A Chinese golden fungus strain carried on space flight, AVIC-8, and its application

Abstract

This application is about a space-borne Chinese golden ear strain, Zhonghang 8, and its application, which belongs to the field of strain selection and breeding technology. The space-borne Chinese golden ear strain Zhonghang 8 in this application was deposited in the General Microbiological Center of the China Microbiological Culture Collection Administration on December 8, 2024, with a deposit number of CGMCC No.41689, and was classified and named Chinese golden ear ( Name Chinese ), the deposit address is No. 3, No. 1, Beichen West Road, Chaoyang District, Beijing. The Chinese golden ear fruiting bodies obtained by cultivating the Chinese golden ear strain Zhonghang 8 in this application are tested compared with wild Chinese golden ear fruiting bodies that have not been carried by spaceflight and conventional commercially available golden ear fruiting bodies. The total flavonoids content of the Chinese golden ear strain Zhonghang 8 fruiting bodies is more significant.

Description

Technical Field

[0001] The present application relates to the technical field of strain selection and breeding, and in particular to a Chinese golden ear bacterial strain, AVIC-8, carried on space flight, and its application. Background Art

[0002] Chinese golden ear, taxonomically belongs to the Tremellales, Tremellaceae, and Genus Golden Ear Naematelia Chinese golden ear is a wild edible fungus distributed in southwest my country at an altitude of 1800-2600 m. Its fruiting body is medium to large, colloid, irregular brain tumor-shaped, narrow at the base, 3-15 cm in diameter, golden yellow on the surface and white inside when fresh, with basidia 18-24 × 17-20 μm and basidiospores 9.5-11 (11.5) × 8-9.5 (10.0) μm.

[0003] Devoting oneself to the innovation of edible fungus germplasm, especially the domestication and cultivation of wild edible fungi, and the research of edible fungus germplasm resources with high active ingredients such as total flavonoids, has always been pursued by technical personnel in this field and has great application value. Summary of the invention

[0004] The present application provides a Chinese golden fungus strain Zhonghang 8, which has the characteristic of a total flavonoid content of up to 0.2%.

[0005] The Chinese golden ear strain Zhonghang 8 in this application was deposited in the General Microbiology Center of China Microbiological Culture Collection Administration on December 8, 2024, with the deposit number CGMCC No.41689, and the classification name is Chinese golden ear ( Naematelia sinensis ), the storage address is No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing.

[0006] Specifically, the new strain of Tricholoma auricularia sinensis in this application, Zhonghang No. 8, was obtained by the following breeding method:

[0007] First, the wild Chinese golden ear fruiting bodies collected from Tacheng Township, Yulong County, Yunnan Province in August 2022 were separated and purified by traditional methods to obtain pure cultures, and then the strains to be carried on space flight (numbered S16~106) were obtained through conventional golden ear strain resistance screening and mushroom production experiments. The depositor was requested to carry the numbered S16~106 Chinese golden ear strains on space flight through the Shenzhou 16 manned spacecraft at 9:31 on May 30, 2023, and at 8:11 on October 31, 2023, Beijing time, the numbered S16~106 Chinese golden ear strains returned to the ground with the return capsule of the Shenzhou 16 manned spacecraft; after fair treatment, the numbered S16~106 Chinese golden ear strains were brought back to the Kunming Institute of Botany, Chinese Academy of Sciences for activation and single spore separation and culture, and further screened and rescreened excellent strains according to the conventional breeding methods for edible fungi, numbered as AVIC 8.

[0008] The present application also provides a Chinese golden fungus fruiting body, which is obtained by cultivating the above-mentioned Chinese golden fungus strain Zhonghang No. 8.

[0009] The present application also provides an application of the fruiting body of Goldenrod in preparing food or medicine. After alcohol extraction of the fruiting body of Goldenrod obtained by cultivating the strain Zhonghang No. 8 provided in the present application, the total flavonoid content in the extract is 0.2%, which is significantly higher than the existing products and has broad application prospects.

[0010] The beneficial effects of this application are:

[0011] The Chinese golden ear fruiting bodies obtained by cultivating the Chinese golden ear strain AVIC 8 in the present application were tested against wild Chinese golden ear fruiting bodies that have not been carried on space flight and conventional commercially available golden ear fruiting bodies. The total flavonoids content of the Chinese golden ear fruiting bodies of the strain AVIC 8 is more significant. The total flavonoids content of the Chinese golden ear fruiting bodies in the present application is as high as 0.2%, which is significantly higher than existing products, and has great application value. BRIEF DESCRIPTION OF THE DRAWINGS

[0012] The above and other objects, features and advantages of the present application will become more apparent through a more detailed description of exemplary embodiments of the present application in conjunction with the accompanying drawings, wherein the same reference numerals generally represent the same components in the exemplary embodiments of the present application.

[0013] Figure 1 This is a fruiting body diagram of the strain Zhonghang 8 obtained in Example 1 of the present invention;

[0014] Figure 2 It is a schematic diagram of the phylogenetic tree of strain Zhonghang No. 8 in this application. DETAILED DESCRIPTION

[0015] The embodiments of the present application will be described in more detail below with reference to examples. Although the embodiments of the present application are shown in the examples, it should be understood that the present application can be implemented in various forms and should not be limited by the embodiments set forth herein. On the contrary, these embodiments are provided to make the present application more thorough and complete, and the scope of the present application can be fully communicated to those skilled in the art.

[0016] Example 1

[0017] This example illustrates the breeding process of the Chinese golden ear strain Zhonghang 8, and the specific steps are as follows:

[0018] (1) The wild golden ear fruiting bodies collected from Tacheng Township, Yulong County, Yunnan Province in August 2022 were separated and purified by traditional methods to obtain pure culture, and then the strains to be carried by spaceflight (numbered S16~106) were obtained through conventional golden ear strain resistance screening and mushroom fruiting experiments. The applicant used universal fungal ITS primers (ITS4 / ITS5) to amplify and identify the strain, and the identification results showed that it was golden ear.

[0019] (2) At 9:31 a.m. on May 30, 2023, strains S16 to S106 were carried into space by the Shenzhou 16 manned spacecraft. At 8:11 a.m. Beijing time on October 31, 2023, strains S16 to S106 were returned to Earth in the return capsule of the Shenzhou 16 manned spacecraft. After notarization, they were brought back to the Culture Collection Center of the Kunming Institute of Botany, Chinese Academy of Sciences for relevant research.

[0020] (3) The space-borne strains S16~106 were activated, the activated mycelium was ground, and the single root fragments were separated and cultured to obtain ZH801~ZH8200.

[0021] (4) Referring to GB / T 21125-2007 Technical Specifications for the Selection and Breeding of Edible Fungi, the conventional selection and breeding methods for edible fungi were further used to obtain a strain that was easy to produce mushrooms, grew fast, and had a high content of total flavonoids. The strain was named Zhonghang No. 8. The strain was preserved in the Kunming Institute of Botany, Chinese Academy of Sciences (KUNCC) using the 10% glycerol + distilled water preservation method.

[0022] (6) The Chinese golden fungus strain Zhonghang 8 was deposited in the General Microbiology Center of China Microorganism Culture Collection Administration on December 8, 2024, with the deposit number: CGMCC No.41689, and the deposit address is No. 3, No. 1 Beichen West Road, Chaoyang District, Beijing.

[0023] The characteristics of the Chinese golden fungus strain Zhonghang 8 in this embodiment are as follows:

[0024] 1. Morphological characteristics

[0025] The fruiting body of the Chinese golden ear is medium to large, colloid, irregular brain tumor-shaped, narrow at the base, 3-15 cm in diameter, golden yellow on the surface and white inside when fresh, with basidia 18-24 × 17-20 μm and basidiospores 9.5-11 × 8-9.5 μm. Figure 1 shown.

[0026] 2. Biological characteristics

[0027] (1) The growth temperature of original species and cultivated species is 10℃~28℃, and the optimum growth temperature is 23℃; the optimum temperature for fruiting body differentiation is 17℃~23℃; the growth temperature of fruiting body is 15℃~26℃, and the optimum temperature is 18℃~23℃.

[0028] (2) The suitable air humidity during the mycelium growth period is 55%~65%. The air humidity during the growth period of young mushrooms is 65%~85%.

[0029] (3) Light: Mycelium does not require light during growth and should be cultured in dark conditions. However, fruiting body formation and development require 300~2000Lux scattered light stimulation.

[0030] (4) Nutrition: The mycelium of T. sinensis mainly parasitizes on the hairy leathery fungus, which provides it with nutrition.

[0031] 3. Genetic characteristics

[0032] The genomic DNA of the Chinese golden ear strain Zhonghang 8 was first amplified and sequenced using the universal primers ITS4 / ITS5 for fungi for the internal transcribed spacer region (ITS) of the ribosome. The bases obtained by sequencing are shown in SEQ ID NO.1, specifically:

[0033] GTCAGCCCTCGGGCTCAAACATTGTGTAATGAACGTCTATAACATAACCTAATAAAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCTTTTGGTATTCCGAAAGGCATGCCTGTTTGAGTGTCAT GAACTCTCAATCCCCTCGGGTTTCCGACTGGATTGGACTTGGGTGCTGCCGTTTGGCTCCTCCTTAAATGACTTAGTGGATGTCTCCCCTAGTCGATGTAATAAGTTTCATCGGTGAAGGGTCTAGTCTGCTCACAATCGCCTTTGCTGGCAACATTTGTACTCTGACCTCAAATCAGGTAGGGCTACCCGCTGAACTTAAGCATATCAAA

[0034] The fragment was sequenced through GenBank and the result was that it belonged to the genus Xylella fastidiosa ( Naematelia) fungi, and 100% homologous to gene accession numbers (PQ084585, PP917727, PQ650952, OP881423 and OQ629799, etc.). Further referring to the data already obtained by the inventors (Tang & Yang, 2024), a phylogenetic tree was constructed to obtain the following phylogenetic tree, as shown in Figure 2 The strain Zhonghang 8 (CGMCC No. 41689) was identified as Auricularia auriculariae.

[0035] Furthermore, the cultivation of the Chinese golden ear strain Zhonghang No. 8 in this embodiment 1 is carried out with reference to the existing technology for cultivation and management, and specifically with reference to the existing literature: Liu Zhengnan, Zheng Shufang. Artificial cultivation technology of golden ear [M]. Golden Shield Publishing House, 2002. for cultivation, thereby obtaining the fruiting body of the Chinese golden ear strain Zhonghang No. 8.

[0036] Example 2 Total flavonoids content test comparison

[0037] In this example, the total flavonoid content of the fruiting bodies of the Chinese golden ear strain Zhonghang 8 obtained by cultivating in Example 1 was tested and compared with the fruiting bodies of wild Chinese golden ear and the existing conventional commercially available golden ear fruiting bodies.

[0038] Specifically, the determination method refers to the existing literature: Yang Wenhui, Meng Min, et al. Study on the antioxidant activity and total flavonoids content of different edible fungi [J]. Journal of Traditional Chinese Medicine, 2020, 31 (2): 301-303.

[0039] The test results are shown in the following table:

[0040] Table 1 Total flavonoids content determination results

[0041]

[0042] It can be seen from the above table that compared with the test of wild Chinese golden ear fruiting bodies that have not been carried into space and conventional commercially available golden ear fruiting bodies, the total flavonoids content of the Chinese golden ear strain Zhonghang No. 8 fruiting bodies is more significant.

[0043] The embodiments of the present application have been described above, and the above description is exemplary, not exhaustive, and is not limited to the disclosed embodiments. Many modifications and changes will be apparent to those of ordinary skill in the art without departing from the scope and spirit of the described embodiments. The selection of terms used herein is intended to best explain the principles of the embodiments, practical applications, or improvements to the technology in the market, or to enable other persons of ordinary skill in the art to understand the embodiments disclosed herein.

Claims

1. A Chinese golden fungus strain Zhonghang No. 8 carried by spaceflight, characterized by: It was deposited in the General Microbiology Center of China Microbiological Culture Collection Administration on December 8, 2024, with the deposit number CGMCC No.41689, and the classification name was Chinese golden ear ( Naematelia sinensis ), the storage address is No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing.

2. A fruiting body of Goldenseal sinensis, characterized in that: Obtained by cultivating the Chinese golden ear strain Zhonghang 8 as described in claim 1.

3. Use of the Chinese golden ear fruiting body according to claim 2 in preparing food.

Images