Phage genome editing vector based on CRISPR-Cas9 system and its editing method and application
Through the CRISPR-Cas9 system and the CRISPR-Cas dual-plasmid system, the problems of time-consuming, labor-intensive and inefficient phage genome editing have been solved, and efficient editing of the Staphylococcus aureus phage genome has been achieved, with the ability to delete, insert and perform site-directed mutations of gene fragments.
Patent Information
- Application Number
- CN202411703022.4
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-11-26
- Publication Date
- 2025-10-03
- Estimated Expiration
- 2044-11-26
AI Technical Summary
Existing phage genome editing methods are time-consuming and labor-intensive, have low editing efficiency, and are unstable when applied to Staphylococcus aureus phage, limiting the study of genome structure and function.
A phage genome editing vector based on the CRISPR-Cas9 system is used, combined with a CRISPR-Cas dual-plasmid system of pTarget plasmid and pEdit plasmid, to achieve efficient editing of the phage genome through homologous recombination and reverse screening methods.
It achieves efficient and stable editing of phage genomes, capable of gene fragment deletion, insertion and site-directed mutagenesis, with an editing efficiency of up to 100% and a short operation time of only 3 days.
Smart Images

Figure CN119464347B_ABST
Abstract
Description
Technical Field
[0001] The present invention belongs to the field of gene editing technology, and specifically relates to a phage genome editing vector based on the CRISPR-Cas9 system, and its editing method and application. Background Art
[0002] Staphylococcus aureus is a common Gram-positive bacterium that is widely present in nature. As an important clinical pathogen and foodborne pathogen, Staphylococcus aureus can cause serious infections in humans and animals, including skin and soft tissue infections, pneumonia, sepsis, and arthritis. At present, infections caused by Staphylococcus aureus are mainly treated clinically with antibiotics, and some countries and regions have also begun to try phage therapy. However, the wild-type phages currently isolated from nature still have some limitations in clinical treatment, and because the functions of most open reading frames of phages are unknown, their functional genomics research has lagged behind. Therefore, there is an urgent need to develop a gene editing method for Staphylococcus aureus phages.
[0003] Currently, methods for phage genome editing primarily include random mutagenesis, classical homologous recombination systems, and phage recombination strategies using electroporated DNA. However, these traditional methods are not only time-consuming and labor-intensive, but also suffer from low editing efficiency, significantly limiting in-depth research into the structure and function of phage genomes. In recent years, with the discovery of various types of CRISPR-Cas systems, they have been transformed into highly efficient gene editing tools and widely used in a variety of organisms, including animals, plants, and bacteria. However, their application in phage genome editing remains exploratory.
[0004] The CRISPR-Cas system is an adaptive immune defense system used by bacteria and archaea to protect themselves from invading foreign phages or plasmids. Based on the type of Cas protein, CRISPR-Cas systems can be divided into two major categories, seven types, and 54 subtypes. Type II CRISPR-Cas systems, whose effector protein is Cas9, have been widely used in gene editing due to their relatively simple structure. Currently, the most widely used Cas9 protein is SpCas9, derived from Streptococcus thermophilus. However, its large molecular weight poses a significant challenge to gene editing efficiency. Type II CRISPR-Cas systems utilize base pairing between tracrRNA and pre-crRNA to promote degradation of these two RNAs by host RNase III, followed by further processing to form mature crRNA. The crRNA and Cas9 nuclease complex recognizes the PAM and, after base pairing with the protospacer sequence, cleaves the foreign gene. Combining the CRISPR-Cas system with homologous recombination can effectively leverage the capabilities of phage genome editing.
[0005] To date, the CRISPR-Cas system has been extensively used to edit the genomes of other bacterial phages, such as Salmonella and Pseudomonas aeruginosa. However, no widely applicable editing methods have been reported for the Staphylococcus aureus phage genome. Furthermore, studies have reported that editing of phage genomes in phages with larger genomes is often unstable. Therefore, modifying the CRISPR-Cas9 system to enable its widespread application in editing the S. aureus phage genome will provide new strategies for subsequent studies of gene biological function and the modification of engineered phages. Summary of the Invention
[0006] Purpose of the invention: The technical problem to be solved by the present invention is to provide a phage genome editing vector based on the CRISPR-Cas9 system.
[0007] The technical problem that the present invention also aims to solve is to provide a pTarget plasmid.
[0008] The technical problem that the present invention also solves is to provide a CRISPR-Cas dual-plasmid system.
[0009] The technical problem that the present invention also aims to solve is to provide an engineered bacterium for a phage genome editing vector.
[0010] The technical problem that the present invention also aims to solve is to provide a method for constructing the phage genome editing vector.
[0011] The final technical problem to be solved by the present invention is to provide a phage genome editing method based on the CRISPR-Cas9 system.
[0012] Technical solution: In order to solve the above technical problems, the first aspect of the present invention provides a phage genome editing vector based on the CRISPR-Cas9 system, wherein the phage genome editing vector includes a resistance screening marker, a promoter P rpsL , Cas9 nuclease gene, endogenous U6 promoter, sgRNA sequence, endogenous U6 terminator and replicon, wherein the Cas9 nuclease gene is selected from Staphylococcus epidermidis ( S. epidermidis ) of the SeCas9 nuclease gene.
[0013] Wherein, the sequence of the phage genome editing vector is shown as SEQ ID No.1.
[0014] The second aspect of the present invention further provides a pTarget plasmid, which is obtained by connecting the spacer fragment of the target gene with the phage genome editing vector, and the spacer fragment of the target gene is designed and amplified according to the PAM site requirements.
[0015] The third aspect of the present invention also provides a CRISPR-Cas dual-plasmid system, which includes the pTarget plasmid and the pEdit plasmid. The pEdit plasmid is obtained by introducing the upstream homology arm fragment and the downstream homology arm fragment of the target gene in the phage genome into the plasmid, and the upstream homology arm fragment and the downstream homology arm fragment of the target gene are obtained by designing primers and amplifying them by PCR.
[0016] The fourth aspect of the present invention further provides an engineered bacterium, which contains the phage genome editing vector based on the CRISPR-Cas9 system, the pTarget plasmid or the CRISPR-Cas dual-plasmid system.
[0017] The fifth aspect of the present invention further provides a method for constructing the gene editing vector, comprising the following steps:
[0018] 1) The promoter P rpsL 、 Secas9 , the endogenous U6 promoter, and the sgRNA gene sequence were connected and introduced into the pUC57 plasmid to obtain the SeCas9-pUC57 plasmid. The gene fragments of the SeCas9 editing system components were amplified by PCR using the SeCas9-pUC57 plasmid as a template;
[0019] 2) Connect the gene fragments of the SeCas9 editing system components to the linear vector to obtain a phage genome editing vector based on the CRISPR-Cas9 system.
[0020] Preferably, the linear vector includes but is not limited to the linear vector obtained by double digestion of pRAB11, and the endonucleases include but are not limited to BamH I and Kpn I.
[0021] The sixth aspect of the present invention further provides a method for constructing the pTarget plasmid, comprising the following steps:
[0022] 1) Constructing the phage genome editing vector based on the CRISPR-Cas9 system;
[0023] 2) Based on the PAM site requirements of the SeCas9 nuclease, determine the editing site on the target gene, design the targeting sequence, and construct it into the phage genome editing plasmid of the CRISPR-Cas9 system obtained in step 1) to obtain the pTarget plasmid.
[0024] A seventh aspect of the present invention further provides a phage genome editing method based on the CRISPR-Cas9 system, comprising the following steps:
[0025] 1) Constructing the phage genome editing vector based on the CRISPR-Cas9 system;
[0026] 2) Based on the PAM site requirements of the SeCas9 nuclease, determine the editing site on the target gene, design a targeting sequence, and construct it into the phage genome editing plasmid of the CRISPR-Cas9 system obtained in step 1) to obtain the pTarget plasmid. Subsequently, it is electroporated into Staphylococcus aureus competent cells to obtain the targeted strain;
[0027] 3) 200 bp DNA sequences upstream and downstream of the editing site were constructed into a vector to obtain the pEdit plasmid, which was then electroporated into Staphylococcus aureus competent cells to obtain the editing strain;
[0028] 4) Infecting the edited strain obtained in step 3) with a phage to induce homologous recombination in the phage, then harvesting the phage and further re-infecting the targeted strain in step 2) with the phage to obtain phage mutants through reverse screening, thereby achieving gene segment deletion, insertion, or site-directed mutagenesis editing of the phage genome.
[0029] Among them, the PAM site selection requirement in step 2) is 5'-NNGRRT-3', and the target gene includes gp036 Gene or gp170 Gene.
[0030] Wherein, the bacteriophage in step 4) includes but is not limited to Staphylococcus aureus philPLA-RODI phage.
[0031] The philPLA-RODI phage used in this invention has a relatively large genome, measuring 142,348 bp, which makes it difficult to establish the editing method of the present invention. This invention achieves editing of phages with relatively large genomes by modifying the CRISPR-Cas9 system and establishing a dual-plasmid system.
[0032] Beneficial effects: Compared with the prior art, the present invention has the following advantages: the phage genome CRISPR-Cas dual-plasmid editing system provided by the present invention, wherein the Cas protein is selected from Staphylococcus epidermidis, has a small molecular weight, a simple structure, and is convenient for gene editing. The present invention can achieve gene fragment deletion, insertion, and site-directed mutation editing of the phage genome through a method of homologous recombination combined with reverse screening. The gene editing method has stable performance, high efficiency, convenience, and powerful functions. The gene editing method of the present invention has a high editing efficiency, which can reach up to 100%, and the editing method of the present invention is short in time, and the required edited phage can be harvested in as little as 3 days. BRIEF DESCRIPTION OF THE DRAWINGS
[0033] Figure 1 This is a schematic structural diagram of the reverse screening plasmid pTarget in the CRISPR-Cas dual-plasmid system of the present invention.
[0034] Figure 2 Schematic diagram of the structure of the template plasmid pEdit in the CRISPR-Cas dual-plasmid system of the present invention.
[0035] Figure 3 philPLA-RODI-Δ gp036 Figure 2 shows the results of plating the second-generation phage on TSB double-layer plates.
[0036] Figure 4 The CRISPR-Cas dual plasmid system of the present invention realizes genome editing in phage philPLA-RODI; gp036 Figure 1 shows the PCR validation results of gene deletion mutation.
[0037] Figure 5 This is a schematic diagram showing the CRISPR-Cas dual-plasmid system of the present invention realizing genome editing in bacteriophage philPLA-RODI; and inserting the fluorescent marker gene GFP into the bacteriophage philPLA-RODI for PCR verification.
[0038] Figure 6 The CRISPR-Cas dual-plasmid system of the present invention realizes genome editing in bacteriophage philPLA-RODI; and the PCR verification result of inserting the fluorescent marker gene GFP into bacteriophage philPLA-RODI.
[0039] Figure 7 This is a diagram showing the sequencing results of the CRISPR-Cas dual-plasmid system of the present invention achieving genome editing in bacteriophage philPLA-RODI and achieving point mutations in bacteriophage philPLA-RODI. DETAILED DESCRIPTION
[0040] The following will clearly and completely describe the technical solutions of the present invention in conjunction with the embodiments of the present invention. Obviously, the embodiments described are only some embodiments of the present invention, not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.
[0041] The materials and sources used in the specific embodiments of the present invention are as follows:
[0042] 1. Strains and plasmids
[0043] pRAB11 vector (Helle, L., Kull, M., Mayer, S., Marincola, G., Zelder, M.-E., Goerke, C., Wolz, C. and Bertram, R. (2011) Vectors for improved Tetrepressor-dependent gradual gene induction or silencing in Staphylococcusaureus. Microbiology, 157, 3314-3323.), E. coli IM08B, (Monk, IR, Tree, JJ, Howden, BP, Stinear, TP and Foster, TJ (2015) Complete Bypass ofRestriction Systems for Major Staphylococcus aureus Lineages. mBio, 6, e00308-00315.) Staphylococcus aureus RN4220, phage philPLA-RODI (3. Gutiérrez, D., Vandenheuvel, D., Martínez, B., Rodríguez, A., Lavigne, R., García, P. andWommack, KE (2015) Two phages, phiIPLA-RODI and phiIPLA-C1C, lyse mono- and dual-species staphylococcal biofilms. Appl Environ Microbiol, 81, 3336-3348.) are laboratory maintained.
[0044] 2. Main reagents
[0045] Primestar max DNA polymerase, DNA marker, and restriction enzymes BamH I and Kpn I were purchased from Bao Bioengineering (Dalian) Co., Ltd.; restriction enzymes BsaI and T4 polynucleotide kinase (PNK) were purchased from Beyotime Biotechnology Co., Ltd.; Clone express II one-step cloning kit, ClonExpress Ultra One-Step Cloning Kit, and 2× Taq Master Mix were purchased from Novozymes Biotech Co., Ltd.; T4 DNA ligase and viral genomic RNA / DNA extraction kit were purchased from Takara; kanamycin (Kan), chloramphenicol (Cm), and LB medium were purchased from Sangon Bioengineering (Shanghai) Co., Ltd.; tryptone soy agar (TSA) and tryptone soy broth (TSB) were purchased from Qingdao Haibo Biotechnology Co., Ltd.; a rapid plasmid miniprep kit and agarose gel DNA recovery kit were purchased from TIANGEN; all other reagents were domestically produced and of analytical grade.
[0046] 3. Main instruments and equipment
[0047] The PCR instrument, electrophoresis instrument, and Gel Doc XR+ gel imager were all purchased from Bio-RAD, USA; the pipette, electroporator, shock cup, high-speed desktop centrifuge, and constant temperature metal bath were all purchased from Eppendorf, Germany; the IS-RDS3 constant temperature oscillating shaker was purchased from Crystal; and the constant temperature incubator was purchased from Shanghai Yuejin Medical Equipment Factory.
[0048] Example 1 Construction of SeCas9-pRAB11 editing system plasmid
[0049] The composition of the SeCas9-pRAB11 editing system plasmid is as follows Figure 1 As shown, its sequence is SEQ ID No. 1. The specific construction method is as follows:
[0050] 1. Amplification of DNA sequences of SeCas9 editing system components
[0051] 1) Download promoter P from NCBI database rpsL 、 Secas9 , endogenous U6 promoter and sgRNA gene sequence.
[0052] P rpsL sequence:
[0053] TCAGAAAAATATACCTGTATCTTTTTTCAAAAGCAAACATGCTTTGGGTAAACATGTAGGTATTAACGTCAATGCGACAATAGTAGCATTGATTAAATGAGAATTAGTAAGTGTTTTACTTACTAAATTTTATTTAACCTAAAAATGAACCACCTGGATGTGTGGGATTAAAAAGTGAAGAGAGGAGGACATATCAC
[0054] Secas9 Sequence: SEQ ID No.5
[0055]
[0056] Endogenous U6 promoter sequence:
[0057] GAGGGCCTATTTCCCATGATTCCTTCATATTTGCATATACGATACAAGGCTGTTAGAGAGATAATTAGAATTAATTTGACTGTAAACACAAAGATATTAGTACAAAATACGTGACGTAGAAAGTAATAATTTCTTGGGTAGTTTGCAGTTTTAAAATTATGTTTTAAAATGGACTATCATATGCTTACCGTAACTTGAAAGTATTTCGATTTCTTGGCTTTATATATCTTGTGGAAAGGAC
[0058] sgRNA gene sequence:
[0059] GTTATAGTACTCTGGAAACAGAATCTACTATAACAAGGCAAAATGCCGTGTTTATCTCGTCAACTTGTTGGCGAGAT
[0060] The above sequence was sent to Sangon Biotech (Shanghai) Co., Ltd. for synthesis and named SeCas9-pUC57 plasmid. The specific plasmid sequence is shown in SEQ ID No: 3 in the sequence listing.
[0061] 2) Using the SeCas9-pUC57 plasmid as a template, the gene fragments of the SeCas9 editing system components were amplified by PCR.
[0062] The primer sequences used for PCR amplification are:
[0063] SeCas9-F:
[0064] 5'-ACTAGTTTTTTATTTGGATCCAACCTATGAATTTACTTCTAAAAAATGTTG-3'
[0065] SeCas9-R:
[0066] 5'-CTCAGATCTGTTAACGGTACCAAAAAAATCTCGCCAACAAGTTG-3'
[0067] The reaction system is shown in Table 1:
[0068] Table 1 PCR reaction system
[0069]
[0070] The reaction program was as follows: 98°C for 3 min; 35 cycles of 98°C for 15 s, 55°C for 15 s, and 72°C for 1 min; and 72°C for 10 min and 4°C.
[0071] Prepare 1% agarose gel for gel electrophoresis at 110 V for 40 min, cut the target band, and use an agarose gel DNA recovery kit to recover fragment A. The specific operation steps were carried out according to the kit instructions.
[0072] 2. Vector digestion
[0073] The pRAB11 plasmid was extracted according to the instructions of the rapid plasmid extraction kit and double-digested with BamH I and Kpn I. The enzyme digestion reaction system is shown in Table 2. 20 systems were prepared and the reaction system was placed at 37°C for enzyme digestion for 3.5 h.
[0074] Table 2 Enzyme digestion reaction system
[0075]
[0076] Prepare 1% agarose gel for gel electrophoresis at 110 V for 40 min, cut the target band, and use an agarose gel DNA recovery kit to recover the double-enzyme digestion product B. The specific operation steps were carried out according to the kit instructions.
[0077] 3. Connection conversion
[0078] The above fragments A and B were ligated using the Clone express II one step cloning kit. The in vitro ligation reaction system is shown in Table 3:
[0079] Table 3 Ligation reaction system
[0080]
[0081] The ligation reaction was incubated at 37°C for 30 minutes. The ligation product was then transformed into competent E. coli IM08B cells, plated onto LB solid medium plates containing 50 μg / mL kanamycin, and incubated in an inverted position at 37°C overnight. The next day, single colonies were picked for colony PCR verification. PCR-positive clones were selected, plasmids were extracted, and the resulting plasmids were sent to the company for sequencing. The correctly sequenced plasmids were named SeCas9-pRAB11 editing plasmids.
[0082] Example 2 Construction of pTarget Plasmid
[0083] 1. Experimental selection gp036Taking gene deletion mutation as an example, according to the PAM site requirements, the 30 bp upstream is selected as the spacer, and the spacer primer sequence is:
[0084] gp036 -SeCas9-F:5'-caccgtcaaatgttaaagttattagaagaagcag-3'
[0085] gp036 -SeCas9-R:5'-taacctgcttcttctaataactttaacatttgac-3'.
[0086] 2. The two completely complementary single-stranded oligonucleotides were phosphorylated, annealed, and ligated to obtain ligation products. The specific reaction system and reaction conditions are shown in Tables 4 and 5:
[0087] 1) Phosphorylation:
[0088] Table 4 Phosphorylation reaction system
[0089]
[0090] The above reaction system was incubated at 37°C for 1 h, and the obtained product was the phosphorylation reaction product.
[0091] 2) Annealing:
[0092] Add 2.5 μL of 1 M NaCl to the above phosphorylation reaction product. The PCR reaction program is 95℃ for 1 min, 80℃ for 3 min, 70℃ for 3 min, 60℃ for 3 min, 50℃ for 3 min, 40℃ for 3 min, 30℃ for 3 min, 25℃ for 3 min, and 4℃ for ∞. Dilute the obtained annealing product 20-fold to obtain the desired spacer fragment.
[0093] 3) Connection:
[0094] Table 5 Ligation reaction system
[0095]
[0096] The reaction program was as follows: 37°C for 2 min; 16°C for 5 min, 25 cycles; 50°C for 5 min, 80°C for 5 min, and 10°C for ∞.
[0097] 3. Transform the ligation product into competent E. coli IM08B, spread it on a LB solid medium plate containing 50 μg / mL kanamycin, and invert it to culture overnight in a 37°C incubator. The next day, pick a single colony for colony PCR verification, select PCR positive clones, extract the plasmid and send it to the company for sequencing. The plasmid with the correct sequencing result is named pTarget- gp036 plasmid.
[0098] The pTarget plasmid is a shuttle plasmid capable of replication and propagation in both Escherichia coli and Staphylococcus aureus. It confers kanamycin resistance in E. coli at a selection concentration of 50 μg / mL, while it confers chloramphenicol resistance in S. aureus at a selection concentration of 15 μg / mL. This plasmid expresses the SeCas9 nuclease in S. aureus and, when used in conjunction with the pEdit plasmid, enables genome editing of the bacteriophage philPLA-RODI to achieve gene deletions, insertions, and site-directed mutagenesis.
[0099] Example 3 pEdit plasmid construction
[0100] The composition of the pEdit plasmid is as follows Figure 2 Its sequence is SEQ ID No: 2. The specific construction method is as follows:
[0101] 1. Using the phage philPLA-RODI genome as a template, 200 bp upstream and downstream of the editing site were selected, and primers were designed to amplify the homology arm fragments up and down. gp036 For example, gene deletion mutations
[0102] gp036 -up-F:
[0103] 5'-actagttttttatttggatccaggaagttagaaatggaaaaattcca-3'
[0104] gp036 -up-R:
[0105] 5'-cttgctagttatattactattctatatctcctttaatttctgtatctttta-3'
[0106] gp036 -down-F:
[0107] 5'-gaatagtaataactagcaaggaaaactgttatattatg-3'
[0108] gp036 -down-R:
[0109] 5'-ctcagatctgttaacggtacctgttatttttaatttatctaagtaatcttctacttg-3'
[0110] The PCR reaction system and procedure are as follows:
[0111] Table 6 PCR reaction system
[0112]
[0113] The reaction program was as follows: 98°C for 3 min; 35 cycles of 98°C for 15 s, 55°C for 15 s, and 72°C for 7 s; 72°C for 10 min, and 4°C ∞.
[0114] Prepare 1% agarose gel for gel electrophoresis at 110 V for 40 min, cut the target band, and use an agarose gel DNA recovery kit to recover up and down fragments. Specific operation steps are carried out according to the kit instructions.
[0115] 2. Use the ClonExpress Ultra One-Step Cloning Kit to reconstruct the up and down fragments in vitro with the pRAB11 double-digested (BamH I and Kpn I) linear vector from Example 1 to generate the pEdit plasmid. The in vitro recombination reaction system is shown in Table 7:
[0116] Table 7 Ligation reaction system
[0117]
[0118] The ligation reaction conditions were 50°C for 15 minutes. The ligation product was then transformed into E. coli IM08B competent cells, spread on LB solid medium plates containing 50 μg / mL kanamycin, and inverted in a 37°C incubator for overnight culture. The next day, single colonies were picked for colony PCR verification. PCR-positive clones were selected, plasmids were extracted, and sent to the company for sequencing. The correctly sequenced plasmids were named pEdit- gp036 plasmid.
[0119] The pEdit plasmid is a shuttle plasmid capable of replication and propagation in both Escherichia coli and Staphylococcus aureus. It confers kanamycin resistance in E. coli at a selection concentration of 50 μg / mL, while it confers chloramphenicol resistance in S. aureus at a selection concentration of 15 μg / mL. This plasmid provides a homologous recombination template for the philPLA-RODI bacteriophage in S. aureus. When used in conjunction with the pTarget plasmid, the philPLA-RODI bacteriophage genome can be edited to achieve gene deletions, insertions, and site-directed mutagenesis.
[0120] Example 4 CRISPR-Cas dual-plasmid system achieves efficient gene deletion on phage philPLA-RODI
[0121] The CRISPR-Cas dual-plasmid system composed of pTarget and pEdit plasmids can achieve efficient deletion of different genes in the phage philPLA-RODI. gp036 For example, gene deletion was performed on phage philPLA-RODI. Figure 4 To perform the phage philPLA-RODI gp036 PCR verification results of gene deletion.
[0122] 1. The pTarget- gp036 Plasmid and pEdit- gp036 The plasmids were electroporated into Staphylococcus aureus RN4220 competent cells, and the successfully electroporated strains were named pTarget- gp036 -RN4220 and pEdit- gp036 -RN4220, the specific operation is as follows: take two RN4220 competent cells (80 μL each) and place them on ice for 5 minutes, take them out and place them at room temperature for 5 minutes; add 10 μL of the above two plasmids to each, mix them gently and transfer them to the electroporation cup, adjust the voltage of the electroporator to 2100 V for electroporation; immediately add 800 μL of TSB medium after electroporation, mix them evenly and transfer them to a 1.5 mL Eppendorf tube, and culture them in a shaker at 37°C for 2-3 hours; centrifuge at 5000 rpm for 3 minutes, discard 900 μL of supernatant, and resuspend the remaining 100 μL of precipitate and spread it on a TSA solid culture medium plate containing 15 μg / mL chloramphenicol, invert it and culture it in a 37°C incubator overnight. Only bacteria that have been successfully electroporated with the plasmid can grow on the plate. The next day, pick a single colony and place it in 4 mL of liquid TSB (cm + ) medium and cultured overnight at 37°C in a shaking incubator.
[0123] 2. Bacteriophage gp036Gene deletion editing
[0124] 1) Step 1: One round of editing (this process can be completed in 1 day)
[0125] For pEdit- gp036 -RN4220 bacterial suspension was expanded at 1:100: in 3 mL TSB (cm + ) medium was added with 30 μL of overnight cultured pEdit- gp036 -RN4220 bacterial solution was cultured at 37°C with a shaker at 180 rpm for about 2.5 h, at which time 10 μL of phage philPLA-RODI stock solution (titer 3.7×10 9 PFU / mL), incubate on a shaker at 37°C and 180 rpm for about 5 h; aspirate 1 mL of the lysate, centrifuge at 4°C and 10,000 rpm for 10 min, transfer the supernatant with a syringe and filter it through a 0.22 μm filter membrane. The resulting lysate was named RODI-Δ gp036 First generation phage.
[0126] 2) Step 2: Second round of Target (this process can be completed in 1 day)
[0127] For pTaregt- gp036 -RN4220 bacterial suspension was expanded at 1:100: in 3 mL TSB (cm + ) medium was added with 30 μL of overnight cultured pTaregt- gp036 -RN4220 bacterial solution was cultured at 37°C and 180 rpm on a shaker for about 2.5 h, at which time 100 μL of RODI-Δ gp036 First generation phage stock solution (titer 2×10 3 PFU / mL), incubate on a shaker at 37°C and 180 rpm for about 5 h; aspirate 1 mL of the lysate, centrifuge at 4°C and 10,000 rpm for 10 min, transfer the supernatant with a syringe and filter it through a 0.22 μm filter membrane. The resulting lysate is named RODI-Δ gp036 Second generation bacteriophage.
[0128] RODI-Δ gp036 Second generation phage (titer 4×10 6 PFU / mL) was serially diluted with TSB medium to 10 -6 , and select appropriate gradients for plating on TSB double-layer plates. The specific plating operation is as follows: TSA and TSB are mixed evenly in a volume ratio of 1:2 to obtain TSB semi-solid medium; 50 μL of overnight cultured pTaregt- gp036-RN4220 bacterial suspension and 10 μL 10 -3 Gradient RODI-Δ gp036 Then add 4 mL of TSB semi-solid medium cooled to about 45°C, mix well, and pour it onto TSA (cm + ) solid culture medium plate; after solidification, place it upside down in a 37℃ incubator for overnight culture. A single plaque will appear on the double-layer plate after overnight culture. Figure 3 RODI-Δ gp036 Results of plating the second-generation phage on TSB double-layer plates.
[0129] 3) Step 3: Three rounds of Target (this process can be completed in one day)
[0130] Use 12-well plates to expand the bacterial suspension at a dilution of 1:100: in 3 mL TSB (cm + ) medium was added with 30 μL of overnight cultured pTaregt- gp036 -RN4220 bacterial solution, cultured on a shaker at 37℃ and 180 rpm for about 2.5 h, at which time 10 single plaques plated during the second round of Target were picked and placed in each of them, and cultured on a shaker at 37℃ and 180 rpm for about 5 h; 1 mL of lysate was aspirated and centrifuged at 4℃ and 10000 rpm for 10 min, and the supernatant was transferred with a syringe to pass through a 0.22 μm filter membrane. The resulting lysate was named RODI-Δ gp036 Three generations of bacteriophage.
[0131] 3. Extract RODI-Δ using viral genomic RNA / DNA extraction kit gp036 The third generation phage genomic DNA was used as a PCR template. gp036 The gene external primers (out) and internal primers (in) are used to amplify it. The PCR products are subjected to gel electrophoresis on 1% agarose gel, and the size of the bands in the gel run results can be used to determine the gp036 Whether the gene was successfully deleted, e.g. Figure 4 As shown. Further, the successful deletion gp036 The PCR products of the gene were sent to the company for sequencing to confirm gp036 The specific PCR verification reaction system is shown in Table 8:
[0132] Table 8 PCR verification reaction system
[0133]
[0134] The reaction program was as follows: 95°C for 3 min; 30 cycles of 95°C for 15 s, 55°C for 15 s, and 72°C for 10 s; and 72°C for 10 min and 4°C ∞.
[0135] gp036 The PCR primer sequences for gene deletion verification are:
[0136] gp036 -in-F:5'-agtaatgaccatgtaacacgaga-3'
[0137] gp036 -in-R:5'-acactccgttaataagcttacct-3'
[0138] gp036 -out-F:5'-agggtgaaagcttatgttcgtg-3'
[0139] gp036 -out-R:5'-tgcgttcatttaataccctcct-3'.
[0140] from Figure 4 philPLA-RODI gp036 The PCR verification results of the gene deletion mutation showed that when the 10 randomly selected phage plaques were verified with internal primers, no bands were produced; when verified with external primers, the edited phage bands were smaller than those of the wild-type phage and the size was correct; further, the sequencing results also showed gp036 The gene was successfully deleted with an editing efficiency of 100%.
[0141] Example 5 CRISPR-Cas dual-plasmid system achieves efficient gene insertion on phage philPLA-RODI
[0142] The CRISPR-Cas dual-plasmid system composed of pTarget and pEdit plasmids can achieve efficient gene insertion in the phage philPLA-RODI. gp170 Gene as an example, in philPLA-RODI gp170 The fluorescent marker gene GFP is inserted after the gene, and the specific GFP sequence is shown in SEQ ID No: 4 in the sequence list.
[0143] 1. Construct pTarget- gp170 Plasmid, which is in gp170 Based on the PAM site requirements, the 30 bp upstream of the gene end was selected as a spacer to construct it into the pTarget plasmid. The spacer primer sequence is:
[0144] gp170 -SeCas9-F:5'-cacctgaataattttggaagtcagattacaacgg-3'
[0145] gp170 -SeCas9-R:5'-taacccgttgtaatctgacttccaaaattattca-3'
[0146] 2. Construct pEdit- according to the method described in Example 3. gp170 Plasmid, the homology arm fragment up of the plasmid contains the above gp170 A spacer was added, and a point mutation was made at a certain spacer base site near the PAM, causing a synonymous mutation in the amino acid encoded at that position. The primer sequences for amplifying the homology arms up and down and GFP are:
[0147] gp170 -up-F:
[0148] 5'-actagttttttatttggatccaactttatttttatggaaggtatttattaacc-3'
[0149] gp170 -up-R:
[0150] 5'-ccttttgacattataatccctcagttgtaatctgacttcc-3'
[0151] gp170 -GFP-F:
[0152] 5'-gggattataatgtcaaaaggtgaagaattatttacagg-3'
[0153] gp170 -GFP-R:
[0154] 5'-ctaattccattttatttatataattcatccataccatgtgtaa-3'
[0155] gp170 -down-F:
[0156] 5'-tataaataaaatggaattagttattaatattatagcagtattaat-3'
[0157] gp170 -down-R:
[0158] 5'-ctcagatctgttaacggtacctccatttctgaaaatactttaatcatcg-3'
[0159] 3. Replace the above pTarget- gp170 Plasmids and pEdit- gp170 The plasmids were electroporated into Staphylococcus aureus RN4220 competent cells, and the successfully electroporated strains were named pTarget- gp170 -RN4220 and pEdit- gp170 -RN4220. According to the phage genome editing method in Example 4, one round of Edit, two rounds of Target, and three rounds of Target were performed to collect RODI- gp170 -GFP three-generation phage.
[0160] 4. Extract RODI- using viral genomic RNA / DNA extraction kit gp170 -GFP three-generation phage genomic DNA, and used it as a PCR template, gp170 Gene external primers (out) and verification primers (verify) are used to amplify them respectively. The PCR products are subjected to gel electrophoresis on 1% agarose gel. The size of the bands in the gel run results can be used to determine whether the GFP gene has been successfully inserted. Figure 5 、 6 Furthermore, the PCR product with successful insertion of the GFP gene was sent to the company for sequencing to confirm the successful insertion of the GFP gene.
[0161] gp170 The PCR verification primer sequences for the inserted GFP gene are:
[0162] gp170 -verify-F1:5'-acggattgtattagtggtggtt-3'
[0163] gp170 -GFP-R1:5'-ccttctggcattgctgattt-3'
[0164] gp170 -GFP-F2:5'-ccaattggtgatggtccagt-3'
[0165] gp170 -verify-R2:5'-tggtctcctctgtacgttctaaca-3'
[0166] gp170-out-F:5'-ccggaagtattctagcaatcg-3'
[0167] gp170 -out-R: 5'-aaaagtaaagacctacagccatacc-3'.
[0168] Figure 6 PCR verification results of inserting the fluorescent marker gene GFP into the bacteriophage philPLA-RODI. Figure 6 The results showed that when 12 randomly selected phage plaques were verified using external primers, the edited phage bands were larger than those of the wild-type phage and the size was correct; when verified using verification primers, the edited phage with the GFP gene successfully inserted was able to run out of the band; further, sequencing results also showed that the GFP gene was successfully inserted, with an editing efficiency of 75%.
[0169] Example 6 CRISPR-Cas dual plasmid system achieves efficient site-directed mutagenesis on phage philPLA-RODI
[0170] The CRISPR-Cas dual-plasmid system composed of pTarget and pEdit plasmids can achieve efficient site-directed mutagenesis in phage philPLA-RODI. gp106 Taking genes as an example, the specific steps are as follows:
[0171] 1. Construct pTarget- gp106 Plasmid, which is in gp106 Based on the PAM site requirements, the 30 bp upstream of the gene was selected as a spacer and constructed into the pTarget plasmid. The spacer primer sequence is:
[0172] gp106 -SeCas9-F:5'-cacccaaaaggtgctcctagtggagaagctacgg-3'
[0173] gp106 -SeCas9-R:5'-taacccgtagcttctccactaggagcaccttttg-3'
[0174] 2. Construct pEdit- according to the method described in Example 3. gp106 Plasmid, the homology arm fragment up of the plasmid contains the above gp106 The spacer of the gene is truncated, and the first base near the PAM undergoes a G to T substitution mutation. The primer sequences for amplifying the homology arms up and down are:
[0175] gp106-up-F:
[0176] 5'-actagttttttatttggatccaggagaaaaatagatggcatttaactac-3'
[0177] gp106 -up-R:
[0178] 5'-aatcctgacgtagcttctccactaggagca-3'
[0179] gp106 -down-F:
[0180] 5'-ggagaagctacgtcaggatttgtaagatggataaaagaa-3'
[0181] gp106 -down-R:
[0182] 5'-ctcagatctgttaacggtaccctgagttgtagattcagtgagttcctt-3'
[0183] 3. Replace the above pTarget- gp106 Plasmids and pEdit- gp106 The plasmids were electroporated into Staphylococcus aureus RN4220 competent cells, and the successfully electroporated strains were named pTarget- gp106 -RN4220 and pEdit- gp106 -RN4220, according to the phage genome editing method in Example 4, one round of Edit, two rounds of Target, and three rounds of Target were performed to collect RODI- gp106 -point third generation bacteriophage.
[0184] 4. Extract RODI- using viral genomic RNA / DNA extraction kit gp106 -point third generation phage genomic DNA and use it as a PCR template. gp106 The gene is amplified using the verification primers (verify) and the PCR product is sent directly to the company for sequencing.
[0185] gp106 The PCR primer sequences for single nucleotide substitution mutations are:
[0186] gp106 -verify-F:5'-cgcctcttactgaaacacagaa-3'
[0187] gp106 -verify-R:5'-tgagttgtagattcagtgagttcct-3'.
[0188] Figure 7 The sequencing results show that the point mutation was successfully achieved in the phage philPLA-RODI. gp106 Site-directed mutagenesis is performed in the spacer of the gene. This site-directed mutagenesis can only produce efficient single nucleotide substitutions at the 1-8 base sites close to the PAM in the 30-base spacer sequence, and can perform any substitution except the substitution between bases A and T, while the editing efficiency can reach 100%.
[0189] CRISPR-Cas9 system edited plasmid sequence (SEQ ID No: 1)
[0190]
[0191] Homologous recombination pEdit plasmid sequence (SEQ ID No: 2)
[0192]
[0193] SeCas9-pUC57 plasmid sequence (SEQ ID No: 3)
[0194]
[0195] GFP sequence (SEQ ID No:4)
[0196] ATGTCAAAAGGTGAAGAATTATTTACAGGTGTTGTTCCAATTTTAGTTGAATTAGATGGTGATGTTAATGGTCATAAATTTTCAGTTCGTGGTGAAGGTGAAGGTGATGCAACAAATGGTAAATTAACATTAAAATTTATTTGTACAACAGGTAAATTACCAGTTCCATGGCCAACATTAGTTACAACATTAACATATGGTGTTCAATGTTTTTCACGTTATCCAGATCATATGAAACAACATGATTTTTTTAAATCAGCAATGCCAGAAGGTTATGTTCAAGAACGTACAATTTCATTTAAAGATGATGGTACATATAAAACACGTGCAGAAGTTAAATTTGAAGGTGATACATTAGTTAATCGTATTGAATTAAAAGGTATTGATTTTAAAGAAGATGGTAATATTTTAGGTCATAAATTAGAATATAATTTTAATTCACATAATGTTTATATTACAGCAGATAAACAAAAAAATGGTATTAAAGCAAATTTTAAAATTCGTCATAATGTTGAAGATGGTTCAGTTCAATTAGCAGATCATTATCAACAAAATACACCAATTGGTGATGGTCCAGTTTTATTACCAGATAATCATTATTTATCAACACAATCAAAATTATCAAAAGATCCAAATGAAAAACGTGATCATATGGTTTTATTAGAATTTGTTACAGCAGCAGGTATTACACATGGTATGGATGAATTATATAAATAA。
Claims
1. A phage genome editing vector based on the CRISPR-Cas9 system, characterized in that: The phage genome editing vector includes a resistance screening marker, a promoter P rpsL , Cas9 nuclease gene, endogenous U6 promoter, sgRNA sequence, endogenous U6 terminator and replicon, wherein the Cas9 nuclease gene is Staphylococcus epidermidis ( S. epidermidis ) SeCas9 nuclease gene, the SeCas9 nuclease gene is shown in SEQ ID NO.
5.
2. The phage genome editing vector based on the CRISPR-Cas9 system according to claim 1, characterized in that The sequence of the phage genome editing vector is shown in SEQ ID No.
1.
3. A pTarget plasmid, characterized in that The pTarget plasmid is obtained by connecting the spacer fragment of the target gene with the phage genome editing vector according to claim 1 or 2, and the spacer fragment of the target gene is designed and amplified according to the PAM site requirements.
4. A CRISPR-Cas dual-plasmid system, characterized in that: The CRISPR-Cas dual-plasmid system includes the pTarget plasmid described in claim 3, and also includes a pEdit plasmid. The pEdit plasmid is obtained by introducing the upstream homology arm fragment and the downstream homology arm fragment of the target gene in the phage genome into the plasmid, and the upstream homology arm fragment and the downstream homology arm fragment of the target gene are obtained by designing primers and amplifying by PCR.
5. An engineered bacterium, characterized in that: The engineered bacteria contains the phage genome editing vector based on the CRISPR-Cas9 system according to claim 1 or 2, the pTarget plasmid according to claim 3, or the CRISPR-Cas dual-plasmid system according to claim 4.
6. The method for constructing a genome editing vector according to claim 1 or 2, characterized in that: The following steps are involved: 1) The promoter P rpsL 、 Secas9 , the endogenous U6 promoter, and the sgRNA gene sequence were connected and introduced into the pUC57 plasmid to obtain the SeCas9-pUC57 plasmid. The gene fragments of the SeCas9 editing system components were amplified by PCR using the SeCas9-pUC57 plasmid as a template; 2) Connect the gene fragments of the SeCas9 editing system components to the linear vector to obtain a phage genome editing vector based on the CRISPR-Cas9 system.
7. The method for constructing the pTarget plasmid according to claim 3, characterized in that: The following steps are involved: 1) constructing a phage genome editing vector based on the CRISPR-Cas9 system as described in claim 1 or 2; 2) Based on the PAM site requirements of the SeCas9 nuclease, determine the editing site on the target gene, design the targeting sequence, and construct it into the phage genome editing plasmid of the CRISPR-Cas9 system obtained in step 1) to obtain the pTarget plasmid.
8. A phage genome editing method based on the CRISPR-Cas9 system, characterized in that: The following steps are involved: 1) constructing a phage genome editing vector based on the CRISPR-Cas9 system as described in claim 1 or 2; 2) Based on the PAM site requirements of the SeCas9 nuclease, determine the editing site on the target gene, design a targeting sequence, and construct it into the phage genome editing vector of the CRISPR-Cas9 system obtained in step 1) to obtain the pTarget plasmid. Subsequently, it is electroporated into Staphylococcus aureus competent cells to obtain the targeted strain; 3) 200 bp DNA sequences upstream and downstream of the editing site were constructed into a vector to obtain the pEdit plasmid, which was then electroporated into Staphylococcus aureus competent cells to obtain the editing strain; 4) Infecting the edited strain obtained in step 3) with a phage to induce homologous recombination in the phage, then harvesting the phage and further re-infecting the targeted strain in step 2) with the phage to obtain phage mutants through reverse screening, thereby achieving deletion or insertion editing of gene fragments in the phage genome.
9. The phage genome editing method based on the CRISPR-Cas9 system according to claim 8, characterized in that: In step 2), the PAM site selection requirement is 5'-NNGRRT-3', and the target gene includes gp036 Gene or gp170 Gene.
10. The phage genome editing method based on the CRISPR-Cas9 system according to claim 8, characterized in that: The bacteriophage in step 4) includes Staphylococcus aureus philPLA-RODI phage.
Citation Information
Patent Citations
pCasSA plasmid and application thereof
CN106834330A
Single guide RNA, crispr / cas9 systems, and methods of use thereof
CN109963945A