Construction and application of a fusion gene encoding a green fluorescent labeled nerve growth factor fusion protein with biological activity

Abstract

The present invention relates to the field of gene engineering technology, and specifically to the construction and application of a fusion gene encoding a nerve growth factor fusion protein with biological activity and green fluorescence labeling. The nucleotide sequence of the fusion gene and the amino acid sequence of the fusion protein are shown in SEQ ID No.1 and SEQ ID No.2, respectively. The present invention also relates to methods such as the construction of an expression plasmid containing the nucleotide sequence of the fusion gene and the preparation of a viral vector. The fusion gene can be expressed in cells cultured in vitro and in animals to form a nerve growth factor fusion protein with green fluorescence, so that its expression and distribution in cells and tissues can be directly observed under a fluorescence microscope, and the fusion protein still has the biological activity of the nerve growth factor, and the nerve growth factor in the fusion protein can be accurately measured by measuring the fluorescence intensity of the fusion protein or the content of the fusion protein.

Description

Technical Field

[0001] The invention belongs to the technical field of gene engineering, and specifically relates to the construction and application of a fusion gene encoding a nerve growth factor fusion protein with a green fluorescent marker and biological activity. Background Art

[0002] Nerve growth factor protein NGF is the first member of the neurotrophic factor family to be identified. NGF is a protein with a molecular weight of 130-140 kDa, composed of three subunits, α, β and γ. The biological activity of NGF mainly comes from the β subunit, which is a 27 kDa dimer composed of two monomers. NGF is necessary for the development and survival of nerve cells. It can regulate the size of cells, promote the occurrence of nerve cell processes and the extension of axons. Although mature nerve cells can tolerate the absence of NGF for a short period of time, the cells will undergo pathological changes such as atrophy and progressive death. In vivo, although glial cells contain NGF, endogenous NGF mainly comes from nerve cells. After damage to the central nervous system (CNS) and peripheral nervous system (PNS), the expression of endogenous NGF and NGF receptors is increased. The administration of exogenous NGF can promote the survival of damaged nerve cells, the extension of axons and the repair of function. For example, after brain injury, the administration of exogenous NGF can prevent the apoptosis and necrosis of cholinergic nerve cells. Studies on peripheral nerve transection have found that exogenous NGF can increase the number of axon regeneration and myelin formation. In the area of ​​spinal cord dorsal root injury, administration of neurotrophic factors including NGF can promote the growth of damaged axons into the spinal cord. This shows that the administration of exogenous NGF helps the repair and regeneration of damaged nerves.

[0003] However, when administering exogenous NGF protein / Ngf gene to treat CNS diseases, the existing technologies and methods for detecting and tracing NGF have many obvious disadvantages, such as: 1) When labeling NGF protein by chemical, radioactive isotope and fluorescent methods, it is difficult to control the quantity, the repeatability is very poor, the results obtained are sometimes contradictory, and the radioactive isotopes are harmful to the body. 2) When detecting NGF by immunological methods, the success of the detection depends on many factors, including the concentration of exogenous NGF, the sensitivity and concentration of the detection antibody, the operator's proficiency in the experimental steps, etc. 3) In terms of workload, immunological detection of NGF is an additional task, which increases the workload. Summary of the invention

[0004] In view of the deficiencies in the prior art and actual needs, the present invention designs and constructs a fusion gene encoding a green fluorescently labeled NGF fusion protein with biological activity. The fusion gene can be expressed in cells and tissues as an NGF fusion protein with green fluorescence, so that its expression and distribution in cells and tissues can be directly observed under a fluorescence microscope. The fusion protein still has the biological activity of the NGF protein, and the NGF protein in the fusion protein can be accurately quantified by measuring the fluorescence intensity of the fusion protein or the content of the fusion protein.

[0005] The present invention provides a fusion gene encoding a green fluorescent-labeled NGF fusion protein with biological activity, characterized in that it is formed by the fusion of the Ngf gene, a unique 45 nucleotide sequence, a Kozak sequence, and a green fluorescent protein gene Ng, and its nucleotide sequence is shown in SEQ ID No.1.

[0006] The present invention also provides a green fluorescent labeled NGF fusion protein with biological activity, the amino acid sequence of which is shown in SEQ ID No.2.

[0007] The present invention also provides an expression plasmid, which carries the fusion gene with the above nucleotide sequence as shown in SEQ ID No. 1, and the gene expression element carried by the expression plasmid can mediate the expression of the fusion gene in cells.

[0008] The present invention also provides a viral vector, which carries the above-mentioned nucleotide sequence as the fusion gene shown in SEQ ID No.1, and the viral vector can enable the above-mentioned fusion gene to enter cells cultured in vitro for expression, and can enable the fusion gene to pass through the blood-brain barrier in the animal body and be expressed in the brain tissue of the animal.

[0009] Furthermore, the viral vector is transferred into a 21x150cm 2 The 293T cells were cultured in DMEM containing 10% fetal bovine serum by volume, thereby packaging and preparing the obtained product.

[0010] The present invention also provides a method for constructing the fusion gene having the nucleotide sequence shown in SEQ ID No. 1, or an expression plasmid containing the fusion gene, comprising the following steps:

[0011] Step 1: Use an RNA extraction kit to extract total RNA from mouse brain, determine the RNA content in the sample by Nano drop, and detect the presence, integrity and purity of RNA by agarose gel electrophoresis;

[0012] Step 2: Reverse transcribe the mRNA into cDNA by RT-PCR, and use the cDNA as a template to perform PCR with the following primers to synthesize the β-Ngf gene containing 45 nucleotides and the Kozak sequence:

[0013] Forward primer: GCGGCCCAACGGTACCATGTCCATGTTGTTCTACACTCTGA,

[0014] Reverse Primer:

[0015] CCATGGTGGCGGTACCGGATCCTCCTCCTCCGGATCCTCCTCCTCCGGATCCTCCTCCTCCGCCTCTTCT TGTAGCCTTCCTG,

[0016] Step 3: Use restriction endonuclease Acc65I to digest the expression plasmid pCAG-NG carrying the green fluorescent protein gene Ng, and recover the plasmid using a gel recovery kit; connect the β-Ngf gene containing 45 nucleotides and a Kozak sequence synthesized in step 2 to pCAG-NG to construct an expression plasmid containing a fusion gene consisting of the Ngf gene, a unique 45 nucleotide sequence, a Kozak sequence, and the green fluorescent protein gene Ng, namely, the pCAG-Ngf-NG expression plasmid.

[0017] The present invention also discloses the use of the above fusion gene or the above fusion protein or the above expression plasmid or the above virus vector in preparing medicine for treating the repair and regeneration of nerve damage.

[0018] Furthermore, the nerve damage is central nervous system damage and / or peripheral nervous system damage.

[0019] The present invention also discloses the application of the above fusion gene or the above fusion protein in detecting the effect of medicine for treating the repair and regeneration of nerve damage.

[0020] Furthermore, in the application, the therapeutic effect can be evaluated by detecting the presence and content of nerve growth factor (NGF protein).

[0021] Compared with the prior art, the technical effect of the present invention is positive and obvious. After the fusion gene of the present invention is directly transfected into cells through an expression plasmid, or it is packaged into an AAV viral vector and then transduced into cells cultured in vitro, or it is packaged into an AAV viral vector and intravenously injected into mice, the fusion gene formed by the Ngf gene-green fluorescent protein gene can be expressed as NGF protein with green fluorescence in cells and tissues. Through a fluorescent microscope, its expression and distribution in cells and tissues can be directly observed without the need for additional immunohistochemistry / immunofluorescence staining. By measuring the fluorescence intensity or content of the NGF fusion protein, the NGF protein content in the fusion protein can be measured. In addition, the NGF fusion protein with green fluorescence expressed by the fusion gene still has the biological activity of the NGF protein, can promote the growth of neuron-like axons, and promote the recovery of movement and hippocampal spatial memory function in mice after craniocerebral trauma. BRIEF DESCRIPTION OF THE DRAWINGS

[0022] Figure 1 : Design diagram of the fusion gene encoding the biologically active green fluorescent-labeled nerve growth factor fusion protein.

[0023] Figure 2 :After the expression plasmid pCAG-Ngf-NG carrying the nerve growth factor (Ngf) fusion gene was transfected into the neuron-like cell PC12, the expression and secretion of the Ngf fusion gene, and its effect on the axon growth of PC12 cells. A is the expression result of P0; B is the expression result of P1 (cell process growth); C is the measurement result of the length of cell processes in the P0 and P1 groups (C, *p<0.001, Student's t-test); D is the result of the determination of the content of NGF fusion protein in the culture supernatant of P0 and P1 cells by an ELISA kit for detecting NGF protein (D, *p<0.001, Student's t-test); P0 is a PC12 cell transfected with the pCAG-NG empty vector without the Ngf fusion gene, and P1 is a PC12 cell transfected with the AAV expression plasmid pCAG-Ngf-NG carrying the Ngf fusion gene, and the picture scale = 100μm.

[0024] Figure 3: Effects of the prepared and purified AAV.CAP-B10-Ngf-NG viral vector carrying the nerve growth factor (Ngf) fusion gene on the processes and branching of PC12 cells cultured in vitro. A is the fluorescence result of cells and processes after PC12 cells cultured in vitro were transduced with empty virus vector; B is the fluorescence result of cell body and processes after PC12 cells cultured in vitro were transduced with Ngf virus vector; C is the statistical analysis of the length of cell processes after PC12 cells cultured in vitro were transduced with empty virus vector and Ngf virus vector respectively; D is the statistical analysis of the number of process branches of cells after PC12 cells cultured in vitro were transduced with empty virus vector and Ngf virus vector respectively; AAV.CAP-B10-Ngf-NG: virus vector carrying Ngf fusion gene (Ngf virus vector), AAV.CAP-B10: empty virus vector without Ngf fusion gene (empty virus vector), (C, *p<0.05, Student's t-test, n=5 / group; D, **p<0.05, Student's t-test, n=5 / group).

[0025] Figure 4 : Expression of nerve growth factor (Ngf) fusion gene in the brain tissue of mice with traumatic brain injury (TBI) mediated by AAV.CAP-B10-Ngf-NG viral vector injected via tail vein. A is a brain tissue section on the contralateral side of the injury after injection of AAV.CAP-B10-NG and AAV.CAP-B10-Ngf-NG; B is a brain tissue section on the ipsilateral side of the injury after injection of AAV.CAP-B10-NG and AAV.CAP-B10-Ngf-NG and immunofluorescence staining with anti-NGF antibody. AAV.CAP-B10-Ngf-NG is a viral vector carrying the Ngf fusion gene (Ngf viral vector); AAV.CAP-B10 is an empty viral vector without the Ngf fusion gene (empty viral vector); Anti-NGF Ab is an antibody against NGF; DAPI, or 4',6-diamidino-2-phenylindole, is a dye that can bind to DNA, stain cell nuclei, and display blue fluorescence under a fluorescence microscope; Merged is a picture that overlaps the green light (representing NGF fusion protein), red light (representing anti-NGF antibody staining), and blue light (representing DAPI-stained cell nuclei) of the same brain slice.

[0026] Figure 5:Effects of nerve growth factor (Ngf) gene therapy on impaired cortical motor function and hippocampal memory function in mice with traumatic brain injury (TBI). A shows the effect on cortical motor function; B shows the effect on hippocampal memory function. A, *p<0.01 and **p<0.05, One-way ANOVA; B, *p<0.05, One-way ANOVA; CCI is controlled cortical injury, a type of TBI. PBS group n=7; B10 group n=8; B10-Ngf group n=8.

[0027] Figure 6 : Evaluation of the toxicity of the expression of nerve growth factor (Ngf) fusion gene on cell growth. B10 group: AAV.CAP-B10-NG empty virus vector group (n=4); B10-Ngf group: AAV.CAP-B10-Ngf-NG virus vector group transduced with Ngf fusion gene (n=4); Control group: control group without AAV transduction (n=4). DETAILED DESCRIPTION

[0028] The following is a further description of the specific embodiments and technical solutions of the present invention in conjunction with the accompanying drawings and specific examples, and the specific examples provide preferred embodiments. The reagents, equipment and methods used in the present invention are all conventional reagents, equipment and methods in the art, and all conventional commercial products with source and specific models marked, and their test methods and specific conditions are carried out according to the test methods and conditions in the instructions of the corresponding products, and if there are no special instructions, the raw materials (actual, methods and equipment) used can be purchased from conventional commercial products, and the reagents, equipment and test methods are all conventional reagents, equipment and methods in the art.

[0029] Example 1: Design and construction of a fusion gene consisting of nerve growth factor gene (β-Ngf) + 45 nucleotides + Kozak sequence + green fluorescent protein gene (Ng)

[0030] A fusion gene encoding a green fluorescent labeled NGF fusion protein with biological activity was designed. The fusion gene was formed by the fusion of the nerve growth factor gene Ngf, a unique 45 nucleotide sequence, a Kozak sequence, and a green fluorescent protein gene Ng. Figure 1 ), the nucleotide sequence of which is shown in SEQ ID No.1.

[0031] SEQ ID No.1:

[0032] ATGTCCATGTTGTTCTACACTCTGATCACTGCGTTTTTGATCGGCGTACAGGCAGAACCGTACACAGATAGCAATGTCCCAGAAGGAGACTCTGTCCCTGAAGCCCACTGGACTAAACTTCAGCATTCCCTTGACACAGCCCTCCGCAGAGCCCGCAGTGCCCCTACTGCACCAATAGCTGCCCGAGTGACAGGGCAGACCCGCAACATCACTGTAGACCCCAGACTGTTTAAGAAACGGAGACTCCACTCACCCCGTGTGCTGTTCAGCACCCAGCCTCCACCCACCTCTTCAGACACTCTGGATCTAGACTTCCAGGCCCATGGTACAATCCCTTTCAACAGGACTCACCGGAGCAAGCGCTCATCCACCCACCCAGTCTTCCACATGGGGGAGTTCTCAGTGTGTGACAGTGTCAGTGTGTGGGTTGGAGATAAGACCACAGCCACAGACATCAAGGGCAAGGAGGTGACAGTGCTGGCCGAGGTGAACATTAACAACAGTGTATTCAGACAGTACTTTTTTGAGACCAAGTGCCGAGCCTCCAATCCTGTTGAGAGTGGGTGCCGGGGCATCGACTCCAAACACTGGAACTCATACTGCACCACGACTCACACCTTCGTCAAGGCGTTGACAACAGATGAGAAGCAGGCTGCCTGGAGGTTCATCCGGATAGACACAGCCTGTGTGTGTGTGCTCAGCAGGAAGGCTACAAGAAGAGGCGGAGGAGGAGGATCCGGAGGAGGAGGATCCGGAGGAGGAGGATCCGGTACC GCCACCATGGTGAGCAAGGGCGAGGAGGATAACATGGCCTCTCTCCCAGCGACACATGAGTTACACATCTTTGGCTCCATCAACGGTGTGGACTTTGACATGGTGGGTCAGGGCACCGGCAATCCAAATGATGGTTATGAGGAGTTAAACCTGAAGTCCACCAAGGGTGACCTCCAGTTCTCCCCCTGGATTCTGGTCCCTCATATCGGGTATGGCTTCCATCAGTACCTGCCCTACCCTGACGGGATGTCGCCTTTCCAGGCCGCCATGGTAGATGGCTCCGGATACCAAGTCCATCGCACAATGCAGTTTGAAGATGGTGCCTCCCTTACTGTTAACTACCGCTACACCTACGAGGGAAGCCACATCAAAGGAGAGGCCCAGGTGAAGGGGACTGGTTTCCCTGCTGACGGTCCTGTGATGACCAACTCGCTGACCGCTGCGGACTGGTGCAGGTCGAAGAAGACTTACCCCAACGACAAAACCATCATCAGTACCTTTAAGTGGAGTTACACCACTGGAAATGGCAAGCGCTACCGGAGCACTGCGCGGACCACCTACACCTTTGCCAAGCCAATGGCGGCTAACTATCTGAAGAACCAGCCGATGTACGTGTTCCGTAAGACGGAGCTCAAGCACTCCAAGACCGAGCTCAACTTCAAGGAGTGGCAAAAGGCCTTTACCGATGTGATGGGCATGGACGAGCTGTACAAGTGA

[0033] The amino acid sequence of the fusion protein encoded by the fusion gene is shown in SEQ ID No.2.

[0034] SEQ ID No.2:

[0035] MSMLFYTLITAFLIGVQAEPYTDSNVPEGDSVPEAHWTKLQHSLDTALRRARSAPTAPIAARVTGQTRNITVDPRLFKKRRLHSPRVLFSTQPPPTSSDTLDLDFQAHGTIPFNRTHRSKRSSTHPVFHMGEFSVCDSVSVWVGDKTTATDIKGKEVTVLAEVNINNSVFRQYFFETKCRASNPVESGCRGIDSKHWNSYCTTTHTFVKALTTDEKQAAWRFIRIDTACVCVLSRKATRRGGGGGSGGGGSGGGGSGTATMVSKGEEDNMASLPATHELHIFGSINGVDFDMVGQGTGNPNDGYEELNLKSTKGDLQFSPWILVPHIGYGFHQYLPYPDGMSPFQAAMVDGSGYQVHRTMQFEDGASLTVNYRYTYEGSHIKGEAQVKGTGFPADGPVMTNSLTAADWCRSKKTYPNDKTIISTFKWSYTTGNGKRYRSTARTTYTFAKPMAANYLKNQPMYVFRKTELKHSKTELNFKEWQKAFTDVMGMDELYK-

[0036] Among them, the sequence of the nerve growth factor gene Ngf is:

[0037] ATGTCCATGTTGTTCTACACTCTGATCACTGCGTTTTTGATCGGCGTACAGGCAGAACCGTACACAGATAGCAATGTCCCAGAAG

[0038] GAGACTCTGTCCCTGAAGCCCACTGGACTAAACTTCAGCATTCCCTTGACACAGCCCTCCGCAGAGCCCGCAGTGCCCCTACTGC

[0039] ACCAATAGCTGCCCGAGTGACAGGGCAGACCCGCAACATCACTGTAGACCCCAGACTGTTTAAGAAACGGAGACTCCACTCACCC

[0040] CGTGTGCTGTTCAGCACCCAGCCTCCACCCACCTCTTCAGACACTCTGGATCTAGACTTCCAGGCCCATGGTACAATCCCTTTCA

[0041] ACAGGACTCACCGGAGCAAGCGCTCATCCACCCACCCAGTCTTCCACATGGGGGAGTTCTCAGTGTGTGACAGTGTCAGTGTGTG

[0042] GGTTGGAGATAAGACCACAGCCACAGACATCAAGGGCAAGGAGGTGACAGTGCTGGCCGAGGTGAACATTAACAACAGTGTATTC

[0043] AGACAGTACTTTTTTGAGACCAAGTGCCGAGCCTCCAATCCTGTTGAGAGTGGGTGCCGGGGCATCGACTCCAAACACTGGAACT

[0044] CATACTGCACCACGACTCACACCTTCGTCAAGGCGTTGACAACAGATGAGAAGCAGGCTGCCTGGAGGTTCATCCGGATAGACACAGCCTGTGTGTGTGTGCTCAGCAGGAAGGCTACAAGAAGAGGC(SEQ ID No.3)。

[0045] The sequence of the green fluorescent protein gene Ng is:

[0046] ATG TGAGCAAGGGCGAGGAGGATAACATGGCCTCTCTCCCAGCGACACATGAGTTACACATCTTTGGCTCCATCAACGGTGTGG

[0047] ACTTTGACATGGTGGGTCAGGGCACCGGCAATCCAAATGATGGTTATGAGGAGTTAAACCTGAAGTCCACCAAGGGTGACCTCCA

[0048] GTTCTCCCCCTGGATTCTGGTCCCTCATATCGGGTATGGCTTCCATCAGTACCTGCCCTACCCTGACGGGATGTCGCCTTTCCAG

[0049] GCCGCCATGGTAGATGGCTCCGGATACCAAGTCCATCGCACAATGCAGTTTGAAGATGGTGCCTCCCTTACTGTTAACTACCGCT

[0050] ACACCTACGAGGGAAGCCACATCAAAGGAGAGGCCCAGGTGAAGGGGACTGGTTTCCCTGCTGACGGTCCTGTGATGACCAACTC

[0051] GCTGACCGCTGCGGACTGGTGCAGGTCGAAGAAGACTTACCCCAACGACAAAACCATCATCAGTACCTTTAAGTGGAGTTACACC

[0052] ACTGGAAATGGCAAGCGCTACCGGAGCACTGCGCGGACCACCTACACCTTTGCCAAGCCAATGGCGGCTAACTATCTGAAGAACC

[0053] AGCCGATGTACGTGTTCCGTAAGACGGAGCTCAAGCACTCCAAGACCGAGCTCAACTTCAAGGAGTGGCAAAAGGCCTTTACCGATGTGATGGGCATGGACGAGCTGTACAAGTGA (SEQ ID No. 4).

[0054] The unique 45 nucleotide sequence is:

[0055] GGATCCTCCTCCTCCGGATCCTCCTCCTCCGGATCCTCCTCCTCC (SEQ ID No.5).

[0056] The Kozak sequence is: CCATGGTGGC (SEQ ID No.6).

[0057] The method for constructing the fusion gene comprises the following steps:

[0058] Step 1: First, use the RNA extraction kit (Tiangen, No. DP451) to extract total RNA from the mouse brain according to the instructions. Then use Nano drop (Thermo Fisher Scientific, product model Nanodrop One) to determine the RNA content in the sample, and then use the following experiments to detect the presence, integrity and purity of RNA. The results of agarose gel electrophoresis with a mass percentage concentration of 1% showed that the two RNAs of 28S and 18S were clearly visible, indicating that the RNA we prepared was intact; OD 260 / OD 280 A ratio between 1.8 and 2.0 indicates that the RNA has a high purity.

[0059] Step 2: Use a reverse transcription kit (Takara, No. 6215A) to reverse transcribe the mRNA into cDNA according to the instructions; then, use a PCR premix (Novozymes, No. P525) to perform PCR with the following primers using cDNA as a template according to the instructions to synthesize the β-Ngf gene containing 45 nucleotides and a Kozak sequence.

[0060] Forward primer: GCGGCCCAACGGTACC ATGTCCATGTTGTTCTACACTCTGA( SEQ ID No.7).

[0061] The primer sequence contains part Partial β-Ngf gene sequence ( ATGTCCATGTTGTTCTACACTCTGA )

[0062] Reverse Primer:

[0063] CCATGGTGGC GGTACC GGATCCTCCTCCTCCGGATCCTCCTCCTCCGGATCCTCCTCCTCC GCCTCTTCTTGTAGCCTTCCTG (SEQ ID No. 8).

[0064] The primer sequence contains 45 nucleotides GGATCCTCCTCCGGATCCTCCTCCTCCGGATCCTCCTCC TCC and Kozak sequence CCATGGTGGC

[0065] Step 3. Use 10 units of restriction endonuclease Acc65I (NEB, No. R0599V) to digest 1 μg of expression plasmid pCAG-NG (Addgene) carrying the green fluorescent protein gene (Ng) according to the instructions, and then recover the plasmid using a gel recovery kit (Tiangen, No. DP219). Connect the β-Ngf gene containing 45 nucleotides and Kozak sequence synthesized in step 2 to pCAG-NG (Takara, No. 638947) at a ratio of 2:1 to construct an AAV expression plasmid pCAG-Ngf-NG containing a fusion gene consisting of the Ngf gene, a unique 45 nucleotide sequence, a Kozak sequence, and a green fluorescent protein gene. Then, sequence the recombinant (Sangon) to confirm the correctness of the gene sequence ( Figure 1 ).

[0066] Sequencing results showed that the constructed recombinant included Figure 1 The sequence of all components (β-Ngf+45 nucleotides+Kozak+Ng) in the genome was confirmed, and the gene sequence was correct (SEQ ID No. 1).

[0067] Example 2: Effect of AAV expression plasmid pCAG-Ngf-NG on cell neurite outgrowth.

[0068] The transfection reagent 1 mg / mL PEI40k (Yisen Company, No.: 40816ES) and the recombinant of Example 1 were mixed in a ratio of 2:1 and transfected into neuronal PC12 cells cultured in vitro on a 24-well plate (Thermo's F12K medium + 2.5% fetal bovine serum + 15% horse serum, 5% CO2, 37°C) to observe whether the Ngf fusion gene can be expressed as a fusion protein of NGF-green fluorescent protein and whether it can promote the axon growth of PC12 cells.

[0069] The results showed that the fusion gene we constructed could be expressed as a fusion protein containing NGF-green fluorescent protein and could promote the axon growth of PC12 cells, thus having the biological activity of NGF ( Figure 2 ). This indicates that the Ngf fusion gene we constructed was successful.

[0070] Example 3: Preparation of AAV virus vector carrying Ngf fusion gene

[0071] Since the AAV expression plasmid pCAG-Ngf-NG cannot directly transfect cells, it needs the help of a transfection reagent similar to that mentioned in Example 2 to enter cells for expression. Moreover, even with the help of a transfection reagent, it cannot effectively pass through the blood-brain barrier (BBB) ​​of animals and express in brain tissue. Therefore, the AAV expression plasmid pCAG-Ngf-NG was used to prepare an AAV viral vector AAV-CAP-B10-Ngf-NG carrying a fusion gene to help express the fusion gene in cells and animal brain tissue.

[0072] Step 1: Transfect pCAG-Ngf-NG and two other plasmids pHelper and pCAP-B10 (1:1:1, 3 mg in total) into a 21x150cm 2 The 293T cells were cultured in DMEM containing 10% fetal bovine serum to package and prepare the AAV-CAP-B10-Ngf-NG viral vector. The same method is used pCAG-NG was used to prepare AAV-CAP-B10-NG empty viral vector.

[0073] Step 2: After 3 days, the cell culture medium and cells were collected. The AAV-CAP-B10-Ngf-NG viral vector in 40% iodixanol was collected by ultracentrifugation (350 K g, 10° C., 1.5 hours) on an iodixanol chromatography column (chromatography column composed of 15%+20%+40%+60% iodixanol), and concentrated using Amicon Ultra-15 (Amicon, Ultra-15) according to the instructions.

[0074] Step 3: Detect the titer of AAV-gCAP-B10-Ngf-NG viral vector using the following primers by quantitative PCR.

[0075] Forward primer: GGAACCCCTAGTGATGGAGTT (SEQ ID No. 9);

[0076] Reverse primer: CGGCCTCAGTGAGCGA (SEQ ID No. 10);

[0077] The results of quantitative PCR showed that the titer of the prepared viral vector was greater than 1x10 12 vg / mL.

[0078] Example 4: Transduction of PC12 cells cultured in vitro by AAV viral vector AAV.CAP-B10-Ngf-NG and its effects on cell processes and branches.

[0079] After preparing and purifying the AAV.CAP-B10-Ngf-NG virus vector (Ngf virus vector) carrying the Ngf fusion gene and the AAV.CAP-B10-NG empty virus vector (empty virus vector) without the Ngf gene, the two virus vectors were added to the PC12 cells cultured in vitro (Thermo's F12K medium + 2.5% fetal bovine serum + 15% horse serum, 5% CO2, 37°C) at a ratio of 1:100. After 48 hours, the length and number of branches of the PC12 cells were analyzed by fluorescence microscopy, and it was seen that ( Figure 3 ): Compared with the empty virus vector group (A), the neurites of PC12 cells in the Ngf virus vector group (B) were significantly extended (C, *p<0.05, Student's t-test, n=5 / group), and the number of neurites of PC12 cells was also significantly increased (D, **p<0.05, Student's t-test, n=5 / group). This shows that we can not only successfully prepare and purify AAV virus vectors, but also that the prepared AAV virus vectors can mediate the expression of Ngf genes and promote the significant extension of axons. This provides a cytological basis for animal experimental research.

[0080] Example 5: Transduction of brain tissue of mice after craniocerebral trauma by AAV.CAP-B10-Ngf-NG viral vector and its effects on motor and memory functions of mice

[0081] After establishing a traumatic brain injury (TBI) mouse animal model (parameters: impact head size 3 mm, speed 3 m / s, depth 2 mm), the AAV viral vector AAV-CAP-B0-Ngf-NG was injected into each mouse at a rate of 2x10 11The dose of viral genome was injected into mice through the tail vein, and then the changes in cortical motor and hippocampal memory function of mice were detected by behavioral tests such as Rotarod, Barnes, and novel object recognition at 1, 3, 5, 7, and 14 days after TBI and administration ( Figure 4-5 ).

[0082] (1) The AAV viral vector AAV.CAP-B10-Ngf-NG injected via the tail vein mediated the expression of the Ngf gene in the brain tissue of TBI mice.

[0083] The results showed that on the 7th day after injection, extensive green fluorescence was observed on the contralateral side of the injury in the perfused and fixed brain tissue sections of both groups (A). Similarly, green fluorescence was also observed in the damaged brain tissue on the ipsilateral side of the injury (B). In order to confirm that the green fluorescence mediated by the Ngf viral vector in the brain tissue is a fusion protein formed by the NGF protein and the green fluorescent protein (NG), the project team of this application used an anti-NGF antibody (Anti-NGF Ab) to perform immunofluorescence staining on the brain sections. After the NGF protein was labeled with red fluorescence (B), it can be seen that the red NGF and the green NGF fusion protein completely overlap (B, Merged lower figure, orange). In the control group of the empty viral vector, no cells were labeled with red fluorescence (B). This result confirms that under the mediation of the AAV viral vector, the Ngf gene can pass through the BBB and express in the brain tissue to generate NGF protein. The above experimental results provide a feasibility basis for the Ngf viral vector we constructed to treat TBI. The blue in Figure B is the cell nucleus stained with DAPI. In Figure A, long scale bar = 100 μm, short scale bar = 40 μm; in Figure B, scale bar = 20 μm.

[0084] The results obtained by Rotarod and Barnes Maze animal behavior detection methods showed that after Ngf gene therapy for traumatic brain trauma (TBI), the damaged cortical motor function and hippocampal memory function of mice were significantly improved.

[0085] Before TBI, the experimental animals were trained on the Rotarod for 3 days. On the 3rd day, the animals that reached the baseline standard of 300 seconds (sec) were included in the TBI and gene therapy experiments. After TBI, the animals were divided into three groups: the group immediately injected with PBS through the tail vein (PBS group, n=7), the group injected with AAV.CAP-B10-NG empty viral vector (empty viral vector group, n=8), and the group injected with AAV.CAP-B10-Ngf-NG viral vector carrying the Ngf gene (Ngf gene therapy group, n=8). On the 1st, 3rd, 5th, 7th and 14th days after TBI and PBS / vector injection, the changes in the animals' cortical motor coordination function were detected by Rotarod, and the results showed that the cortical motor coordination function of the animals in the Ngf gene therapy group was gradually improved (A). On the 14th day, compared with the PBS group and the empty vector group, the cortical motor coordination function of the impaired animals in the Ngf gene therapy group was significantly enhanced (A, *p<0.01 and **p<0.05, One-way ANOVA, respectively). This shows that Ngf gene therapy can significantly improve the impaired cortical motor function of mice after TBI. In addition, at 4 weeks after TBI and PBS / vector injection, the results of the impaired hippocampal memory function of mice detected by the Barnes Maze method showed that the hippocampal memory function of animals in the Ngf gene therapy group was significantly enhanced compared with the empty vector group (B, *p<0.05, One-way ANOVA). This shows that Ngf gene therapy can also significantly improve the impaired hippocampal spatial memory function of mice after TBI.

[0086] Example 7: Cytotoxicity Experiment

[0087] After the neuron-like PC12 cells were inoculated into the culture plates in 96-well culture plates (Thermo's F12K medium, 5% CO2, 37°C), the cells were divided into three groups: a control group without AAV transduction (Control, n=4), a group transduced with an AAV.CAP-B10-NG empty virus vector (B10 group, n=4), and a group transduced with an AAV.CAP-B10-Ngf-NG virus vector carrying the Ngf gene (B10-Ngf group, n=4). On the 5th day after the AAV-CAP-B10-Ngf-NG virus vector was diluted 100 times and added to the cells, the CCK8 kit (Yisheng Company, No. 40203ES) was used to detect the effect of the expression of the fusion gene on cell proliferation and cytotoxicity according to the instructions ( Figure 6 ). The results showed that compared with the Control group, the B10 group and the B10-Ngf group did not affect the survival of cells; in addition, compared with the B10 group, the B10-Ngf group did not affect the survival of cells. This indicates that the expression of the fusion gene has no obvious cytotoxicity to cells.

Claims

1. A fusion gene encoding a green fluorescently labeled nerve growth factor fusion protein having biological activity, characterized in that: Nerve Growth Factor Gene Ngf , unique 45 nucleotide sequences, Kozak sequence, green fluorescent protein gene Ng The nucleotide sequence of the fusion protein is shown in SEQ ID No.

1.

2. A green fluorescent labeled nerve growth factor fusion protein with biological activity, whose amino acid sequence is shown in SEQ ID No.

2.

3. An expression plasmid, characterized in that: It carries the fusion gene according to claim 1.

4. A viral vector, characterized in that It carries the fusion gene according to claim 1.

5. The method for constructing the expression plasmid according to claim 3, characterized in that: Contains the following steps: Step 1: Use an RNA extraction kit to extract total RNA from mouse brain, determine the RNA content and purity in the sample by Nano drop, and detect the presence and integrity of RNA by agarose gel electrophoresis; Step 2: Reverse transcribe the mRNA into cDNA by RT-PCR. Use the cDNA as a template and perform PCR with the following primers to synthesize a β- Ngf Gene: Forward primer: GCGGCCCAACGGTACCATGTCCATGTTGTTCTACACTCTGA, Reverse Primer: CCATGGTGGCGGTACCGGATCCTCCTCCTCCGGATCCTCCTCCTCCGGATCCTCCTCCTCCGCCTCTTCTTGTAGCCTTCCTG, Step 3: Use restriction endonuclease Acc65I to digest the green fluorescent protein gene Ng The expression plasmid pCAG-NG was recovered by gel recovery kit; the β- Ngf The gene was connected to pCAG-NG to construct Ngf Gene, unique 45 nucleotide sequence, Kozak sequence, green fluorescent protein gene Ng The expression plasmid of the fusion gene composed of Ngf -NG expression plasmid.

6. The method for constructing a viral vector according to claim 4, characterized in that: The expression plasmid constructed in claim 5, plasmid pHelper and pCAP-B10 were transferred into a 21x150cm 2 The 293T cells were cultured in DMEM containing 10% fetal bovine serum by volume, thereby packaging and preparing.

7. Use of the fusion protein according to claim 2, the expression plasmid according to claim 3, or the viral vector according to claim 4 in the preparation of a drug for promoting recovery of movement and hippocampal spatial memory function in mice after craniocerebral trauma.

8. Use of the fusion gene according to claim 1, the fusion protein according to claim 2, the expression plasmid according to claim 3, or the viral vector according to claim 4 in the preparation of a reagent for detecting the presence of nerve growth factor or tracing nerve growth factor.

Images