Kit and pretreatment method for 5hmC-dna pretreatment, photoelectrochemical sensor for detecting 5hmC-dna and detection method of 5hmC-dna
By using a azidation reaction and self-triggered isothermal amplification technology with a reagent kit and photoelectrochemical sensor, the problems of accuracy and radioactive contamination in the detection of 5hmC in the prior art have been solved, and high-sensitivity single-base resolution detection has been achieved.
Patent Information
- Application Number
- CN202411581910.3
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-11-07
- Publication Date
- 2025-11-21
- Estimated Expiration
- 2044-11-07
AI Technical Summary
Existing technologies are insufficient for the accurate and specific detection of 5hmC at the single-base resolution level, and also present problems such as radioactive contamination and high requirements for detection equipment.
A reagent kit and photoelectrochemical sensor were used to form a Y-shaped scaffold structure through an azide reaction. Combined with self-triggered isothermal amplification technology, the Cu2O@CuO@Ag ternary composite material was used as a photoelectrochemical sensor to achieve signal amplification and specific detection at 5 hmC.
It achieves high-sensitivity detection of 5hmC at the single-base resolution level, is simple to operate, low in cost, has no radioactive contamination, and has a detection limit of 0.42fM.
Smart Images

Figure CN119464455B_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of biosensing technology, and more particularly to a kit and pretreatment method for 5hmC-DNA pretreatment, a photoelectrochemical sensor for detecting 5hmC-DNA, and a method for detecting 5hmC-DNA. Background Technology
[0002] 5-Hydroxymethylcytosine (5hmC) is a pattern of epigenetic modification, primarily produced by the catalysis of the TET (ten-eleven translocation) protease. It is the "sixth base" discovered after 5mC. To date, numerous studies both domestically and internationally have shown that the overall content of 5hmC is significantly reduced in various cancer genes, including those for breast cancer (HOXA, LZTS1, TNFA), colon cancer (CA2, FMN2, PDCD4, PKIB), and lung cancer (SOD3). Conversely, the overall level of 5hmC shows an increasing trend in benign uterine leiomyomas, acute myeloid leukemia, and glioblastoma. Furthermore, abnormal 5hmC distributions have been found in myelodysplastic syndromes, Huntington's disease, and Alzheimer's disease. Therefore, 5hmC is not only a key intermediate in the demethylation process but also acts as an independent epigenetic marker and an important biomarker for disease diagnosis and prognosis. Because epigenetic modifications regulate gene expression in the early stages of tumor development, while positive imaging findings often indicate mid-to-late stages of tumor growth, and protein tumor marker detection is typically performed after tumor formation, detecting 5hmC modification levels represents an earlier detection process. Furthermore, the detection of characteristic target genes for tumors offers better methodological specificity compared to current laboratory methods for detecting protein tumor markers. Therefore, epigenetic DNA hydroxymethylation levels have become a new target for early-stage, specific tumor diagnosis, and quantitative analysis of specific DNA hydroxymethylation sequences can provide strong support for understanding the epigenetic patterns of disease development and for early-stage, specific tumor diagnosis.
[0003] Currently reported methods for DNA hydroxymethylation analysis mainly include the following: ① Liquid chromatography-mass spectrometry (LC-MS) analysis: LC-MS combines the separation capability of chromatography with the qualitative detection of mass spectrometry. DNA samples are enzymatically digested into mononucleotides, injected into a chromatographic column, and mass spectra are plotted after measuring each peak. While this technique has high specificity and can provide the compositional percentage of each component, it cannot achieve single-base resolution and requires a small sample volume per analysis. ② Glycosylation labeling analysis: This method uses radioactively labeled glucose to specifically label the 5hmC base of the target gene via an enzymatic reaction, thereby enriching and purifying the target gene. While this method has high sensitivity, low cost, and is easy to operate, it suffers from radioactive contamination and incomplete enzymatic reactions. ③ Single-molecule sequencing technology: Single-molecule DNA sequencing distinguishes different bases using optical or electrical signals. The technology has a base identification error rate as high as 18-20%, resulting in poor accuracy. In addition, the massive data processing required after detection and the special requirements for detection equipment make it difficult to promote in clinical laboratories.
[0004] In summary, obtaining accurate and specific 5hmC at single-base resolution from a large number of C (cytosine, C) and 5mC sites remains a significant challenge. Summary of the Invention
[0005] The purpose of this invention is to provide a kit and pretreatment method for 5hmC-DNA pretreatment, a photoelectrochemical sensor for detecting 5hmC-DNA, and a detection method for 5hmC-DNA. Using the pretreatment method of this invention to treat 5hmC-DNA before detection enables specific detection of 5hmC at single-base resolution, exhibiting high sensitivity, simple operation, low cost, and no radioactive contamination.
[0006] To achieve the above-mentioned objectives, the present invention provides the following technical solution:
[0007] This invention provides a kit for pretreatment of 5hmC-DNA, comprising NE buffer, uridine diphosphate-6-azido-glucose solution, T4 phage β-glucose transferase, DBCO-modified primer Yc, DNA strand Ya, DNA strand Yb, DNA strand H1, DNA strand H2, DNA strand S1, deoxynucleotide triphosphate solution, DNA polymerase, and nicking endonuclease.
[0008] The nucleotide sequence of the primer Yc is shown in SEQ ID NO.1;
[0009] The nucleotide sequence of the DNA chain Ya is shown in SEQ ID NO.2;
[0010] The nucleotide sequence of the DNA chain Yb is shown in SEQ ID NO.3;
[0011] The nucleotide sequence of the DNA chain H1 is shown in SEQ ID NO.4;
[0012] The nucleotide sequence of the DNA strand H2 is shown in SEQ ID NO.5;
[0013] The nucleotide sequence of the DNA chain S1 is shown in SEQ ID NO.6.
[0014] This invention provides a pretreatment method for 5hmC-DNA, which uses the kit described above to treat 5hmC-DNA, including the following steps:
[0015] NE buffer, uridine diphosphate-6-azido-glucose solution, T4 phage β-glucose transferase and 5hmC-DNA sample to be treated were mixed, and the resulting mixture was subjected to azidation reaction at 37℃ to obtain azidated 5hmC solution.
[0016] The azide-labeled 5hmC solution was mixed with DBCO-modified primer Yc and a click chemistry reaction was carried out at 37°C to obtain 5hmC-Yc.
[0017] The 5hmC-Yc, DNA strand Ya and DNA strand Yb were mixed and hybridized at 37°C to obtain a Y-shaped scaffold.
[0018] The Y-shaped scaffold was mixed with DNA strand H1 and DNA strand H2 and assembled at 37°C to form a Y-shaped scaffold containing hairpins.
[0019] The hairpin-containing Y-shaped scaffold was mixed with DNA strand S1 and subjected to a strand displacement reaction at 37°C. The resulting reaction solution was then mixed with deoxyribonucleotide triphosphate, DNA polymerase, and nicking endonuclease, and subjected to a first incubation at 37°C.
[0020] Preferably, the molar ratio of the 5hmC-Yc, DNA strand Ya, and DNA strand Yb is 1:1:1;
[0021] The molar ratio of the Y-shaped scaffold to DNA strand H1 and DNA strand H2 is 1:1:1.
[0022] This invention provides a photoelectrochemical sensor for detecting 5hmC-DNA, comprising a substrate electrode loaded with a Cu2O@CuO@Ag layer, NH3-modified DNA strand H3, ethanethiol, and the ALP-H4 solution of the above-described reagent kit;
[0023] The nucleotide sequence of the DNA chain H3 is shown in SEQ ID NO.7;
[0024] The ALP-H4 in the ALP-H4 solution is Biotin-H4-Biotin, wherein the nucleotide sequence of H4 is shown in SEQ ID NO.8.
[0025] Preferably, the method for preparing the substrate electrode loaded with the Cu2O@CuO@Ag layer includes: dispersing Cu2O@CuO@Ag in water to obtain a Cu2O@CuO@Ag suspension; adding the Cu2O@CuO@Ag suspension dropwise onto the surface of a conductive substrate and then drying and calcining it to obtain the substrate electrode loaded with the Cu2O@CuO@Ag layer.
[0026] Preferably, it also includes MES buffer and Tris buffer;
[0027] The MES buffer contains 1-ethyl-(3-dimethylaminopropyl)carbodiimide and N-hydroxysuccinimide;
[0028] The Tris buffer contains L-ascorbic acid-2-phosphate trisodium.
[0029] A method for detecting 5hmC-DNA for non-disease diagnostic purposes using the photoelectrochemical sensor described above includes the following steps:
[0030] The NH3-modified DNA strand H3 was heated and then cooled to form a hairpin structure H3.
[0031] A hairpin-structured H3 is added to the surface of the substrate electrode loaded with Cu2O@CuO@Ag layer and bonded together to form H3 / Cu2O@CuO@Ag / conductive substrate;
[0032] Ethyl mercaptan was added to the surface of the H3 / Cu2O@CuO@Ag / conductive substrate for a second incubation to form an HT layer, thus obtaining the HT / H3 / Cu2O@CuO@Ag / conductive substrate; wherein HT is ethyl mercaptan.
[0033] The sample to be tested was pretreated using the kit according to the pretreatment method described above to obtain a sequence P solution;
[0034] The sequence P solution was added to the surface of the HT / H3 / Cu2O@CuO@Ag / conductive substrate and a third incubation was performed to form the P / HT / H3 / Cu2O@CuO@Ag / conductive substrate.
[0035] ALP-H4 solution was added to the surface of a P / HT / H3 / Cu2O@CuO@Ag / conductive substrate for a fourth incubation to form a photoelectrochemical sensor.
[0036] The photoelectrochemical sensor was placed in a Tris-HCl buffer solution containing L-ascorbic acid 2-phosphate for photocurrent testing. The photocurrent intensity was measured, and the content of 5hmC-DNA in the sample was calculated based on the linear relationship between the photocurrent intensity and the logarithm of the 5hmC-DNA concentration.
[0037] Preferably, before adding the hairpin structure H3 to the surface of the substrate electrode loaded with Cu2O@CuO@Ag layer, the substrate electrode loaded with Cu2O@CuO@Ag layer is further activated using MES buffer.
[0038] Preferably, after the fourth incubation is completed, Tris buffer is added to the surface of the formed ALP-H4 / P / HT / H3 / Cu2O@CuO@Ag / conductive substrate.
[0039] Preferably, the bonding temperature is 37°C and the bonding time is 1.5 hours.
[0040] The detection principle of this invention is as follows: The Cu2O@CuO@Ag ternary composite material serves as the basic photocurrent of the PEC (photoelectrochemical sensor). A zirconia reaction specifically targets the 5hmC target, forming a Y-shaped scaffold structure. A self-triggered isothermal amplification technique is used to amplify the signal on the Y-shaped scaffold, thereby converting the 5hmC site into a large number of sequences P (specifically, S1 initiates the self-triggered isothermal amplification technique; S1 binds to hairpin H1, exposing and rearranging the self-primer domain within the H1 stem; H1 extension and enzymatic digestion reactions are repeated, thus converting the 5hmC site into a large number of sequences P). Sequence P is introduced onto the electrode and binds to H3. After opening the hairpin H3, it is subsequently recognized by the H4 probe carrying ALP (i.e., ALP-H4). ALP catalyzes the reaction of AAP in Tris-HCl buffer. ( L-Ascorbic acid 2-phosphate trisodium salt ) Hydrolysis produces more AA (ascorbic acid) electron donors for PEC detection.
[0041] This invention utilizes an azide reaction to specifically react with a 5hmC target, forming a Y-shaped scaffold structure. A self-triggered isothermal amplification technique is then used to achieve signal conversion output from the Y-shaped scaffold. Based on this, a photoelectrochemical analysis strategy using a ternary heterojunction photocatalyst Cu2O@CuO@Ag is constructed. By leveraging the signal conversion output structure and the amplification principle of the catalytic medium, a dual amplification of the photoelectrochemical response signal is achieved, thereby enabling specific detection of 5hmC and improving detection sensitivity. Through the dose-response relationship between the photoelectrochemical signal response and the target sequence, a mathematical model of DNA hydroxymethylation at different abundances and the electrochemical response signal is established to achieve quantitative analysis of 5hmC-DNA hydroxymethylation.
[0042] The results of the embodiments show that the detection limit of the present invention for 5hmC is 0.42fM (signal-to-noise ratio S / N = 3). Attached Figure Description
[0043] Figure 1 This is a schematic diagram of the 5hmC-DNA pretreatment process of the present invention;
[0044] Figure 2 This is a schematic diagram of the method flow for detecting 5hmC-DNA;
[0045] Figure 3 SEM image of Cu2O@CuO@Ag;
[0046] Figure 4 Photocurrent intensity curves for 5hmC-DNA at different known concentrations;
[0047] Figure 5 This is a standard curve showing the relationship between photocurrent intensity and the logarithm of 5hmC-DNA concentration.
[0048] Figure 6 Electrochemical impedance spectroscopy for different photochemical sensors;
[0049] Figure 7 This is the result of a specific detection experiment. Detailed Implementation
[0050] This invention provides a kit for pretreatment of 5hmC-DNA, comprising NE buffer, uridine diphosphate-6-azido-glucose solution, T4 phage β-glucose transferase, DBCO-modified primer Yc, DNA strand Ya, DNA strand Yb, DNA strand H1, DNA strand H2, DNA strand S1, deoxynucleotide triphosphate solution, DNA polymerase, and nicking endonuclease.
[0051] Unless otherwise specified, all raw materials used in this invention are commercially available products well known in the art.
[0052] In this invention, the NE buffer is preferably composed of Tris-HCl, MgCl2 and dithiothreitol (DTT), and the pH value of the NE buffer is preferably 6.0.
[0053] The present invention does not have any special requirements on the concentration of the uridine diphosphate-6-azido-glucose (UDP-6-N3-Glu) solution; in the embodiments of the present invention, it is specifically 200 nM.
[0054] The present invention does not have any special requirements for the activity of the T4 phage β-glucose transferase (T4-β-GT). In the embodiments of the present invention, the unit activity of the T4 phage β-glucose transferase is preferably 20 U / mL.
[0055] In this invention, the nucleotide sequence of primer Yc is shown in SEQ ID NO.1, specifically G GACAGACGGATTTCCTCTAGTACTCCTGTGTGACTCCA. The DBCO-modified primer Yc is specifically GGACAGACGGATTTCCTCTAGTACTCCTGTGTGACTCCA-DBCO, where DBCO is dibenzocyclooctene. In this invention, the DBCO-modified primer Yc was synthesized by Sangon Biotech (Shanghai) Co., Ltd.
[0056] In this invention, the nucleotide sequence of the DNA chain Ya is shown in SEQ ID NO.2; specifically, GAATGCTGCGTGTAATCCGTCTGTCCACTGGCTACTGTC.
[0057] In this invention, the nucleotide sequence of the DNA chain Yb is as shown in SEQ ID NO.3; specifically, GAGTACTAGAGGAACACGCAGCATTCACCTGTCTGTCGT.
[0058] In this invention, the nucleotide sequence of the DNA chain H1 is as shown in SEQ ID NO.4; specifically, TGGAAAATCTCTAGCAGTACGTACACTGCTAGAGGCCGTGTAGGATCCG AATTTTTTTTGACAGTAGCCAGT.
[0059] In this invention, the nucleotide sequence of the DNA chain H2 is as shown in SEQ ID NO.5; specifically, it is ACTGCTAGAGATTTTCCACGGCCTCTAGCAGTGTACGTTTTTTTTTTTAC GACAGACAGGT.
[0060] In this invention, the nucleotide sequence of the DNA chain S1 is as shown in SEQ ID NO.6; specifically, it is GAGATTTTCCA.
[0061] In this invention, all of the above-mentioned DNA strands were synthesized by Sangon Biotech (Shanghai) Co., Ltd.
[0062] In this invention, the concentration of the deoxyribonucleotide triphosphate (dNTP) solution is preferably 500 μM.
[0063] In this invention, the DNA polymerase is preferably KF DNA polymerase; the activity of the DNA polymerase is preferably 100 U / mL.
[0064] In this invention, the activity of the nicking endonuclease (Nt.BbvCI) is preferably 500 U / mL.
[0065] This invention provides a pretreatment method for 5hmC-DNA, which uses the kit described above to treat 5hmC-DNA, including the following steps:
[0066] NE buffer, uridine diphosphate-6-azido-glucose solution, T4 phage β-glucose transferase and 5hmC-DNA sample to be treated were mixed, and the resulting mixture was subjected to azidation reaction at 37℃ to obtain azidated 5hmC solution.
[0067] The azide-labeled 5hmC solution was mixed with DBCO-modified primer Yc and a click chemistry reaction was carried out at 37°C to obtain 5hmC-Yc.
[0068] The 5hmC-Yc, DNA strand Ya and DNA strand Yb were mixed and hybridized at 37°C to obtain a Y-shaped scaffold.
[0069] The Y-shaped scaffold was mixed with DNA strand H1 and DNA strand H2 and assembled at 37°C to form a Y-shaped scaffold containing hairpins.
[0070] The hairpin-containing Y-shaped scaffold was mixed with DNA strand S1 and subjected to a strand displacement reaction at 37°C. The resulting reaction solution was then mixed with deoxyribonucleotide triphosphate, DNA polymerase, and nicking endonuclease, and subjected to a first incubation at 37°C.
[0071] In this invention, NE buffer, uridine diphosphate-6-azido-glucose solution, T4 phage β-glucose transferase and 5hmC-DNA sample to be treated are mixed, and the resulting mixture is subjected to azidation reaction at 37°C to obtain azidated 5hmC solution.
[0072] In this invention, the amount of uridine diphosphate-6-azido-glucose solution is preferably such that the concentration of uridine diphosphate-6-azido-glucose (UDP-6-N3-Glu) in the mixture is 6-7 nM; the amount of T4 phage β-glucose transferase (T4-β-GT) is preferably such that the concentration of T4-β-GT in the mixture is 0.06-0.07 U / mL.
[0073] This invention does not have special requirements for the 5hmC-DNA sample to be treated. In the embodiments of this invention, 5hmC-DNA synthesized by Sangon Biotech (Shanghai) Co., Ltd. is specifically used. In this invention, the nucleotide sequence of the 5hmC is obtained by replacing the C at position 18 of the sequence shown in SEQ ID NO.9 with 5hmC. In this invention, the preferred volume ratio of the NE buffer to the 5hmC-DNA sample to be treated is 9:20.
[0074] In this invention, the preferred time for the azidation reaction is 2 hours. During the azidation reaction, T4-β-GT, in the presence of the glucose donor UDP-6-N3-Glu, glycosylates 5-hydroxymethylcytosine to generate β-glucosyl-5-hydroxymethylcytosine (5-ghmC), thus achieving azidation labeling.
[0075] After the azidation reaction is completed, the present invention preferably purifies the reaction system using a DNA purification kit to remove UDP-6-N3-Glu and T4 phage β-glucose transferase, and obtains an azid-labeled 5h mC solution.
[0076] After obtaining the azide-labeled 5hmC solution, the present invention mixes the azide-labeled 5hmC solution with DBCO-modified primer Yc and performs a click chemistry reaction at 37°C to obtain 5hmC-Yc.
[0077] In this invention, the molar ratio of azide-labeled 5hmC to DBC O-modified primer Yc in the azide-labeled 5hmC solution is preferably 1:1.
[0078] In this invention, the preferred time for the click chemical reaction is 24 hours.
[0079] After obtaining 5hmC-Yc, the present invention mixes the 5hmC-Yc, DNA strand Ya and DNA strand Yb, and performs a hybridization reaction at 37°C to obtain a Y-shaped scaffold.
[0080] In this invention, the molar ratio of 5hmC-Yc, DNA strand Ya, and DNA strand Yb is preferably 1:1:1. In this invention, the hybridization reaction time is preferably 2 hours. In this invention, Ya, Yb, and Yc hybridize in pairs during the hybridization reaction.
[0081] After obtaining the Y-shaped scaffold, the present invention mixes the Y-shaped scaffold with DNA strand H1 and DNA strand H2, and assembles them at 37°C to form a hairpin-containing Y-shaped scaffold.
[0082] In this invention, the molar ratio of the Y-shaped scaffold to DNA strand H1 and DNA strand H2 is preferably 1:1:1. In this invention, the assembly time is preferably 2 hours.
[0083] After forming a hairpin-containing Y-shaped scaffold, the present invention mixes the hairpin-containing Y-shaped scaffold with DNA strand S1 and performs a strand displacement reaction at 37°C to obtain a reaction solution.
[0084] In this invention, the molar ratio of the hairpin-containing Y-shaped scaffold to the DNA strand S1 is preferably 1:1.
[0085] In this invention, the preferred duration of the strand substitution reaction is 2 hours. This invention utilizes DNA strand S1 to open the hair clip H1, followed by a hybridization reaction between H1 and H2.
[0086] After obtaining the reaction solution, the reaction solution was mixed with deoxynucleotide triphosphate, DNA polymerase and nicking endonuclease, and incubated for the first time at 37°C.
[0087] In this invention, the preferred volume ratio of the reaction solution to deoxynucleotide triphosphate, DNA polymerase and nicking endonuclease is 2000:50:4:25.
[0088] In this invention, the first incubation time is preferably 2 hours. This invention generates a large number of signal recognition-conversion element P sequences through the first incubation.
[0089] After completing the first incubation, the present invention preferably further includes inactivating the obtained solution, and the inactivated solution is denoted as solution P. The present invention does not have special requirements for the inactivation conditions, as long as the inactivation effect is achieved. In an embodiment of the present invention, inactivation is specifically performed at 80°C for 20 minutes.
[0090] Figure 1 This is a schematic diagram of the 5hmC-DNA pretreatment process of the present invention.
[0091] This invention utilizes the azide reaction to specifically react with a 5hmC target to form a Y-shaped scaffold structure, and combines self-triggered isothermal amplification technology to realize signal conversion and output of the Y-shaped scaffold, thereby amplifying the photoelectrochemical signal.
[0092] This invention provides a photoelectrochemical sensor for detecting 5hmC-DNA, comprising a substrate electrode loaded with a Cu2O@CuO@Ag layer, NH3-modified DNA strand H3, ethanethiol, the kit described above, and ALP-H4 solution.
[0093] In this invention, the preferred method for preparing the substrate electrode loaded with the Cu2O@CuO@Ag layer includes: dispersing Cu2O@CuO@Ag in water to obtain a Cu2O@CuO@Ag suspension; adding the Cu2O@CuO@Ag suspension dropwise onto the surface of a conductive substrate and then drying and calcining it to obtain the substrate electrode loaded with the Cu2O@CuO@Ag layer.
[0094] The following section will first explain Cu2O@CuO@Ag.
[0095] In this invention, the Cu2O@CuO@Ag preferably comprises Cu2O@CuO and Ag particles loaded on the surface of the Cu2O@CuO. The mass of the Ag particles is preferably 9-10% of the mass of the Cu2O@CuO.
[0096] In this invention, the Cu2O@CuO@Ag is prepared using methods well known in the art; the preferred method for preparing the Cu2O@CuO@Ag includes the following steps:
[0097] Cu2O was dispersed in water, nitrate was added to the resulting dispersion, and solid-liquid separation was performed to obtain Cu2O@CuO.
[0098] The Cu2O@CuO was dispersed in a water-ethanol mixed solution, and the resulting dispersion was mixed with silver nitrate solution. The mixture was then subjected to a light-induced reaction, followed by solid-liquid separation to obtain Cu2O@CuO@Ag.
[0099] In this invention, Cu2O is dispersed in water, nitrate is added to the resulting dispersion to carry out an oxidation reaction, and solid-liquid separation is performed to obtain Cu2O@CuO.
[0100] In this invention, the Cu2O can be prepared using commercially available products or methods well known in the art. In an embodiment of this invention, the Cu2O is prepared in-house. Specifically, 0.375 g of CuSO4·5H2O is added to 80 mL of 0.5 mM anhydrous sodium citrate, and a light blue solution is formed under vigorous stirring. Then, 20 mL of 1.25 M NaOH is added to the above solution to obtain a dark blue suspension. Subsequently, 50 mL of 0.03 M ascorbic acid solution is added dropwise to the suspension, and the mixture is stirred at a constant speed for 30 min. After standing for 1 h, the mixture is centrifuged to obtain brick-red particles, which are washed three times with deionized water and anhydrous ethanol, respectively. Finally, the particles are dried overnight in a vacuum oven at 60 °C to obtain Cu2O.
[0101] In this invention, the water is preferably deionized water; the amount of water used is not particularly important, as long as it is sufficient to disperse Cu₂O evenly. In this invention, the nitrate is preferably potassium nitrate; the mass ratio of Cu₂O to nitrate is preferably 2:1. In this invention, the nitrate is preferably added to the dispersion under stirring conditions. In this invention, the oxidation reaction time is preferably 1 hour; the oxidation reaction is preferably carried out under stirring conditions. The equation for the oxidation reaction is 3Cu₂O + 2NO₃. - →6CuO+2NO↑+O 2- .
[0102] In this invention, the solid-liquid separation is preferably performed by centrifugation. After the solid-liquid separation is completed, the resulting precipitate is preferably washed three times with deionized water and anhydrous ethanol, and then vacuum dried overnight at 60°C to obtain Cu2O@CuO.
[0103] After obtaining Cu2O@CuO, the present invention disperses Cu2O@CuO in a water-ethanol mixed solution, mixes the resulting dispersion with silver nitrate solution, performs a light irradiation reaction, and separates the solid and liquid to obtain Cu2O@CuO@Ag.
[0104] In this invention, the volume ratio of water to ethanol in the water-ethanol mixed solution is preferably 1:1. This invention does not have special requirements on the amount of the water-ethanol mixed solution used, as long as it is sufficient to disperse Cu₂O@CuO uniformly. In this invention, the dispersion is preferably carried out under ultrasonic conditions. This invention does not have special requirements on the concentration of the silver nitrate solution, but preferably the mass of Ag in the silver nitrate solution is 9-10% of the mass of Cu₂O@CuO, more preferably 10%.
[0105] In this invention, the photoreaction is preferably carried out in a photoreactor; the photoreaction is preferably provided by a 300W Xe lamp, and the photoreaction is preferably carried out under stirring conditions for 1 hour. This invention preferably maintains the reaction temperature at 10–20°C throughout the entire photoreaction process using circulating water. This invention attaches silver particles to Cu₂O@CuO via photodeposition.
[0106] In this invention, the solid-liquid separation is preferably performed by centrifugation. After the solid-liquid separation is completed, the resulting precipitate is preferably washed, then vacuum dried overnight at 60°C, and finally ground to obtain Cu2O@CuO@Ag powder.
[0107] The preparation method of the substrate electrode loaded with Cu2O@CuO@Ag layer is described below.
[0108] In this invention, Cu2O@CuO@Ag is dispersed in water to obtain a Cu2O@CuO@Ag suspension; the Cu2O@CuO@Ag suspension is then dropped onto the surface of a conductive substrate and dried and calcined to obtain a substrate electrode loaded with a Cu2O@CuO@Ag layer.
[0109] In this invention, the concentration of the Cu2O@CuO@Ag suspension is preferably 2 mg / mL.
[0110] In this invention, the conductive substrate is preferably ITO conductive glass. Before adding the Cu2O@CuO@Ag suspension to the surface of the conductive substrate, the conductive substrate is preferably first ultrasonically cleaned with acetone, ethanol and deionized water sequentially for 10 minutes, and then dried in nitrogen.
[0111] In this invention, the amount of Cu2O@CuO@Ag suspension preferably satisfies a Cu2O@CuO@Ag loading of 0.05–0.1 mg / cm³. 2 0.08 mg / cm³ is preferable, and more preferably 0.08 mg / cm³. 2 .
[0112] In this invention, the drying is preferably carried out at room temperature; the calcination temperature is preferably 180°C; and the calcination time is preferably 40 min. This invention loads Cu₂O@CuO@Ag onto the surface of a conductive substrate through calcination.
[0113] The photoelectrochemical sensor for detecting 5hmC-DNA provided by the present invention will be described below.
[0114] In this invention, the photoelectrochemical sensor for detecting 5hmC-DNA includes a substrate electrode loaded with a Cu2O@CuO@Ag layer, NH3-modified DNA strand H3, ethanethiol, the kit described in the above scheme, and ALP-H4 solution.
[0115] The substrate electrode with the Cu2O@CuO@Ag layer has been discussed above.
[0116] In this invention, the nucleotide sequence of the DNA chain H3 is shown in SEQ ID NO.7; specifically, the NH3-modified DNA chain H3 is CCTACCGGGAAGTCGCGTGTGTAGGATCCGAA TGCCTTT-NH3. In this invention, the NH3-modified DNA chain H3 is synthesized by Sangon Biotech (Shanghai) Co., Ltd. In this invention, the concentration of the NH3-modified DNA chain H3 is preferably 1 μM.
[0117] In this invention, the ALP-H4 in the ALP-H4 solution is Biotin-H4-Biotin, wherein the nucleotide sequence of H4 is as shown in SEQ ID NO.8, specifically ACAGCCGACTTCCCG, and ALP-H4 represents Biotin-ACACGCGACTTCCCG-Biotin.
[0118] In this invention, the ALP-H4 solution is preferably prepared by alkaline phosphatase-labeled streptavidin (1 mg·mL⁻¹). -1 Add to H4 (1 μM) buffer and incubate at room temperature for 90 min to form.
[0119] In this invention, the concentration of the ALP-H4 solution is preferably 1 μM.
[0120] In this invention, the photoelectrochemical sensor preferably further includes a MES buffer and a Tris buffer; the MES buffer preferably contains 1-ethyl-(3-dimethylaminopropyl)carbodiimide (EDC) and N-hydroxysuccinimide (NHS); the concentration of 1-ethyl-(3-dimethylaminopropyl)carbodiimide in the MES buffer is preferably 2 mg / mL, and the concentration of N-hydroxysuccinimide is preferably 50 mM; the pH value of the MES buffer is preferably 5-6, more preferably 5.5.
[0121] In this invention, the Tris buffer preferably contains L-ascorbic acid-2-phosphate trisodium, and the concentration of L-ascorbic acid-2-phosphate trisodium in the Tris buffer is preferably 100 mM; the pH value of the Tris buffer is preferably 7-8, more preferably 7.3.
[0122] This invention provides a method for detecting 5hmC-DNA for non-disease diagnostic purposes using the photoelectrochemical sensor described above, comprising the following steps:
[0123] The NH3-modified DNA strand H3 is heated to form a hairpin structure H3;
[0124] A hairpin-structured H3 is added to the surface of the substrate electrode loaded with Cu2O@CuO@Ag layer and bonded together to form H3 / Cu2O@CuO@Ag / conductive substrate;
[0125] Ethyl mercaptan was added to the surface of the H3 / Cu2O@CuO@Ag / conductive substrate for a second incubation to form an HT layer, thus obtaining the HT / H3 / Cu2O@CuO@Ag / conductive substrate; wherein HT is ethyl mercaptan.
[0126] The sample to be tested was pretreated using the kit according to the pretreatment method described above to obtain a sequence P solution;
[0127] The sequence P solution was added to the surface of the HT / H3 / Cu2O@CuO@Ag / conductive substrate and a third incubation was performed to form the P / HT / H3 / Cu2O@CuO@Ag / conductive substrate.
[0128] ALP-H4 solution was added to the surface of a P / HT / H3 / Cu2O@CuO@Ag / conductive substrate for a fourth incubation to form a photoelectrochemical sensor.
[0129] The photoelectrochemical sensor was placed in a Tris-HCl buffer solution containing L-ascorbic acid 2-phosphate for photocurrent testing. The photocurrent intensity was measured, and the content of 5hmC-DNA in the sample was calculated based on the linear relationship between the photocurrent intensity and the logarithm of the 5hmC-DNA concentration.
[0130] This invention involves heating and then cooling an NH3-modified DNA strand H3 to form a hairpin structure H3.
[0131] In this invention, the heating temperature is preferably 95°C, and the heating time is preferably 10 minutes. In this invention, the cooling rate is preferably 0.1°C·s. -1 The present invention preferably cools to 37°C. The hair clip structure is formed by heating.
[0132] After forming the hairpin structure H3, the present invention adds the hairpin structure H3 to the surface of the substrate electrode loaded with Cu2O@CuO@Ag layer and combines them to form H3 / Cu2O@CuO@Ag / conductive substrate.
[0133] Before adding the hairpin structure H3, this invention preferably activates the substrate electrode loaded with the Cu2O@CuO@Ag layer using MES buffer; the activation time is preferably 2 hours. This invention does not have special requirements for the specific activation procedure; the MES buffer is simply added dropwise to the surface of the substrate electrode loaded with the Cu2O@CuO@Ag layer, and then rinsed clean with PBS buffer after 2 hours.
[0134] In this invention, the volume ratio of H3 in the hairpin structure to the sequence P solution is preferably 1:1; the concentration of H3 in the hairpin structure is preferably 1 μM.
[0135] In this invention, the bonding temperature is preferably 37°C, and the bonding time is preferably 1.5 h. In this invention, the H3 chain is modified with -NH3, and -NH3 can combine with Ag particles on Cu2O@CuO@Ag through coordination bonds.
[0136] After the binding is completed, the present invention preferably rinses with PBS buffer to form H3 / Cu2O@CuO@Ag / conductive substrate.
[0137] After forming the H3 / Cu2O@CuO@Ag / conductive substrate, the present invention adds ethanethiol to the surface of the H3 / Cu2O@CuO@Ag / conductive substrate for a second incubation to form an HT layer, thereby obtaining the HT / H3 / Cu2O@CuO@Ag / conductive substrate; wherein HT is ethanethiol.
[0138] In this invention, the preferred temperature for the second incubation is 37°C, and the preferred time is 40 minutes. There are no special requirements for the amount of ethanethiol added in this invention; it is sufficient to achieve the purpose of blocking non-specific adsorption.
[0139] The present invention pre-treats the sample to be tested to obtain a sequence P solution; the method of pre-treatment has been described above and will not be repeated here.
[0140] In this invention, the sequence P solution is added to the surface of the HT / H3 / Cu2O@CuO@Ag / conductive substrate and subjected to a third incubation to form the P / HT / H3 / Cu2O@CuO@Ag / conductive substrate.
[0141] In this invention, the preferred amount of the P solution is 35–45 μL / cm³. 2 More preferably 40 μL / cm 2 In this invention, the preferred temperature for the third incubation is 37°C, and the preferred time is 1.5 hours. During this third incubation, the P sequence opens the H3 sequence on the hair follicle and hybridizes with the H3 strand for complementary pairing.
[0142] After the third incubation is completed, the present invention preferably uses PBS buffer to rinse away unreacted substances to obtain P / HT / H3 / Cu2O@CuO@Ag / conductive substrate.
[0143] After obtaining the P / HT / H3 / Cu2O@CuO@Ag / conductive substrate, the present invention adds ALP-H4 solution to the surface of the P / HT / H3 / Cu2O@CuO@Ag / conductive substrate for a fourth incubation.
[0144] In this invention, the preferred amount of ALP-H4 solution is 35–45 μL / cm³. 2 More preferably 40 μL / cm 2 In this invention, the preferred temperature for the fourth incubation is 37°C, and the preferred time is 1.5 hours. In this fourth incubation, the H4 chain and the H3 chain hybridize and pair complementaryly.
[0145] After completing the fourth incubation, the present invention preferably further includes adding Tris buffer to the surface of the formed ALP-H4 / P / HT / H3 / Cu2O@CuO@Ag / conductive substrate to improve the buffering capacity of the photoelectrochemical sensor.
[0146] In this invention, the preferred amount of Tris buffer is 35–45 μL / cm³. 2 More preferably 40 μL / cm 2 .
[0147] After forming the photoelectrochemical sensor, the present invention places the photoelectrochemical sensor in a Tris-HCl buffer containing L-ascorbic acid 2-phosphate trisodium salt for photocurrent testing, measures the photocurrent intensity, and calculates the content of 5hmC-DNA in the sample to be tested based on the linear relationship between the photocurrent intensity and the logarithm of the 5hmC-DNA concentration.
[0148] In this invention, the concentration of L-ascorbic acid trisodium 2-phosphate (AALP) in the Tris-HCl buffer is preferably 100 mM, the concentration of tris in the Tris-HCl buffer is preferably 0.1 M, and the pH value of the Tris-HCl buffer is preferably 7 to 7.5, more preferably 7.3.
[0149] In this invention, the preferred test conditions for the photocurrent intensity include: a bias voltage of 0V and a switching interval of 10s.
[0150] In this invention, the method for obtaining the linear relationship between the photocurrent intensity and the logarithm of the 5hmC-DNA concentration is the same as the method for detecting 5hmC-DNA, except that the sample to be tested is replaced with a standard sample with a known 5hmC-DNA concentration.
[0151] In this invention, the linear relationship between the photocurrent intensity and the logarithm of the 5hmC-DNA concentration is preferably expressed with the logarithm of the 5hmC concentration (Log C) as the abscissa and the photocurrent intensity as the ordinate.
[0152] In this invention, the flowchart of the method for detecting 5hmC-DNA for non-disease diagnostic purposes using the photoelectrochemical sensor described above is shown below. Figure 2 As shown (the conductive substrate is ITO conductive glass as an example).
[0153] This invention utilizes a photoelectrochemical analysis strategy based on a ternary heterojunction photocatalyst Cu2O@CuO@Ag. By leveraging the signal conversion output structure (P-sequence) and the amplification principle of the catalytic medium, it achieves dual amplification of the photoelectrochemical response signal, thereby improving the detection sensitivity.
[0154] Example 1
[0155] Step 1: Constructing signal transduction elements based on azidated 5hmC-DNA targets
[0156] 1) 5hmC-DNA target azide-glucose transfer treatment: The 5hmC labeling reaction was carried out in a 30 μL solution consisting of 9 μL 1×NE buffer, 1 μL 200 nM UDP-6-N3-Glu, 20 μL 2 μM 5hmC-DNA, and 0.1 μL 20 U / mL T4-β-GT, and reacted at 37 °C for 2 h. Subsequently, UDP-6-N3-Glu and enzyme were removed using a DNA purification kit. 20 μL of DBCO-modified primer (Yc) was added to the azide-labeled 5hmC solution, and a click chemistry reaction was performed, incubated at 37 °C for 24 h to form 5hmC-Yc.
[0157] 2) Preparation of Y-shaped scaffolds: 35 μL of each of Ya, Yb, and 5hmC-Yc (all at 5 μM before mixing) were mixed and hybridized at 37 °C for 2 h to prepare Y-shaped scaffolds. Subsequently, 100 μL of H1 (5 μM) and 100 μL of H2 (5 μM) were added, and the mixture was reacted at 37 °C for 2 h to assemble a hairpin-containing Y-shaped scaffold.
[0158] Output of the signal transduction element: 100 μL of 5 μM S1 was added to 100 μL of a hairpin Y-shaped scaffold, and the reaction was carried out at 37 °C for 2 h to induce a strand displacement reaction. Subsequently, a mixture containing 0.4 μL of KF DNA polymerase (100 U / mL), 5 μL of 500 μM deoxyribonucleotide triphosphate (dNTP), and 2.5 μL of Nt.BbvCI (500 U / mL) was incubated at 37 °C for 2 h to generate a large number of signal recognition-transduction element P sequences, which were then inactivated at 80 °C for 20 min to obtain the resulting P solution for the next step.
[0159] Step 2: Design of a photoelectrochemical sensor based on Cu2O@CuO@Ag composite
[0160] 1) Preparation of Cu₂O: First, 0.375 g of CuSO₄·5H₂O was added to 80 mL of 0.5 mM anhydrous sodium citrate, forming a light blue solution under vigorous stirring. Then, 20 mL of 1.25 M NaOH was added to the above solution, resulting in a dark blue suspension. Subsequently, 50 mL of 0.03 M ascorbic acid solution was added dropwise to the suspension, and the mixture was stirred at a constant speed for 30 min. After standing for 1 h, the mixture was centrifuged to obtain brick-red particles, which were washed three times with deionized water and anhydrous ethanol, respectively. Finally, the particles were dried overnight in a vacuum oven at 60 °C.
[0161] 2) Preparation of Cu2O@CuO: 100 mg of freshly prepared Cu2O was dispersed in 50 mL of deionized water. Then, 50 mg of potassium nitrate was dissolved in the suspension under vigorous stirring for 1 h. The precipitate was collected by centrifugation and washed three times with deionized water and anhydrous ethanol. Subsequently, it was vacuum dried overnight at 60 °C to obtain a dark red powder.
[0162] 3) Preparation of Cu2O@CuO@Ag: 100 mg Cu2O@CuO was dispersed in 100 mL of a mixture of deionized water and anhydrous ethanol (volume ratio 1:1) under ultrasonication. Then, 157.4 μL of AgNO3 solution (0.1 g / mL) was added to the suspension, with the added Ag content approximately equal to the Cu2O@CuO content. The mixture was transferred to a photoreactor, illuminated by a 300 W Xe lamp. The reaction temperature was maintained at approximately 15 °C throughout the process using circulating water, and the reaction was initiated with stirring for 1 h. Finally, the precipitate was collected by centrifugation, washed, and dried overnight in a vacuum oven at 60 °C. The final product was a brown Cu2O@CuO@Ag powder obtained by grinding (SEM image shown). Figure 3 As shown, Ag is located on the Cu2O@CuO surface.
[0163] Step 3: Assembly of the photoelectrochemical sensor based on the ternary heterojunction photocatalyst Cu2O@CuO@Ag composite
[0164] 1) The ITO conductive glass was ultrasonically cleaned sequentially with acetone, ethanol, and deionized water for 10 min, dried in nitrogen, and the conductive area of the electrode was fixed with insulating tape to a size of 5 mm × 5 mm. 2 mg of Cu2O@CuO@Ag powder was ultrasonically dispersed in 1 mL of ultrapure water to obtain a 2 mg / mL Cu2O@CuO@Ag suspension. 10 μL of the Cu2O@CuO@Ag suspension was added dropwise to the surface of the ITO electrode. After drying at room temperature, the electrode was calcined in a muffle furnace at 180 °C for 40 min to obtain an ITO electrode covered with a Cu2O@CuO@Ag film. 6 μL of MES buffer (containing 2 mg / mL EDC and 50 mM NHS, pH 5.5) was applied to the electrode surface for activation for 2 h.
[0165] 2) Non-specific adsorption was blocked by incubation with 10 μL of 0.1 mM ethanethiol (HT) for 40 min. H3 (1 μM) was heated at 95 °C for 10 min, and the temperature was increased at 0.1 °C·s⁻¹. -1 The electrode was cooled to 37°C at a rate that formed a hairpin structure. Then, 10 μL of H3 (1 μM) was added to the electrode (Cu2O@CuO@Ag / ITO), and hybridization was performed at 37°C for 1.5 h to form H3 / Cu2O@CuO@Ag / ITO. Subsequently, 10 μL of LP solution was added and incubated at 37°C for 1.5 h to form P / H3 / Cu2O@CuO@Ag / ITO. 10 μL of 1 μM LP-H4 solution was added to P / H3 / Cu2O@CuO@Ag / ITO, and incubation was performed at 37°C for 1.5 h. Then, 10 μL of Tris buffer (pH 7.4) containing 100 mM L-ascorbic acid-2-phosphate trisodium (ALP) was added to obtain the photoelectrochemical sensor (PEC) used in the experiment.
[0166] Electrochemical impedance spectroscopy (EIS) was measured using a CHI660E electrochemical workstation with a three-electrode system: an ITO electrode as the working electrode (different substances were fixed on the ITO surface to form the working electrode), a platinum wire electrode as the counter electrode, and Ag / AgCl as the reference electrode. EIS was measured in a 5 mM K3Fe(CN)6 / K4Fe(CN)6 solution containing 0.1 M KCl, with a frequency range of 5 × 10⁻⁶. -2 Up to 1×10 6 Hz, open-circuit voltage amplitude is 10mV. The results are as follows: Figure 6 As shown. Figure 6 In the diagram, a represents ITO; b represents Cu₂O@CuO@Ag / ITO; c represents H₃ / Cu₂O@CuO@Ag / ITO; d represents HT / H₃ / Cu₂O@CuO@Ag / ITO; e represents P / HT / H₃ / Cu₂O@CuO@Ag / ITO; and f represents H₄ / P / HT / H₃ / Cu₂O@CuO@Ag / ITO. Figure 6 It can be seen that the resistance (Ret) of the blank ITO electrode (curve a) is relatively small. When Cu2O@CuO@Ag is fixed on the electrode surface (curve b), Ret increases significantly. Subsequently, when H3, HT, P and H4 are added in sequence, Ret gradually increases (curve cf), indicating that the sensor has been successfully fabricated.
[0167] PEC was measured in 15 mL of 0.1 M Tris-HCl buffer (containing 100 mM L-ascorbic acid 2-phosphate trisodium salt (AAP)), with a bias voltage of 0 V and a switching interval of 10 s.
[0168] The photocurrent intensity of 5hmC-DNA at different known concentrations was tested according to the above test method, and the results are shown in [Figure number missing]. Figure 4 The standard curve is shown in [reference]. Figure 5 . Figure 4 In the curves, from a to j, the 5hmC concentrations are 1 μM, 100 nM, 10 nM, 1 nM, 100 pM, 10 pM, 1 pM, 100 fM, 10 fM, and 1 fM, respectively. Figure 4 It can be seen that as the concentration of 5hmC decreases from 1μm to 1fM, the ECL intensity gradually decreases (curve a to curve g); the standard curve shows that there is a linear relationship between the ECL intensity (I) and the logarithm (Log C) of the 5hmC concentration, and the linear regression equation is expressed as I = 0.12LogC + 2.24, with a detection limit of 0.42fM (S / N = 3).
[0169] Specificity test:
[0170] The target 5hmC-DNA in the above experiment was replaced with 5mC-DNA and C-DNA. The nucleotide sequence of the CD-DNA is shown in SEQ ID NO.9, specifically: CGGATGTTGTGGGTCAGC GCATCATACTCTA. The nucleotide sequence of the 5hmC-DNA was obtained by replacing the 18th bold C with 5hmC; the nucleotide sequence of the 5mC-DNA was obtained by replacing the 18th bold C with 5mC. The remaining detection steps remained unchanged. The experimental results are as follows: Figure 7 As shown. By Figure 7 It is evident that in the azide DNA process, 100 nM 5hmC-DNA is replaced by the same concentration of different DNAs (5mC-DNA, C-DNA). The electrode fabrication and detection procedures are kept consistent to ensure comparable experimental conditions. By comparing the photocurrent values of different DNAs on the electrodes, the selectivity of this detection method for different DNA molecules can be evaluated. Figure 7As shown, the photocurrent of 5 hmC-DNA and the mixed substance (containing 100 nM 5 hmC-DNA, 100 nM 5 mC-DNA and 100 nM DNA) was significantly higher than that of other DNAs, indicating that the method has good detection selectivity for 5 h mC-DNA (Note: no substance was added to the blank group).
[0171] The above description is only a preferred embodiment of the present invention. It should be noted that for those skilled in the art, several improvements and modifications can be made without departing from the principle of the present invention, and these improvements and modifications should also be considered within the scope of protection of the present invention.
Claims
1. A photoelectrochemical sensor for detecting 5hmC-DNA, characterized in that, Includes a substrate electrode loaded with Cu2O@CuO@Ag layers, NH3-modified DNA strand H3, ethanethiol, a kit for 5hmC-DNA pretreatment, and ALP-H4 solution; The nucleotide sequence of the DNA chain H3 is shown in SEQ ID NO.7; The ALP-H4 in the ALP-H4 solution is Biotin-H4-Biotin, wherein the nucleotide sequence of the H4 is shown in SEQ ID NO.8; The kit for 5hmC-DNA pretreatment includes: NE buffer, uridine diphosphate-6-azido-glucose solution, T4 phage β-glucose transferase, DBCO-modified primer Yc, DNA strand Ya, DNA strand Yb, DNA strand H1, DNA strand H2, DNA strand S1, deoxynucleotide triphosphate solution, DNA polymerase, and nicking endonuclease. The nucleotide sequence of the primer Yc is shown in SEQ ID NO.1; The nucleotide sequence of the DNA chain Ya is shown in SEQ ID NO.2; The nucleotide sequence of the DNA chain Yb is shown in SEQ ID NO.3; The nucleotide sequence of the DNA chain H1 is shown in SEQ ID NO.4; The nucleotide sequence of the DNA strand H2 is shown in SEQ ID NO.5; The nucleotide sequence of the DNA chain S1 is shown in SEQ ID NO.
6.
2. The photoelectrochemical sensor according to claim 1, characterized in that, The method for preparing the substrate electrode loaded with Cu2O@CuO@Ag layers includes: dispersing Cu2O@CuO@Ag in water to obtain a Cu2O@CuO@Ag suspension; adding the Cu2O@CuO@Ag suspension dropwise onto the surface of a conductive substrate and then drying and calcining it to obtain the substrate electrode loaded with Cu2O@CuO@Ag layers.
3. The photoelectrochemical sensor according to claim 1, characterized in that, It also includes MES buffer and Tris buffer; The MES buffer contains 1-ethyl-(3-dimethylaminopropyl)carbodiimide and N-hydroxysuccinimide; The Tris buffer contains L-ascorbic acid-2-phosphate trisodium.
4. A method for detecting 5hmC-DNA for non-disease diagnostic purposes using the photoelectrochemical sensor according to any one of claims 1 to 3, characterized in that, Includes the following steps: The NH3-modified DNA strand H3 was heated and then cooled to form a hairpin structure H3. A hairpin-structured H3 is added to the surface of the substrate electrode loaded with Cu2O@CuO@Ag layer and bonded together to form H3 / Cu2O@CuO@Ag / conductive substrate; Ethyl mercaptan was added to the surface of the H3 / Cu2O@CuO@Ag / conductive substrate for a second incubation to form an HT layer, thus obtaining the HT / H3 / Cu2O@CuO@Ag / conductive substrate; wherein HT is ethyl mercaptan. The samples to be tested were pretreated using a 5hmC-DNA pretreatment kit to obtain sequence P solution; The sequence P solution was added to the surface of the HT / H3 / Cu2O@CuO@Ag / conductive substrate and a third incubation was performed to form the P / HT / H3 / Cu2O@CuO@Ag / conductive substrate. ALP-H4 solution was added to the surface of a P / HT / H3 / Cu2O@CuO@Ag / conductive substrate for a fourth incubation to form a photoelectrochemical sensor. The photoelectrochemical sensor was placed in a Tris-HCl buffer solution containing L-ascorbic acid 2-phosphate trisodium salt for photocurrent testing. The photocurrent intensity was measured, and the content of 5hmC-DNA in the sample to be tested was calculated based on the linear relationship between the photocurrent intensity and the logarithm of the 5hmC-DNA concentration. The preprocessing includes the following steps: NE buffer, uridine diphosphate-6-azido-glucose solution, T4 phage β-glucose transferase and 5hmC-DNA sample to be treated were mixed, and the resulting mixture was subjected to azidation reaction at 37℃ to obtain azidated 5hmC solution. The azide-labeled 5hmC solution was mixed with DBCO-modified primer Yc and a click chemistry reaction was carried out at 37°C to obtain 5hmC-Yc. The 5hmC-Yc, DNA strand Ya and DNA strand Yb were mixed and hybridized at 37°C to obtain a Y-shaped scaffold. The Y-shaped scaffold was mixed with DNA strand H1 and DNA strand H2 and assembled at 37°C to form a Y-shaped scaffold containing hairpins. The hairpin-containing Y-shaped scaffold was mixed with DNA strand S1, and a strand displacement reaction was carried out at 37°C. The resulting reaction solution was mixed with deoxynucleotide triphosphate, DNA polymerase and nicking endonuclease, and incubated for the first time at 37°C to obtain sequence P solution.
5. The method according to claim 4, characterized in that, The molar ratio of 5hmC-Yc, DNA strand Ya, and DNA strand Yb is 1:1:1; The molar ratio of the Y-shaped scaffold to DNA strand H1 and DNA strand H2 is 1:1:
1.
6. The method according to claim 4, characterized in that, Before adding the hairpin structure H3 to the substrate electrode surface loaded with Cu2O@CuO@Ag layer, the substrate electrode loaded with Cu2O@CuO@Ag layer is activated using MES buffer.
7. The method according to claim 4, characterized in that, After the fourth incubation is completed, Tris buffer is added to the surface of the formed ALP-H4 / P / HT / H3 / Cu2O@CuO@Ag / conductive substrate.
8. The method according to claim 4, characterized in that, The bonding temperature was 37°C and the time was 1.5 h.
Citation Information
Patent Citations
Photoelectric chemical analysis method for detection of 5-hydroxymethylcytosine based on black titanium dioxide
CN109709170A
Compositions and methods for increasing resolution of 5-hydroxymethylated cytosine in nucleic acid sequencing
CN118265801A