer fixed phase carrier also includes a fluorescent DNA complementary chain; the fluorescent DNA complementary chain is complementary to the triggering chain and is used for fluorescence qualitative analysis.

[0016] Furthermore, the fluorescent complementary chain may be a DNA complementary sequence with fluorescent probes such as Cy3 and FITC.

[0017] It should be noted that fluorescence characterization is to judge whether the preparation of the polymer stationary phase carrier is successful or not by placing the fluorescent material under a fluorescence microscope and observing the fluorescence intensity.

[0018] The method for preparing the polymer fixed phase carrier for DNA synthesis comprises the following steps:

[0019] (1) modifying the first functional group on the surface of the polymer substrate and introducing a modified functional group;

[0020] (2) The initiator chain is coupled to the functional group modified on the polymer substrate in step (1) by a click reaction through the second functional group (such as an alkynyl group) contained therein, thereby obtaining the polymer stationary phase carrier. The stationary phase can be used to mark the initiator chain coupling on the stationary phase by means of fluorescent chain hybridization and fluorescence microscopy observation.

[0021] Depending on the active functional groups on the surface of the polymer substrate itself (such as ester groups, carboxyl groups, halogen groups or hydroxyl groups, etc.), in the above step (1), modifying the first functional group on the surface of the polymer substrate and introducing the modified functional group can be carried out in steps, or the modification can be achieved in one step by selecting a suitable reactant containing both the "first functional group and the functional group".

[0022] When the material of the polymer substrate is an ester polymer compound, the first functional group of the surface modification of the ester polymer compound is carried out through an amidation substitution reaction.

[0023] Furthermore, the amidation substitution reaction is carried out between the ester polymer compound and the amino compound in the presence of a solvent, a catalyst and neutral conditions.

[0024] Specifically, the amino compound can be any one of ethylenediamine, propylenediamine, and polyethyleneimine; the solvent can be any one of water, tetrahydrofuran, acetonitrile, and dimethyl sulfoxide; the catalyst can be any one of dimethylaminopyridine, potassium tert-butoxide, and sodium carbonate; and the neutral condition refers to adjusting the solution pH to about 8.

[0025] The molar ratio of the ester polymer compound, the amino compound and the catalyst can be (0.5-1.5): (1-10): (0.02-0.1) in sequence.

[0026] The reaction temperature of the amidation reaction can be 25-70° C.; the reaction time can be 2-48 hours.

[0027] Furthermore, the modified functional group is grafted with the functional group by NHS esterification reaction between the NHS ester carrying an azide group and the first functional group.

[0028] The NHS esterification reaction is carried out in a solvent under weak alkaline conditions.

[0029] The solvent may be at least one of water, acetonitrile, dimethyl sulfoxide, and N,N-dimethylformamide; the weakly alkaline condition refers to adjusting the solution pH to between 8 and 9.

[0030] According to an embodiment of the present invention, the NHS ester with an azide group may be NHS-PEG-N3.

[0031] The molar ratio of the first functional group on the surface-modified first functional group polymer substrate and the NHS ester with an azide group is (0.5-1.5): (1-10).

[0032] The reaction temperature of the NHS esterification reaction can be 25-50° C.; the reaction time can be 12-48 hours.

[0033] When the material of the polymer substrate is a carboxylic acid polymer compound, the first functional group of the surface modification of the carboxylic acid polymer compound is carried out through an amidation condensation reaction.

[0034] Furthermore, the amidation condensation reaction is carried out between the carboxylic acid polymer compound and the amino compound in the presence of a solvent, a catalyst and acidic conditions.

[0035] Among them, the amino compound can be any one of ethylenediamine, propylenediamine, and NH2-PEG-N3; the solvent can be any one of water, acetonitrile, N,N-dimethylformamide, and tetrahydrofuran; the catalyst can be EDC; and the acidic condition refers to adjusting the solution pH to between 4.5 and 6.

[0036] The molar ratio of the carboxylic acid polymer compound, the amino compound and the catalyst can be (0.5-1.5): (1-10): (0.02-0.1) respectively.

[0037] The reaction temperature of the condensation reaction may be 25-70° C.; the reaction time may be 2-48 hours.

[0038] When the amino compound is selected from NH2-PEG-N3, for the polymer substrate formed by the carboxylic acid polymer compound, modifying the first functional group and introducing the modified functional group can be completed in one step.

[0039] When the amino compound is selected from ethylenediamine or propylenediamine, after modifying the first functional group, the functional group is further modified.

[0040] Furthermore, the modified functional group is grafted with the functional group by NHS esterification reaction between the NHS ester with an azide group and the first functional group. The NHS esterification reaction is carried out in a solvent under weak alkaline conditions.

[0041] The solvent may be any one of water, acetonitrile, dimethyl sulfoxide, and N,N-dimethylformamide; the weakly alkaline condition refers to adjusting the solution pH to between 8 and 9.

[0042] The molar ratio of the first functional group on the surface-modified first functional group polymer substrate and the NHS ester with an azide group is (0.5-1.5): (1-10).

[0043] The reaction temperature of the NHS esterification reaction can be 25-50° C.; the reaction time can be 12-48 hours.

[0044] When the material of the polymer substrate is a macromolecular halide, the first functional group modified on the surface of the macromolecular halide is obtained through a nucleophilic substitution reaction.

[0045] Furthermore, the nucleophilic substitution reaction is obtained by a nucleophilic substitution reaction between a polymer halide and a nucleophilic reagent in the presence of a solvent, a catalyst and an acid-binding agent.

[0046] Wherein, the nucleophilic reagent may be an amino compound and / or an azide compound; the amino compound may be any one of polyethyleneimine, ethylenediamine, and propylenediamine; the azide compound may be any one of sodium azide, trimethylsilyl azide, and tetrabutylammonium azide; the solvent may be any one of tetrahydrofuran, N,N-dimethylformamide, dimethyl sulfoxide, and acetonitrile; the catalyst may be any one of tetrabutylammonium fluoride, tetrabutylammonium bromide, and tetrabutylammonium fluoroborate; the acid-binding agent may be an organic base and / or an organic base, the organic base may be any one of triethylamine and diisopropylethylamine, and the inorganic base may be at least one of sodium carbonate, potassium carbonate, cesium carbonate, sodium hydroxide, and potassium hydroxide.

[0047] The molar ratio of the polymer halide, the nucleophilic agent, the catalyst, and the acid-binding agent may be (0.5-1.5): (1-20): (0.05-0.99): (0.25-10) in sequence. Specifically, the molar ratio of the polymer halide, the nucleophilic agent, the catalyst, and the acid-binding agent may be 1.0:1.5:0.25:1.

[0048] The reaction temperature of the nucleophilic substitution reaction can be 25-50° C.; the reaction time can be 12-48 hours.

[0049] When the material of the polymer substrate is a polyhydroxy polymer compound, the first functional group of the polyhydroxy polymer compound surface modification is carried out by reacting with an active ester.

[0050] Furthermore, the reaction with active ester is carried out with polyhydroxy polymer compound and NHS ester in the presence of solvent and base catalyst.

[0051] Wherein, the NHS ester is NHS-PEG-N3; the solvent can be any one of water, N,N-dimethylformamide, and dimethyl sulfoxide; and the base catalyst includes any one of triethylamine, dimethylaminopyridine, and sodium carbonate.

[0052] The molar ratios of the polyhydroxy polymer compound, NHS-PEG-N3 and the base catalyst can be (0.5-1.5): (1-10): (0.02-0.1) respectively.

[0053] The reaction temperature of the reaction with the active ester may be 25-50° C.; the reaction time may be 12-48 hours.

[0054] The initiator chain may be a DNA sequence with an alkynyl group modified at the 5' end. According to one embodiment of the present invention, the alkynyl group may be provided by a DBCO group (diphenylcyclooctyne group).

[0055] The molar ratio of the initiator chain to the polymer substrate with modified functional groups may be (0.5-1.5):(1-10). Specifically, the molar ratio of the initiator chain to the polymer substrate with modified functional groups may be 1.0:1.5.

[0056] The click reaction includes a solvent, which may be water; the reaction temperature of the click reaction may be 25-60° C.; and the reaction time may be 1-48 hours.

[0057] The method further comprises the step of hybridizing the priming strand and the fluorescent complementary strand after step (2) is completed.

[0058] The fluorescent complementary chain can be a DNA complementary sequence with fluorescent probes such as Cy3 and FITC.

[0059] The molar ratio of the initiating chain to the fluorescent complementary chain can be 20:1;

[0060] The hybridization comprises a solvent, and the solvent may be a mixed solution of SSC buffer solution and PBS buffer solution;

[0061] The hybridization temperature may be 25-100° C. and the hybridization time may be 10-60 minutes.

[0062] The invention also provides a method for synthesizing DNA using the polymer fixed phase carrier.

[0063] The method for synthesizing DNA using the polymer fixed phase carrier provided by the present invention comprises the following steps:

[0064] The polymer fixed phase carrier is used to perform DNA synthesis.

[0065] Compared with the prior art, the present invention has the following beneficial effects:

[0066] 1. The present invention provides a stationary phase carrier with a polymer as a base material, which has the advantages of low cost, excellent physical and chemical properties, and functionalization.

[0067] 2. The synthesis method of the present invention is simple, the synthesis route is short, the raw materials are cheap and easily available, the process is highly safe, and the operation is simple.

[0068] 3. The polymer carrier of the present invention can be grafted with functional groups and can be used for biological DNA synthesis with a high synthesis accuracy.

[0069] 4. The present invention is one of the few polymer-based stationary phase materials used for biological DNA synthesis. BRIEF DESCRIPTION OF THE DRAWINGS

[0070] Figure 1 This is a flow chart of preparing a stationary phase carrier based on polymethyl methacrylate (PMMA) in Example 1 of the present invention.

[0071] Figure 2 This is a fluorescence image after hybridization of the fluorescent complementary chain in Example 1 of the present invention.

[0072] Figure 3 This is a flow chart for preparing a stationary phase carrier based on polyacrylic acid (PAA) in Example 2 of the present invention.

[0073] Figure 4 This is a fluorescence image after hybridization of fluorescent complementary chains in Example 2 of the present invention.

[0074] Figure 5 This is a flow chart for preparing a stationary phase carrier based on polyvinyl chloride (PVC) in Example 3 of the present invention.

[0075] Figure 6 This is a fluorescence image after hybridization of fluorescent complementary chains in Example 3 of the present invention.

[0076] Figure 7 This is a flow chart of preparing a stationary phase carrier based on polyvinyl alcohol (PVC) in Example 4 of the present invention.

[0077] Figure 8 This is a fluorescence image after hybridization of fluorescent complementary chains in Example 4 of the present invention.

[0078] Fig. 9 This is a diagram showing the sequencing results after DNA is synthesized by the biological reaction in Example 5 of the present invention.

[0079] Fig.10 This is the gel electrophoresis diagram after the first eight rounds of synthesis in Example 5 of the present invention.

[0080] Fig.11 This is a fluorescence image after the glass material is fixed with the hybridized fluorescent complementary chain in comparative example 1 of the present invention.

[0081] Fig.12 This is a diagram showing the sequencing results after DNA is synthesized in a biological reaction using a glass sheet as a stationary phase carrier in Comparative Example 1 of the present invention. DETAILED DESCRIPTION

[0082] The present invention is further described in detail below in conjunction with specific embodiments, and the examples provided are only for illustrating the present invention, rather than for limiting the scope of the present invention. The examples provided below can be used as a guide for further improvements by those of ordinary skill in the art, and do not constitute a limitation of the present invention in any way.

[0083] The experimental methods in the following examples, unless otherwise specified, are all conventional methods, and are performed according to the techniques or conditions described in the literature in the field or according to the product instructions. The materials, reagents, etc. used in the following examples, unless otherwise specified, can all be obtained from commercial channels.

[0084] The sequence of the initiator chain 1 used in the following examples is: 5'-TTGATTGACTTGGGATCAGACTCCTACGCGTTCAGAGAATCCGTGATG-3' (SEQ ID No. 1), wherein the 5' end is modified with a DBCO group.

[0085] Example 1: Modification of ester polymer compound polymethyl methacrylate (PMMA) as stationary phase carrier

[0086] according to Figure 1 Flowchart Preparation of polymer stationary phase carrier based on polymethyl methacrylate (PMMA)

[0087] (1) Modification of the first functional group amino

[0088] Select PMMA with a molecular weight of 15,000 to prepare a 3mm*3mm*1mm resin sheet, clean the surface of the PMMA resin sheet with 200μL of anhydrous ethanol, blow dry with nitrogen and let stand at room temperature for 10 min. Soak the PMMA resin sheet in a 100mM boric acid solution (pH=8) containing 10% hexamethylenediamine for 2 h, wash it twice with water, 10 min each time, and blow dry with nitrogen.

[0089] (2) Modification of functional groups

[0090] The PMMA resin sheet modified with the first functional group amino group was immersed in 100 μL of 1.5 ng / mL NHS-PEG-N3 (DMSO: water = 1: 5.66, v / v) solution overnight, washed twice with water, and dried with nitrogen gas.

[0091] (3) Coupling initiation chain

[0092] The initiator chain 1 (1 μl, 1 μmol / L) was dropped onto the PMMA resin sheet modified with the azide group and reacted in a humidifier at 25°C for 2 hours. The PMMA resin sheet after the reaction was rinsed with water three times, immersed in water for 2 hours, and then dried in a vacuum drying oven for 2 hours.

[0093] (4) Hybridization of fluorescent complementary chains

[0094] The PMMA resin sheet with coupled initiator chain was immersed in a well plate containing fluorescent complementary chain (100 μl, 0.5 μmol / L) and hybridized at 25°C for 30 minutes. The hybridization solution was aspirated, washed twice with 0.1 mol / L sodium chloride solution, blown dry with nitrogen and observed under a fluorescence microscope. Figure 2 This is the fluorescence image after hybridization of fluorescent complementary chains.

[0095] Figure 2 This is a fluorescence image after the PMMA resin sheet is hybridized with the fluorescent complementary chain. From the fluorescence image, it can be seen that the initiator chain is successfully inoculated on the PMMA resin sheet and the PMMA stationary phase is successfully prepared.

[0096] Example 2 Carboxylic acid polymer compound polyacrylic acid (PAA) modified as a stationary phase carrier

[0097] according to Figure 3 Flowchart Preparation of Polymer Stationary Phase Support Based on Polyacrylic Acid (PAA)

[0098] (1) Modification of functional groups

[0099] Select PAA with a molecular weight of 15,000 to prepare a 3mm*3mm*1mm resin sheet, weigh 20 mg EDC and 7.4 mg NHS, dilute to 1 mL with DMSO or MES, soak the PAA resin sheet in the solution, add 2 ng / mL NH2-PEG-N3 (DMSO solvent) to react overnight, wash twice with water, and blow dry with nitrogen.

[0100] (2) Coupling initiation chain

[0101] The initiator chain 1 (1 μl, 1 μmol / L) was dropped onto the PAA resin sheet modified with the azide group and reacted in a humidifier at 25°C for 2 hours. The PAA resin sheet after the reaction was rinsed with water three times, immersed in water for 2 hours, and then dried in a vacuum drying oven for 2 hours.

[0102] (3) Hybridization of fluorescent complementary chains

[0103] The PAA resin sheet coupled with the initiating chain was immersed in a well plate containing a fluorescent complementary chain (100 μl, 0.5 μmol / L) and hybridized at 25°C for 30 minutes. The hybridization solution was aspirated, washed twice with 0.1 mol / L sodium chloride solution, and then dried with nitrogen and observed under a fluorescence microscope. Figure 4 This is the fluorescence image after hybridization of fluorescent complementary chains.

[0104] Figure 4 This is the fluorescence image after the PAA resin sheet is hybridized with the fluorescent complementary chain. From the fluorescence image, it can be seen that the initiating chain is successfully inoculated on the PAA sheet and the PAA stationary phase is successfully prepared.

[0105] Example 3: Modification of polymer halide polyvinyl chloride (PVC) as a stationary phase carrier

[0106] according to Figure 5 Flowchart Preparation of polyvinyl chloride (PVC) based stationary phase carrier

[0107] (1) Modification of functional groups

[0108] Select polyvinyl chloride with a molecular weight of 50,000 to prepare a 3mm*3mm*1mm resin sheet. Weigh anhydrous sodium carbonate (21.2mg, 0.2mmol) and add 10ml acetonitrile solvent to fully shake. Under nitrogen protection, put the polyvinyl chloride resin sheet into a glass flask. Add trimethylsilane (40μl, 0.3mmol / L) and tetrabutylammonium fluoride (14.5μl, 0.05mmol / L) dropwise into the glass flask and react at 50°C for 48 hours. After the reaction, wash the polyvinyl chloride resin sheet with water three times, soak the polyvinyl chloride resin sheet in water for 24 hours, and then put it into a vacuum drying oven for drying to obtain an azide-modified polyvinyl chloride resin sheet.

[0109] (2) Coupling initiation chain

[0110] The initiator chain 1 (1 μl, 10 μmol / L) was dropped onto the polyvinyl chloride resin sheet modified with the azide group and reacted in a humidifier at 25°C for 2 hours. The polyvinyl chloride resin sheet after the reaction was rinsed with water three times, immersed in water for 2 hours, and then placed in a vacuum drying oven for 2 hours.

[0111] (3) Hybridization of fluorescent complementary chains

[0112] The polyvinyl chloride resin sheet with coupled initiator chain was immersed in a well plate containing fluorescent complementary chain (100 μl, 0.5 μmol / L) and hybridized at 25°C for 30 minutes. The hybridization solution was aspirated, washed twice with 0.1 mol / L sodium chloride solution, blown dry with nitrogen and observed under a fluorescence microscope. Figure 6 This is the fluorescence image after hybridization of fluorescent complementary chains.

[0113] Figure 6 This is a fluorescence image after the polyvinyl chloride resin sheet is hybridized with the fluorescent complementary chain. From the fluorescence image, it can be seen that the initiating chain is successfully inoculated on the polyvinyl chloride sheet and the polyvinyl chloride stationary phase is successfully prepared.

[0114] Example 4: Modification of polyhydroxy polymer polyvinyl alcohol (PVA) as a stationary phase carrier

[0115] according to Figure 7 Flowchart Preparation of polyvinyl alcohol (PVA) based stationary phase carrier

[0116] (1) Modification of functional groups

[0117] Select polyvinyl alcohol with a molecular weight of 8000 to prepare a 3mm*3mm*1mm resin sheet, weigh triethylamine (5μL, 0.05mmol / L) and NHS-PEG-N3 (6mg, 3mmol / L), add 10mL dimethyl sulfoxide solvent, shake and react for 18h, and soak the polyvinyl alcohol resin sheet in the solution. After the reaction, wash the polyvinyl alcohol with water three times, soak the polyvinyl alcohol resin sheet in water for 24 hours, and then put it into a vacuum drying oven for drying to obtain azide-modified polyvinyl alcohol.

[0118] (2) Coupling initiation chain

[0119] The initiator chain 1 (1 μl, 10 μmol / L) was dropped onto the polyvinyl chloride resin sheet modified with the azide group and reacted in a humidifier at 25°C for 2 hours. The polyvinyl chloride resin sheet after the reaction was rinsed with water three times, immersed in water for 2 hours, and then placed in a vacuum drying oven for 2 hours.

[0120] (3) Hybridization of fluorescent complementary chains

[0121] The polyvinyl chloride resin sheet with coupled initiator chain was immersed in a well plate containing fluorescent complementary chain (100 μl, 0.5 μmol / L) and hybridized at 25°C for 30 minutes. The hybridization solution was aspirated, washed twice with 0.1 mol / L sodium chloride solution, blown dry with nitrogen and observed under a fluorescence microscope. Figure 8 This is the fluorescence image after hybridization of fluorescent complementary chains.

[0122] Figure 8 This is a fluorescence image after the polyvinyl alcohol resin sheet is hybridized with the fluorescent complementary chain. From the fluorescence image, it can be seen that the initiating chain is successfully inoculated on the polyvinyl alcohol sheet and the polyvinyl alcohol stationary phase is successfully prepared.

[0123] Example 5: Biosynthetic DNA

[0124] The polymer fixed phase carrier coupled to the initiator chain is used to repeatedly perform DNA synthesis reaction and deprotection reaction cycles on a DNA synthesizer to synthesize the target sequence. Specifically, TdT enzyme and dNTP with protected bases can be used for enzyme reaction, and the protected bases can be eluted with a deprotection solution. Enzymatic synthesis of the target DNA sequence can be achieved through multiple cycles. The steps are as follows:

[0125] (1) Using TdT enzyme and dNTP with protected bases to perform enzyme reaction on the hybridized polymer stationary phase, the enzyme reaction system is shown in Table 1:

[0126]

[0127] The enzyme reaction conditions are 30°C and the reaction time is 5-10 min.

[0128] (2) Using a deprotection solution (0.3 mol / L sodium nitrite solution) to elute the protected bases, multiple cycles (specifically 120 cycles) are performed to synthesize multiple bases in the order of GTTGGTAACATGGGTTTGTAGGTGCCATAGTGGTGTATTGGACCGTTCAGGCCTATATCGTCATTGAGTATGGATCCGATAGCTTGCCTCTCCGTACGCG (SEQ ID No. 2) to achieve enzymatic synthesis of the target DNA sequence.

[0129] (3) For the use of polymer stationary phase carrier ( Figure 9-10 The result obtained by using the stationary phase carrier prepared in Example 3) The synthesized target DNA sequence was first subjected to PolyA synthesis in a PCR instrument. The PolyA synthesis system is shown in Table 2, and the PCR conditions are shown in Table 3.

[0130]

[0131]

[0132] (4) Perform PCR amplification on the entire sequence. The PCR reaction system is shown in Table 4, and the PCR reaction conditions are shown in Table 5. Perform agarose gel electrophoresis on the PCR amplified product, recover the target electrophoresis band and perform sequencing analysis on it. Fig. 9 As shown in the results, the sequencing accuracy can reach 99.5% and the yield can reach 60%. We also manually synthesized DNA, washed the polymer stationary phase support after each round of synthesis reaction, and then performed gel electrophoresis, such as Fig.10 As shown, it can be seen that after 8 rounds of washing, no DNA chain was washed off, proving that the polymer stationary phase carrier provided by the present invention has good stability.

[0133]

[0134]

[0135]

[0136] Comparative Example 1: Stationary phase carrier with glass as substrate

[0137] (1) Modification of functional groups

[0138] The glass slide was first cleaned with acetone for 5 minutes, then cleaned with acetonitrile and dried with compressed air. The dried glass slide was immersed in a 1% triethoxypropylsilazide acetonitrile solution for 2 hours, then cleaned with acetonitrile, dried with compressed air, and then heated in an oven at 60°C for 1 hour to obtain an azido glass slide.

[0139] (2) Coupling initiation chain

[0140] The initiator chain 1 (1 μl, 10 μmol / L) was dropped onto the glass slide modified with the azide group and reacted in a humidifier at 25°C for 2 hours. The glass slide after the reaction was rinsed with water three times, immersed in water for 2 hours, and then dried in a vacuum drying oven for 2 hours.

[0141] (3) Hybridization of fluorescent complementary chains

[0142] Immerse the glass slide with the coupled initiator chain in a well plate containing a fluorescent complementary chain (100 μl, 0.5 μmol / L) and hybridize at 25°C for 30 minutes. Aspirate the hybridization solution, wash it twice with 0.1 mol / L sodium chloride solution, blow it dry with nitrogen, and observe it under a fluorescence microscope. Fig.11 This is the fluorescence image after hybridization of fluorescent complementary chains.

[0143] like Fig.12 As shown, the same sequence as the stationary phase carrier in Example 3 was synthesized, using a glass sheet as the stationary phase carrier, with a synthesis accuracy of 99.2% and a yield of 47.61%.

[0144] The polymer stationary phase carrier proposed by the present invention has excellent physical and chemical properties with a polymer as a base, and obtains a functional polymer base by grafting functional groups on the surface of the polymer base and modifying it, thereby obtaining a stationary phase carrier with low preparation cost and good stability. The stationary phase carrier of the present invention can be used to carry out biological DNA synthesis reaction, and the synthesis accuracy and yield are also high.

[0145] The present invention has been described in detail above. It will be apparent to those skilled in the art that the present invention may be implemented in a wide range under equivalent parameters, concentrations and conditions without departing from the spirit and scope of the present invention and without the need for unnecessary experimentation. Although the present invention provides specific embodiments, it should be understood that further improvements may be made to the present invention. In short, according to the principles of the present invention, this application intends to include any changes, uses or improvements to the present invention, including changes made by conventional techniques known in the art that depart from the scope disclosed in this application. Applications of some of the basic features may be made within the scope of the following appended claims.

Claims

1. A polymer stationary phase carrier for DNA synthesis, the carrier comprising a polymer substrate, the material of which comprises any one of an ester polymer compound, a carboxylic acid polymer compound, a polymer halide and a polyhydroxy polymer compound; The surface of the polymer substrate is modified with a first functional group, and the first functional group reacts with the polymer substrate to covalently bond; the first functional group is a functional group that can react with an active functional group on the surface of the polymer substrate, such as an ester group, a carboxyl group, a halogen group or a hydroxyl group; The surface of the polymer substrate is also modified with functional groups, and the functional groups are groups that can undergo click reactions; The polymer stationary phase carrier also includes an initiator chain coupled to the polymer substrate through the functional group; the initiator chain is coupled to the surface of the polymer substrate modified with the functional group through the second functional group contained therein; The ester polymer compound includes at least one of polymethyl methacrylate, polyethylene glycol diacrylate, and hydroxypropyl methacrylate; The carboxylic acid polymer compound includes at least one of polyacrylic acid and polybutenoic acid; The polymer halide is a polymer containing halogen, the halogen is any one of fluorine, chlorine and bromine, and the polymer halide is specifically at least one of polytetrafluoroethylene, polyvinyl chloride, chlorinated polyvinyl chloride, chlorinated polypropylene or brominated polypropylene; The polyhydroxy polymer is at least one of polyvinyl alcohol, polyester polyol, polysaccharide, and polyamino acid; The first functional group is selected from any of the following groups: amino, hydroxyl, alkoxy, thiol, active ester, alkyl selenyl, phosphate, azido, metal alkyl; The functional group is a thiol group or an azide group; The second functional group is a functional group capable of reacting with an azide group or a thiol group.

2. The polymer stationary phase carrier according to claim 1, characterized in that: The second functional group is any one of a vinyl group, a cycloalkenyl group, a cycloalkadienyl group, a heterocycloalkenyl group, and an alkynyl group.

3. The polymer stationary phase carrier according to claim 1, characterized in that: The initiator strand is a single-stranded DNA that binds to DNA polymerase and guides DNA synthesis; the 5' end of the single-stranded DNA is modified with the second functional group and can be covalently bound to the surface of the polymer substrate.

4. The polymer stationary phase carrier according to claim 1, characterized in that: The polymer fixed phase carrier also includes a fluorescent DNA complementary chain; the fluorescent DNA complementary chain is complementary to the initiating chain.

5. Use of the polymer fixed phase carrier according to any one of claims 1 to 4 in DNA synthesis.

6. The method for preparing the polymer stationary phase carrier according to any one of claims 1 to 5, comprising the following steps: (1) modifying the first functional group on the surface of the polymer substrate and introducing a modified functional group; (2) The initiator chain is coupled with the functional group modified on the polymer substrate in step (1) by a click reaction through the second functional group contained therein, thereby obtaining the polymer stationary phase carrier.

7. The preparation method according to claim 6, characterized in that: The material of the polymer substrate is an ester polymer compound, and the first functional group of the surface modification of the ester polymer compound is carried out through an amidation substitution reaction; And / or, the material of the polymer substrate is a carboxylic acid polymer compound; the first functional group of the surface modification of the carboxylic acid polymer compound is carried out by an amidation condensation reaction; And / or, the material of the polymer substrate is a macromolecular halide; the first functional group modified on the surface of the macromolecular halide is obtained by a nucleophilic substitution reaction; And / or, the material of the polymer substrate is a polyhydroxy polymer compound; the first functional group of the polyhydroxy polymer compound surface modification is carried out by reaction with an active ester.

8. The preparation method according to claim 6 or 7, characterized in that: The method further comprises the step of hybridizing the priming strand and the fluorescent complementary strand after step (2) is completed.

Images