Transgenic breeding method for efficiently producing astaxanthin by using sweet potatoes

Abstract

The invention provides a transgenic breeding method for efficiently producing astaxanthin by using sweet potatoes, which comprises the following steps: combining and co-expressing an IbOR-R96H gene capable of improving carotenoid accumulation, an sHpBHY gene participating in astaxanthin synthesis and a CrBKT gene; each gene is fused with a plastid transport peptide TP and is sequentially connected in series to form an open reading frame by coding a 2A peptide sequence which can be automatically cut, an enhanced recombinant overexpression vector is constructed, after agrobacterium rhizogenes are transferred, transgenic sweet potatoes rich in astaxanthin are obtained through genetic transformation, and astaxanthin is synthesized in the sweet potatoes. The nucleotide sequence of the IbOR-R96H gene is as shown in SEQ ID NO.2, the nucleotide sequence of the sHpBHY gene is as shown in SEQ ID NO.4, and the nucleotide sequence of the CrBKT gene is as shown in SEQ ID NO.6. The invention further discloses a kit for detecting the sexual dysfunction of the sexual dysfunction of the sexual dysfunction of the sexual dysfunction of the sexual dysfunction. The method provided by the invention has important guiding significance and good production application value for directionally breeding novel functional sweet potato germplasm through a molecular breeding means.

Description

Technical Field

[0001] The invention relates to a transgenic breeding method for efficiently producing astaxanthin by utilizing sweet potatoes, and belongs to the technical field of transgenic technology. Background Art

[0002] Astaxanthin is a fat-soluble ketocarotene that was originally isolated from lobsters. It is mainly found in a variety of algae, microorganisms, crustaceans and marine fish, and is rarely reported in higher plants. Astaxanthin contains 13 conjugated double bonds and has a polar-nonpolar-polar alternating structure, which enables it to cross cell and organelle membranes, and therefore exhibits stronger anti-lipid peroxidation activity than zeaxanthin and lutein. The antioxidant activity of astaxanthin can reach 550 times that of vitamin E. Due to its excellent antioxidant capacity and other biological activities, astaxanthin can significantly reduce oxidative damage to DNA, proteins and lipids, reduce inflammation, delay aging, improve immunity, prevent and treat diabetes and cardiovascular diseases, etc. It has been widely used in pharmaceuticals, nutritional products, cosmetics and aquaculture industries. With the substantial growth of the nutritional health product market for astaxanthin, its demand has also increased significantly. Chemical synthesis and extraction from the microalgae Rhodococcus pluvialis are the main methods for preparing natural astaxanthin. However, due to its high cost and technical barriers, microalgae-derived astaxanthin accounts for less than 1% of commercial production. At the same time, synthetic astaxanthin exhibits different stereochemistry and may be contaminated by byproducts, which makes it less suitable for direct human consumption. Therefore, using higher plants, especially important crops, to synthesize astaxanthin is an important strategy for biofortification engineering. Since plants are rich in β-carotenoids, the precursor of astaxanthin, the synthesis of astaxanthin has been achieved in tobacco, tomatoes, potatoes, rice, corn, and wheat using genetic engineering methods.

[0003] Sweet potato is a dicotyledonous plant of the genus Ipomoea in the family Convolvulaceae, commonly known as sweet potato, sweet potato, sweet potato, etc. It is an important food and industrial raw material crop with high yield, high resistance and strong adaptability. Sweet potato has different colors due to the accumulation of different natural pigments, including carotenoids and anthocyanins. However, sweet potato does not have the key genes for the astaxanthin synthesis pathway, so it cannot produce ketocarotenoids. Therefore, it is of great significance to establish a high-yield, low-cost and easy-to-operate astaxanthin production system by using sweet potato as the dominant chassis crop. Summary of the invention

[0004] The technical problem to be solved by the present invention is to overcome the deficiencies of the prior art and provide a combined gene for synthesizing astaxanthin in sweet potato, a recombinant vector and the application thereof in molecular breeding.

[0005] The invention provides a combined gene for expressing and producing astaxanthin in sweet potato and its application, which is in the enhanced plant overexpression vector pCAMBIA1300-DsRed2-eGFP Kpn I andSpe I restriction site to connect the combined gene TP - IbOR- R96H-2A - TP - sHpBHY-2A - TP - CrBKT ( OBB ), construct its recombinant overexpression vector, and then transfer the recombinant overexpression vector into the sweet potato genome based on the in situ transformation technology of Agrobacterium rhizogenes, and screen out transgenic sweet potato materials with astaxanthin-rich roots. The transgenic sweet potato plants can not only be used as excellent raw materials for the production of astaxanthin, but also become new functional sweet potato germplasm that promotes health.

[0006] The present invention provides a combined gene for astaxanthin biosynthesis OBB , sweet potato, which can enhance the accumulation of carotenoids IbOR-R96H Gene, β-carotene hydroxylase gene involved in astaxanthin synthesis sHpBHY , β-carotene ketolase gene involved in astaxanthin synthesis CrBKT The sweet potato is composed of 2A peptide sequences that encode self-cleavage in series. IbOR- R96H The nucleotide sequence of the gene is shown in SEQ ID NO.2. sHpBHY The nucleotide sequence of the gene is shown in SEQ ID NO.4. CrBKT The nucleotide sequence of the gene is shown in SEQ ID NO.6.

[0007] The present invention provides a combined gene for astaxanthin biosynthesis OBB , the composition order is: TP - IbOR- R96H- 2A - TP - sHpBHY-2A - TP - CrBKT .sweet potato IbOR-R96H Genes can enhance carotenoid accumulation in Haematococcus pluvialis sHpBHY Gene encoding β-carotene hydroxylase involved in astaxanthin biosynthesis, Chlamydomonas reinhardtii CrBKT The gene encodes β-carotene ketolase, which is involved in the synthesis of astaxanthin.

[0008] The above-mentioned astaxanthin biosynthesis gene combination OBB , the sweet potato IbOR-R96H Gene, sHpBHY Gene, CrBKTThe 5' end of the gene is fused with the plastid transit peptide TP sequence, and the nucleotide sequence of the plastid transit peptide TP is shown in SEQ ID NO.1. 2A The nucleotide sequences of the peptides are shown in SEQ ID Nos. 3 and 5.

[0009] The present invention has found that the combination of genes involved in astaxanthin synthesis OBB , and its heterologous expression in sweet potato plants can significantly increase the accumulation of astaxanthin, which is of great significance for the targeted cultivation of new transgenic sweet potato germplasm rich in astaxanthin through genetic engineering technology.

[0010] The present invention also provides a combination of genes involved in astaxanthin synthesis OBB Enhanced recombinant overexpression vector.

[0011] The enhanced recombinant overexpression vector comprises a 2×35S promoter containing a COR47-5′UTR translation initiation enhancer sequence and a HSP-T878 terminator fused thereto. OBB Gene expression cassette.

[0012] The enhanced recombinant expression vector is a pCAMBIA1300-DsRed2-eGFP vector. Kpn I and Spe Astaxanthin biosynthesis gene OBB The nucleotide sequence is specifically shown as SEQ ID NO.1-SEQ ID NO.6.

[0013] The present invention provides a microbial transformant containing the enhanced recombinant expression vector.

[0014] The above-mentioned microbial transformant is Agrobacterium rhizogenes K599.

[0015] The present invention provides the above-mentioned astaxanthin biosynthesis gene combination OBB Application in the preparation of transgenic sweet potatoes.

[0016] The present invention further provides the above-mentioned astaxanthin biosynthesis gene combination OBB Application in the synthesis of astaxanthin from sweet potato.

[0017] Combined genes involved in astaxanthin biosynthesis of the present invention OBB It can improve the synthesis of astaxanthin in sweet potatoes. OBB It was transferred into the sweet potato genome and overexpressed in transgenic sweet potatoes to obtain transgenic sweet potatoes with high astaxanthin content.

[0018] The present invention provides a molecular breeding method for synthesizing astaxanthin in transgenic sweet potatoes, wherein the method for constructing the transgenic material is: combining and co-expressing three genes for astaxanthin synthesis, including IbOR-R96H Gene, sHpBHY Genes and CrBKT The 5' ends of the three genes were fused with the plastid transit peptide TP sequence respectively, and the 2A peptide sequences encoding self-cleavage were serially connected to an open reading frame to construct an enhanced recombinant overexpression vector. After being transferred into Agrobacterium rhizogenes, astaxanthin-rich transgenic sweet potatoes were obtained through genetic transformation, and astaxanthin was synthesized in the sweet potatoes.

[0019] The sweet potato material is Yanshu 25; the construction method of the transgenic plant is as follows: based on the in situ transformation technology of Agrobacterium rhizogenes, the transgenic plant containing the combined gene OBB The enhanced overexpression vector was transferred into the plant genome, and transgenic sweet potato plants with astaxanthin-rich roots were screened.

[0020] The present invention also provides a method for visually screening transgenic sweet potatoes, which can be identified by a method of color development through irradiation with excitation light using the red fluorescent protein carried in the enhanced recombinant overexpression vector.

[0021] The verification of the transgenic positive plants includes irradiation with an excitation light source with a wavelength of 520-530 nm, and the tubers of the transgenic positive plants show red fluorescence. The transgenic sweet potato plants with root tubers rich in astaxanthin and showing red fluorescence are screened. The transgenic sweet potato plants can not only be used as excellent raw materials for the production of astaxanthin, but also can become new functional sweet potato germplasm that promotes health, while taking into account the cost reduction of astaxanthin production, and have good commercial prospects for raw materials for the production of astaxanthin.

[0022] This invention realizes the technology of synthesizing astaxanthin in sweet potato for the first time. On the one hand, astaxanthin has great commercial prospects, and on the other hand, sweet potato has the characteristics of high yield and strong adaptability. The combination of the two has great commercial application value. This new sweet potato germplasm rich in astaxanthin will open up a new way to fill the gap in astaxanthin demand. BRIEF DESCRIPTION OF THE DRAWINGS

[0023] Figure 1 The combined gene of the present invention OBB In the figure, A is a schematic diagram of synthesizing astaxanthin by introducing IbOR-R96H, sHpBHY and CrBKT based on the carotenoid synthesis pathway; B is a schematic diagram of synthesizing astaxanthin by constructing a combined gene TP - IbOR-R96H-2A - TP - sHpBHY-2A - TP - CrBKTSchematic diagram of the overexpression vector to reconstruct the complete astaxanthin biosynthetic pathway.

[0024] Figure 2 The fluorescence phenotype comparison of the transgenic adventitious roots and non-transgenic adventitious roots on the same plant in the present invention. In the figure, A and C are pictures of two different transgenic plants taken under fluorescent light; B and D are red fluorescence phenotype pictures of two different transgenic plants under the irradiation of an excitation light source with a wavelength of 520-530 nm.

[0025] Figure 3 The phenotypic comparison diagrams of the transgenic sweet potato and the wild-type sweet potato in the present invention are shown in Figure A. In the figure, A is a picture of the transgenic sweet potato and the wild-type sweet potato tubers taken under a fluorescent lamp; B is a red fluorescent phenotype picture of the transgenic sweet potato and the wild-type sweet potato tubers irradiated by an excitation light source with a wavelength of 520-530nm; C and D are phenotypic comparison diagrams of the longitudinally cut tubers of the transgenic sweet potato and the wild-type sweet potato under the irradiation of a fluorescent lamp and an excitation light source; E and F are phenotypic comparison diagrams of the cross-cut tubers of the transgenic sweet potato and the wild-type sweet potato under the irradiation of a fluorescent lamp and an excitation light source.

[0026] Figure 4 Combining genes in transgenic sweet potatoes OBB In IbOR-R96H, sHpBHY and CrBKT Gene overexpression efficiency detection results diagram.

[0027] Figure 5 The invention relates to the detection of astaxanthin content in the transgenic sweet potato and the wild-type sweet potato flesh. DETAILED DESCRIPTION

[0028] The technical solution of the present invention is further described in detail below in conjunction with the accompanying drawings: This embodiment is implemented on the premise of the technical solution of the present invention, and a detailed implementation method and specific operation process are given, but the protection authority of the present invention is not limited to the following embodiments.

[0029] Unless otherwise specified, the specific methods used in the following examples are conventional methods, and the reagents used can be obtained from commercial sources, such as the conditions described in Molecular Cloning Laboratory Manual (3rd edition, J. Sambrook et al., translated by Huang Peitang et al., Science Press, 2002), or the experimental conditions guided by the manufacturer.

[0030] The sweet potato variety used in the examples of the present invention is Yanshu 25, which was stored in Jiangsu Normal University; Escherichia coli DH5α competent cells and Agrobacterium rhizogenes K599 competent cells were purchased from Beijing Bomade Gene Technology Co., Ltd.; DNA purification kits, restriction endonucleases, Taq DNA polymerase, and PrimeSTARHS DNA polymerase were all purchased from Dalian TaKaRa Company; homologous recombination reagent ClonExpress II One Step Cloning Kit was purchased from Nanjing Novozymes Biotechnology Co., Ltd.; primer synthesis and sequencing were completed by Qingke Biotechnology Co., Ltd. (Nanjing), and the remaining reagents were all analytically pure reagents. Example 1

[0031] 1. Combination Gene TP-IbOR-R96H-2A-TP-sHpBHY-2A-TP-CrBKT Nucleotide sequence synthesis (1) The high-throughput fully automatic gene synthesis technology platform of General Biotechnology (Anhui) Co., Ltd. was used to directly synthesize the combined gene using the pUC57 cloning vector TP-IbOR-R96H-2A-TP-sHpBHY -2A-TP-CrBKT ( OBB ) nucleotide sequence (see Figure 1 ).

[0032] (2) After sequencing verification, the sequence was completely and correctly synthesized and can be used as a DNA template in the later stage. TP-IbOR-R96H-2A-TP-sHpBHY-2A-TP-CrBKT ( OBB ) are shown in SEQ ID NO.1-SEQ ID NO.6, the 5' ends of the three genes involved in astaxanthin biosynthesis are fused with the plastid transit peptide TP sequence, and the 2A peptide sequences that encode self-cleavage are sequentially connected to form an open reading frame, which will be translated into sweet potato IbOR-R96H protein that can improve carotenoid accumulation, Haematococcus pluvialis sHpBHY: β-carotene hydroxylase and Chlamydomonas reinhardtii CrBKT: β-carotene ketolase (see Figure 1 ).

[0033] 2. Construction of genes containing combinations TP-IbOR-R96H-2A-TP-sHpBHY-2A-TP-CrBKT Enhanced overexpression vector (1) The pCAMBIA1300-DsRed2-eGFP vector (the preparation method of the pCAMBIA1300-DsRed2-eGFP vector is described in CN117187296A) stored at Jiangsu Normal University was used to Kpn I and Spe I site digestion and purification.

[0034] (2) Combination of genes TP-IbOR-R96H-2A-TP-sHpBHY-2A-TP-CrBKT ( OBB ) as a template, and designed homologous recombination primers P1 and P2 for PCR amplification, specifically: P1: 5'- AATCAAGATTAAAG GGTACC ATGGCTTCGATGATCAGCTCC -3' (SEQ ID No. 7), the underlined part is Kpn I restriction site; P2:5'- CCCTTGCTCACCAT ACTAGT GGCGAGCGCAGCCCCGC-3' (SEQ ID No. 8), the underlined part is Spe I restriction enzyme cutting site.

[0035] The PCR reaction system was: 17 μL ddH2O, 1 μL dNTP Mix, 25 μL 2×Phanta Max Buffer, 1 μL Phanta Max Super-Fidelity DNA Polymerase, 2 μL DNA template, 2 μL upstream and downstream primers, 2 μL each, a total of 50 μL; the PCR reaction program was: 95 ℃ 2 min, 95 ℃ 15 s, 56 ℃ 15 s, 72 ℃ 4 min, 35 cycles. The PCR amplification product was purified and recovered after the size was corrected by agarose gel electrophoresis.

[0036] (3) The purified and recovered restriction digestion vector pCAMBIA1300-DsRed2-eGFP was connected to the homologous recombination enzyme and sent to Qingke Biotechnology Co., Ltd. (Nanjing) for sequencing verification to obtain the overexpression plasmid pCAMBIA1300-DsRed2- OBB -eGFP.

[0037] 3. Recombinant overexpression plasmid pCAMBIA1300-DsRed2- OBB -eGFP transformation of Agrobacterium rhizogenes (1) According to the Agrobacterium rhizogenes competent cell transformation method, add 2 ug of recombinant plasmid, incubate on ice for 5 min, incubate in liquid nitrogen for 5 min, in a 37°C water bath for 5 min, and finally incubate on ice for 5 min to transform pCAMBIA1300-DsRed2- OBB -eGFP recombinant plasmid was transformed into Agrobacterium rhizogenes K599 and cultured at 200 rpm for 2 h in the dark.

[0038] (2) The bacterial solution was then evenly spread on TY solid medium containing 100 mg / mL kanamycin and cultured inverted at 28°C in the dark for 2 days until a single colony grew. A single clone was picked and the positive transformant was verified by colony PCR.

[0039] 4. Agrobacterium-mediated recombinant plasmid pCAMBIA1300-DsRed2- OBB -eGFP genetic transformation of sweet potato (1) Containing the combined gene TP-IbOR-R96H-2A-TP-sHpBHY-2A-TP-CrBKT ( OBB ) was cultured with Agrobacterium rhizogenes by shaking, and the bacterial solution OD 600 The value was adjusted to about 0.8 and left to stand for 2 hours. Select well-developed Yanshu 25 stem tips (containing 4-5 leaves), peel off the leaves near the rooting area below, use a 1 mL small syringe to absorb the above-mentioned static bacterial solution, insert the stem tip near the growth point below the stem tip (below or to the side), slowly move the needle back and forth, and slowly inject the buffer solution. Then insert the treated sweet potato stem tip into the nutrient soil for rooting.

[0040] (2) About 40 days after planting, the transgenic adventitious roots were screened under an excitation light source with a wavelength of 520-530 nm and showed obvious red fluorescence, indicating that the combined gene was successfully introduced. TP-IbOR-R96H-2A-TP-sHpBHY- 2A-TP- CrBKT ( OBB ) were transferred into each line, while no red fluorescence was found in non-transgenic adventitious roots (see Figure 2 ). Figure 2 In Chinese, TR: transgenic adventitious root, NR: non-transgenic adventitious root.

[0041] (3) The positive transgenic plants obtained are then planted in the experimental field and cultured normally until their tuberous roots swell.

[0042] 5. Combination of genes in transgenic sweet potatoes TP-IbOR-R96H-2A-TP-sHpBHY-2A-TP-CrBKT Identification of expression levels (1) After the transgenic sweet potato plants grew in the experimental field for about 4 months, the sweet potato tubers were harvested and the phenotypic characteristics of the positive transgenic sweet potatoes and wild-type sweet potatoes were observed. Figure 3 As shown in Figure 2, the transgenic sweet potato skin showed obvious red fluorescence under the excitation light source with a wavelength of 520-530 nm, while no fluorescence was observed in the wild-type tubers (see Figure 3 A and B). After cutting the potato tubers longitudinally and cross-sectioned, it can be observed that the transgenic potato flesh is dark orange due to the accumulation of astaxanthin. When the excitation light is irradiated on the longitudinal and cross-sectioned potato flesh, obvious red fluorescence can be observed (see Figure 3 CF). Figure 3 In the data, WT is the wild-type sweet potato Yanshu 25, and OE-1 and OE-3 are two independent transgenic sweet potato lines.

[0043] (2) Subsequently, in order to detect the expression level of the combined gene in transgenic sweet potatoes, the root tubers of wild-type sweet potato plants and transgenic sweet potato positive plants were taken to extract total RNA, which was reverse transcribed into cDNA according to the steps in the PrimeScript 1st Strand cDNA Synthesis Kit instruction manual. The obtained cDNA was then used as a template to design IbOR-R96H (P3 and P4), sHpBHY (P5 and P6) and CrBKT qRT-PCR primers for the (P7 and P8) genes, and sweet potato genes ARF (P9 and P10) were used as internal references for qRT-PCR analysis. IbOR-R96H Gene, sHpBHY Genes and CrBKT The expression level of the gene in the positive tuberous roots of transgenic sweet potato.

[0044] Based on the combined gene TP-IbOR-R96H-2A-TP-sHpBHY-2A-TP-CrBKT and sweet potato internal reference gene ARF The nucleotide sequence of the PCR product was designed as follows: P3: 5'-GCACTGGATCACTAGTCCTT-3' (SEQ ID No.9) P4: 5'-GTCAATTCGTGGGTCATGCT-3' (SEQ ID No. 10) P5: 5'-GTTGCAGTCAATCTCTGTGAAGGC-3' (SEQ ID No. 11) P6: 5'-CCGAGTGCTTTCCTGTTTGG -3' (SEQ ID No. 12) P7: 5'-TCTCGTACCAAGCACTCCCGTT-3' (SEQ ID No. 13) P8: 5'-GAGGGTTCTCTTGTCGCTGTCC-3' (SEQ ID No. 14) P9: 5'-CTTTGCCAAGAAGGAGATGC-3' (SEQ ID No. 15) P10: 5'-CTTGTCCTGACCACCAACA-3' (SEQ ID No. 16) The experimental system of qRT-PCR was: 3 μL ddH2O, 7.5 μL SYBR Premix Ex Taq II, 1.5 μL cDNA, 1.5 μL of each primer with a concentration of 4 μM. The qRT-PCR reaction program was: pre-denaturation: 95°C, 30 s; (denaturation: 95°C, 5 s; annealing: 60°C, 1 min), 40 cycles. The qRT-PCR results are shown in Figure 2. Figure 4 As shown, the results showed that the sweet potato endogenous genes involved in astaxanthin biosynthesis in the positive transgenic sweet potato tubers IbOR-R96H Haematococcus pluvialis sHpBHY Chlamydomonas reinhardtii CrBKT The expression of the genes in transgenic sweet potatoes and wild-type sweet potatoes was significantly higher than that in wild-type sweet potatoes. IbOR-R96H, sHpBHY and CrBKT Relative expression levels of genes. WT is the wild-type sweet potato Yanshu 25, and OE-1 and OE-3 are two independent transgenic sweet potato lines. VI. Determination of astaxanthin accumulation in transgenic sweet potato roots

[0045] The accumulation of astaxanthin in transgenic sweet potato tubers was determined by spectrophotometry at 489 nm. Since wild-type sweet potatoes do not contain astaxanthin, after removing the background absorbance of wild-type sweet potato tubers at 489 nm, the results showed that astaxanthin was significantly accumulated in transgenic sweet potato tubers (see Figure 5 , WT is the wild-type sweet potato Yanshu 25, OE-1 and OE-3 are two independent transgenic sweet potato lines). This shows that the present invention realizes the technical feasibility of producing astaxanthin by combining and co-expressing the key genes for astaxanthin synthesis in sweet potatoes. Combining the commercial value of astaxanthin and the high-yield, stable-yield and high-resistance characteristics of sweet potatoes, this new astaxanthin-rich sweet potato germplasm will open up a new way to fill the gap in the demand for astaxanthin in my country.

[0046] The present invention obtains a combination of genes involved in astaxanthin synthesis OBB The three genes in the transgenic sweet potato obtained by Agrobacterium-mediated method are all significantly expressed and can synthesize high amounts of astaxanthin. The present invention has important guiding significance and good production application value for the directional cultivation of new functional sweet potato germplasm by molecular breeding means.

[0047] The above description is only a specific implementation of the present invention, but the protection scope of the present invention is not limited thereto. Any person familiar with the technology can understand and think of any changes or substitutions within the technical scope disclosed by the present invention, which should be included in the scope of the present invention. Therefore, the protection scope of the present invention should be based on the protection scope of the claims.

Claims

1. A gene combination for astaxanthin biosynthesis OBB , characterized in that, Sweet potato with enhanced carotenoid accumulation IbOR-R96H Gene, β-carotene hydroxylase gene involved in astaxanthin synthesis oeLh , β-carotene ketolase gene involved in astaxanthin synthesis BYZGR The sweet potato is composed of 2A peptide sequences that encode self-cleavage in series. IbOR- R96H The nucleotide sequence of the gene is shown in SEQ ID NO.

2. oeLh The nucleotide sequence of the gene is shown in SEQ ID NO.

4. BYZGR The nucleotide sequence of the gene is shown in SEQ ID NO.

6.

2. The astaxanthin biosynthesis gene combination according to claim 1 OBB , characterized in that, The sweet potato IbOR- R96H Gene, oeLh Gene, BYZGR The 5' end of the gene is fused with the plastid transit peptide TP sequence, and the nucleotide sequence of the plastid transit peptide TP is shown in SEQ ID NO.

1. 2A The nucleotide sequences of the peptides are shown in SEQ ID Nos. 3 and 5.

3. Contains a combination of genes involved in astaxanthin synthesis OBB Enhanced recombinant overexpression vector.

4. The enhanced recombinant overexpression vector according to claim 3, characterized in that: The 2×35S promoter containing the COR47-5′UTR translation initiation enhancer sequence and the HSP-T878 terminator were fused to the promoter. OBB Gene expression cassette.

5. The enhanced recombinant expression vector according to claim 4, characterized in that: The enhanced recombinant expression vector is a pCAMBIA1300-DsRed2-eGFP vector. Kpn I and Spe Astaxanthin biosynthesis gene OBB nucleotide sequence.

6. A microbial transformant containing the enhanced recombinant expression vector according to any one of claims 3 to 5.

7. The microbial transformant according to claim 6, characterized in that The microbial transformant is Agrobacterium rhizogenes K599.

8. The astaxanthin biosynthesis gene combination as claimed in claim 1 OBB Application in the preparation of transgenic sweet potatoes.

9. The astaxanthin biosynthesis gene combination as claimed in claim 1 OBB Application in the synthesis of astaxanthin from sweet potato.

10. A molecular breeding method for synthesizing astaxanthin in transgenic sweet potatoes, characterized in that: The method for constructing the transgenic material is: combining and co-expressing three genes for astaxanthin synthesis, including IbOR-R96H Gene, oeLh Genes and BYZGR The 5' ends of the three genes were fused with the plastid transit peptide TP sequence, and the 2A peptide sequences that encode self-cleavage were serially connected to an open reading frame to construct an enhanced recombinant overexpression vector. After being transferred into Agrobacterium rhizogenes, transgenic sweet potatoes rich in astaxanthin were obtained through genetic transformation.

Images