Application of hsacirc0055038 in diagnosis and treatment of esophageal cancer

Abstract

The invention discloses a circRNA (Ribonucleic Acid) marker for diagnosing and treating esophageal cancer and application of the circRNA marker, and belongs to the technical field of biology. The inventor finds that the expression of the circular RNA hsacirc0055038 in the plasma of an esophageal cancer patient is remarkably different from that of a healthy person through research, and the expression of the circular RNA hsacirc0055038 in the plasma of the esophageal cancer patient is remarkably increased, so that the circular RNA hsacirc0055038 can be used as an esophageal cancer diagnosis marker and can be used for well predicting the occurrence of the esophageal cancer. Besides, after the expression of the hsacirc0055038 is knocked down, the multiplication capacity of esophageal cancer cells can be remarkably inhibited, so that the hsacirc0055038 circular RNA gene can be used as a potential target spot for treating esophageal cancer, and a reagent for detecting the circ0055038 can be used in a product for diagnosing or treating cancer.

Description

Technical Field

[0001] The present invention belongs to the field of biotechnology, and specifically relates to a circRNA for diagnosis and treatment of esophageal cancer and application thereof. Background Art

[0002] Esophageal cancer is a highly malignant digestive tract tumor with a poor prognosis. The median survival period is generally less than one year, and the 5-year survival rate of patients in the middle and late stages is between 20% and 30%. The 2020 global cancer statistics released by the International Agency for Research on Cancer under the World Health Organization show that the global incidence and mortality of esophageal cancer have remained high, still ranking seventh and sixth respectively. my country is one of the high-incidence areas of esophageal cancer in the world, with an average of about 150,000 deaths each year. There are more male patients than female patients, and the age of onset is mostly over 40 years old. The best treatment for esophageal cancer is surgery, but a considerable number of patients will still relapse. The early clinical symptoms of esophageal cancer are hidden, and more than 50% of patients have progressed to the middle and late stages at the time of initial diagnosis and cannot undergo surgical treatment. At this stage, the diagnosis and treatment of esophageal cancer still face huge challenges, and the poor prognosis of patients will continue. Therefore, it is urgent to find targets and prognostic markers for the diagnosis and treatment of esophageal cancer.

[0003] In recent years, with the innovation of molecular biology research technology, the role and biological function of non-coding RNA have been further explored. At present, a large number of studies have confirmed that non-coding RNA can regulate the progression of tumors at multiple important nodes such as epigenetics, transcriptional level, and post-transcriptional level. More and more studies have shown that non-coding RNA is related to the occurrence and development of esophageal cancer. Therefore, by discovering non-coding RNA related to the occurrence and prognosis of esophageal cancer, we can know the diagnosis and treatment of esophageal cancer and greatly improve the prognosis of patients with advanced esophageal cancer, which will have a significant impact on the prevention and treatment of esophageal cancer in my country.

[0004] Circular RNA (circRNA) is a type of non-coding RNA molecule that forms a circular structure with covalent bonds. Unlike other ncRNAs, it lacks a 5' end cap and a 3' end poly (A) tail. CircRNAs are located in the cytoplasm and widely exist. Their expression is more stable and not easily degraded by RNase. The main functions of circRNA are: (1) CircRNA acts as a miRNA "sponge" by competing for binding to related miRNAs, affecting the effect of the miRNA on the target mRNA. (2) CircRNA participates in protein translation. (3) CircRNA exerts biological functions by regulating genes. In recent years, research on circRNA in human diseases has shown explosive growth. CircRNA can directly participate in regulating the occurrence and development of pathology in digestive system tumors. CircRNA has the characteristics of high stability, tissue specificity, and functional diversity. Given its stability and specific expression, it is more stable in serum and therefore has greater potential as a diagnostic marker and therapeutic target for diseases.

[0005] Therefore, by studying circRNA, it is expected to overcome the technical difficulties in the early diagnosis of esophageal cancer and further provide new therapeutic directions for the diagnosis and treatment of esophageal cancer. Summary of the invention

[0006] The purpose of the present invention is to provide a circRNA for the diagnosis and treatment of esophageal cancer and its application. The inventors found that the expression level of the hsa_circ_0055038 circular RNA gene was significantly reduced in samples of esophageal cancer patients, which suggests that the circular RNA gene can be used as a marker and can be further used in the diagnosis and treatment of esophageal cancer.

[0007] The present invention is achieved through the following technical solutions:

[0008] In a first aspect, the present invention provides a circRNA marker for the diagnosis and treatment of esophageal cancer, wherein the circRNA marker is hsa_circ_0055038 with a nucleotide sequence as shown in SEQ ID No.1.

[0009] hsa_circ_0055038 is located in the gene GFPT1 (hsa_circ_0055038 consists of seven exons 12, 13, 14, 15, 16, 17, and 18, with a total length of 884 nt). After amplification, the circular sequence of hsa_circ_0055038 was confirmed by first-generation Sanger sequencing. The full length of hsa_circ_0055038 is 884 bases, and the full-length sequence is:

[0010] GCAACTTCAGTTCATTTATGCAGAAGGAAATATTTGAGCAGCCAGAGTCTGTCGTGAACACAATGAGA

[0011] GGAAGAGTCAACTTTGATGACTATAACTGTGAATTTGGGTGGTTTGAAGGATCACATAAAGGAGATCCA

[0012] GAGATGCCGGCGTTTGATTCTTATTGCTTGTGGAACAAGTTACCATGCTGGTGTAGCAACACGTCAAG

[0013] TTCTTGAGGAGCTGACTGAGTTGCCTGTGATGGTGGAACTAGCAAGTGACTTCCTGGACAGAAAACACA

[0014] CCAGTCTTTCGAGATGATGTTTGCTTTTTCCTTAGTCAATCAGGTGAGACAGCAGATACTTTGATGGG

[0015] TCTTCGTTACTGTAAGGAGAGAGGAGCTTTAACTGTGGGGATCACAAACACAGTTGGCAGTTCCATAT

[0016] CACGGGAGACAGATTGTGGAGTTCATATTAATGCTGGTCCTGAGATTGGTGTGGCCAGTACAAAGGCT

[0017] TATACCAGCCAGTTTGTATCCCCTTGTGATGTTTGCCCTTATGATGTGTGATGATCGGATCTCCATGCA

[0018] AGAAAGACGCAAAGAGATCATGCTTGGATTGAAACGGCTGCCTGATTTGATTAAGGAAGTACTGAGCA

[0019] TGGATGACGAAATTCAGAAACTAGCAACAGAACTTTATCATCAGAAGTCAGTTCTGATAATGGGACGA

[0020] GGCTATCATTATGCTACTTGTCTTGAAGGGGCACTGAAAATCAAAGAAATTACTTATATGCACTCTGA

[0021] AGGCATCCTTGCTGGTGAATTGAAACATGGCCCTCTGGCTTTGGTGGATAAATTGATGCCTGTGATCA

[0022] TGATCATCATGAGAGATCACACTTATGCCAAGTGTCAGAATGCTCTTCAGCAAGTGGTTGCTCGCAG (SEQ ID No. 1).

[0023] In a second aspect, the present invention provides a primer set for the above-mentioned circRNA marker, the primer set comprising a forward primer and a reverse primer;

[0024] The nucleotide sequence of the forward primer is shown in SEQ ID NO.2: CTGAGTTGCCTGTGATGGTG;

[0025] The nucleotide sequence of the reverse primer is shown in SEQ ID NO.3: TGGTGTGTTTCTGTCCAGGA.

[0026] Specifically, the forward primer and reverse primer of the internal reference GAPDH are also included:

[0027] Internal reference GAPDH Primer F:GGAGCGAGATCCCTCCAAAAT (SEQ ID NO.4);

[0028] Internal reference GAPDH Primer R: GGCTGTTGTCATACTTCTCATGG (SEQ ID NO. 5).

[0029] In a third aspect, the present invention provides a use of the above-mentioned circRNA marker in the preparation of a product for diagnosing or treating esophageal cancer.

[0030] In a third aspect, the present invention provides a reagent for detecting the above-mentioned circRNA marker and its use in preparing a product for diagnosing or treating esophageal cancer.

[0031] Further, in a preferred embodiment of the present invention, the above reagent is selected from: a probe, a gene chip or a detection primer set having detection specificity for a circRNA marker;

[0032] Preferably, the detection primer set includes a forward primer and a reverse primer, the nucleotide sequence of the forward primer is shown as SEQ ID NO.2, and the nucleotide sequence of the reverse primer is shown as SEQ ID NO.3.

[0033] Furthermore, in a preferred embodiment of the present invention, the above reagents also include RNA extraction reagents, reverse transcription reaction system and fluorescent quantitative PCR reagents.

[0034] Furthermore, in a preferred embodiment of the present invention, the above-mentioned product includes a chip, a kit or a nucleic acid membrane strip.

[0035] In a fourth aspect, the present invention provides a kit for diagnosing or treating esophageal cancer, the kit comprising a specific primer set for the circRNA marker in claim 1;

[0036] Preferably, the primer set includes a forward primer and a reverse primer, the nucleotide sequence of the forward primer is shown as SEQ ID NO.2, and the nucleotide sequence of the reverse primer is shown as SEQ ID NO.3;

[0037] In a fifth aspect, the present invention provides a use of the above-mentioned circRNA marker expression inhibitor in the preparation of a drug for treating esophageal cancer.

[0038] In a sixth aspect, the present invention provides a drug for treating esophageal cancer, the active ingredient of which includes an expression inhibitor of a circRNA marker as claimed in claim 1.

[0039] Compared with the prior art, the present invention has at least the following technical effects:

[0040] The inventors found that the expression of circular RNA hsa_circ_0055038 in the plasma of esophageal cancer patients and healthy people was significantly different. The expression of hsa_circ_0055038 in the plasma of esophageal cancer patients was significantly increased, which showed that hsa_circ_0055038 can be used as a diagnostic marker for esophageal cancer. It is significantly increased in the serum of esophageal cancer patients and can well predict the occurrence of esophageal cancer.

[0041] The inventors further found that after silencing the expression of hsa_circ_0055038, the proliferation and invasion abilities of esophageal cancer cells could be significantly inhibited, indicating that the hsa_circ_0055038 circular RNA gene could be used as a potential target for the treatment of esophageal cancer. BRIEF DESCRIPTION OF THE DRAWINGS

[0042] Figure 1 This is the identification diagram of the circular hsa_circ_0055038 in Example 1 of the present invention;

[0043] Figure 2 The fluorescence quantitative PCR detection result of hsa_circ_0055038 in Example 2 of the present invention;

[0044] Figure 3 This is a graphical representation showing that hsa_circ_0055038 has good marker performance in esophageal cancer serum in Example 2 of the present invention;

[0045] Figure 4 This is a graphical representation of the experimental results of hsa_circ_0055038 on cell proliferation in Example 3 of the present invention. DETAILED DESCRIPTION

[0046] The embodiments of the present invention will be described in detail below in conjunction with examples. However, those skilled in the art will understand that the following examples are only used to illustrate the present invention and should not be construed as limiting the scope of the present invention. The specific conditions not specified in the examples are carried out according to conventional conditions or conditions recommended by the manufacturer. The reagents or instruments used without indicating the manufacturer are all conventional products that can be purchased commercially.

[0047] The specific embodiments of the present invention are described in detail below. It should be understood that the specific embodiments described herein are only used to illustrate and explain the present invention, and are not used to limit the present invention.

[0048] Example 1

[0049] Identification of hsa_circ_0055038

[0050] 1. RNA extraction (Trizol method)

[0051] (1) Add 1 ml of trizol to the plasma of esophageal cancer patients and healthy subjects, mix thoroughly by pipetting, and let stand at room temperature for 5 min (to completely separate the nucleic acid-protein complex).

[0052] (2) Add 200 μL of chloroform, shake vigorously for 10 seconds, and let stand at room temperature for 10 minutes;

[0053] (3) Centrifuge at 12,000 g for 10 min at 4°C. The solution is separated into three layers. RNA is dissolved in the aqueous phase. The aqueous phase is transferred to another new RNase-free EP tube.

[0054] (4) Add 1 volume of isopropanol, vortex to mix thoroughly, and let stand at room temperature for 10 min;

[0055] (5) Centrifuge at 12,000 g for 15 min at 4°C. RNA precipitate will appear at the bottom of the tube after centrifugation. Discard the supernatant.

[0056] (6) Add 1 ml of 75% ethanol, gently invert by hand, centrifuge at 7500 g for 10 min at 4°C, and discard the supernatant;

[0057] (7) Dry at room temperature and add 20 μL of DEPC water to dissolve the precipitate.

[0058] 2. Genomic DNA Removal

[0059] To remove the residual genomic DNA in the total RNA, DNA digestion enzyme was used. The specific reaction system and conditions were as follows. The total volume of the reaction solution was 10 μL, and the following components were used:

[0060] RNA 6μL (3μg) DNaseI 1μL 10Xbuffer 1μL <![CDATA[RNAfreeH2O]]> 2μL

[0061] The reaction solution was digested at 37°C for 40 min and then inactivated by heating at 85°C for 3 min.

[0062] 3. Reverse transcription of RNA into cDNA

[0063] The reaction system and conditions for reverse transcription of RNA into cDNA are as follows

[0064] Total RNA 2μg Random Primers 0.5μL 2XRTMix 5μL RTEnzymeMix 1μL <![CDATA[RNAfreeddH2O]]> Make up to 10 μL

[0065] The reaction conditions were: 37°C for 10 min, 42°C for 20 min, 85°C for 5 min, and 4°C for 2 min.

[0066] 4. Design reverse amplification PCR primers to amplify the circRNA interface and flanking sequence DNA sequencing verification

[0067] According to some reference sequences provided in the Circbase database, the primers for reverse PCR amplification were designed to amplify the interface and flanking sequences of hsa_circ_0055038:

[0068]

[0069] The size of the partial sequence of circular RNA hsa_circ_0055038 amplified by primers is 884 bp. hsa_circ_0055038 is located in the gene GFPT1 (hsa_circ_0055038 consists of seven exons 12, 13, 14, 15, 16, 17, and 18, with a total length of 884 nt). After amplification, the circular sequence of hsa_circ_0055038 was confirmed by first-generation Sanger sequencing (such as Figure 1 The full length of hsa_circ_0055038 is 884 bases, and the full-length sequence is:

[0070] GCAACTTCAGTTCATTTATGCAGAAGGAAATATTTGAGCAGCCAGAGTCTGTCGTGAACACAATGAGA

[0071] GGAAGAGTCAACTTTGATGACTATAACTGTGAATTTGGGTGGTTTGAAGGATCACATAAAGGAGATCCA

[0072] GAGATGCCGGCGTTTGATTCTTATTGCTTGTGGAACAAGTTACCATGCTGGTGTAGCAACACGTCAAG

[0073] TTCTTGAGGAGCTGACTGAGTTGCCTGTGATGGTGGAACTAGCAAGTGACTTCCTGGACAGAAAACACA

[0074] CCAGTCTTTCGAGATGATGTTTGCTTTTTCCTTAGTCAATCAGGTGAGACAGCAGATACTTTGATGGG

[0075] TCTTCGTTACTGTAAGGAGAGAGGAGCTTTAACTGTGGGGATCACAAACACAGTTGGCAGTTCCATAT

[0076] CACGGGAGACAGATTGTGGAGTTCATATTAATGCTGGTCCTGAGATTGGTGTGGCCAGTACAAAGGCT

[0077] TATACCAGCCAGTTTGTATCCCCTTGTGATGTTTGCCCTTATGATGTGTGATGATCGGATCTCCATGCA

[0078] AGAAAGACGCAAAGAGATCATGCTTGGATTGAAACGGCTGCCTGATTTGATTAAGGAAGTACTGAGCA

[0079] TGGATGACGAAATTCAGAAACTAGCAACAGAACTTTATCATCAGAAGTCAGTTCTGATAATGGGACGA

[0080] GGCTATCATTATGCTACTTGTCTTGAAGGGGCACTGAAAATCAAAGAAATTACTTATATGCACTCTGA

[0081] AGGCATCCTTGCTGGTGAATTGAAACATGGCCCTCTGGCTTTGGTGGATAAATTGATGCCTGTGATCA

[0082] TGATCATCATGAGAGATCACACTTATGCCAAGTGTCAGAATGCTCTTCAGCAAGTGGTTGCTCGGCAG(SEQ ID NO.1)

[0083] Example 2

[0084] Fluorescence quantitative PCR detection of hsa_circ_0055038

[0085] The method for detecting the expression of circular RNA hsa_circ_0055038 molecules in the plasma of esophageal cancer patients and healthy subjects by fluorescence quantitative PCR amplification is as follows:

[0086] Total RNA was extracted according to the method described in Example 1, and the residual genomic DNA in the extracted RNA was removed by DNase, and the RNA was reverse transcribed into cDNA; finally, fluorescence quantitative PCR amplification was used for detection, and the primer sequences of fluorescence quantitative PCR are shown in SEQ ID NO.2-5.

[0087] Fluorescence quantitative PCR amplification to detect the expression of circular RNA hsa_circ_0055038 molecules in the plasma of esophageal cancer patients and healthy subjects. The reaction system and reaction conditions are as follows:

[0088] cDNA 1μL Upstream primer (10 μM) 0.2μL Downstream primer (10 μM) 0.2μL 2XPCRMasterMix 10μL RNAfreeddH2O Make up to 20 μL

[0089] The reaction conditions of fluorescence quantitative PCR were as follows: denaturation at 95°C for 5 minutes; 95°C for 10 seconds, and 60°C for 35 seconds; and 40 cycles.

[0090] Fluorescence quantitative PCR was used to detect the expression of circular RNA hsa_circ_0055038 in the plasma of esophageal cancer patients and healthy subjects. Figure 2 and Figure 3 As shown:

[0091] Depend on Figure 2 It can be seen that the expression level of hsa_circ_0055038 in the plasma of esophageal cancer patients is significantly increased compared with that in the plasma of healthy people.

[0092] Depend on Figure 3It can be seen that the AUC for esophageal cancer is 0.9744, indicating that hsa_circ_0055038 can be used as a tumor diagnostic marker, indicating that hsa_circ_0055038 is significantly increased in esophageal cancer serum and can well predict the occurrence of tumors.

[0093] The fluorescent quantitative PCR detection method of the present invention can ideally detect the expression of circular RNA hsa_circ_0055038 in an organism.

[0094] Example 3

[0095] CCK8 assay to detect the effect of hsa_circ_0055038 on cell proliferation

[0096] Esophageal cancer cell lines KYSE30 and KYSE1500 in logarithmic growth phase were cultured at 2×10 4The cell suspension of 100 cells / mL was inoculated into a six-well plate, and the culture plate was cultured in an incubator for 24 hours (37°C, 5% CO2). In order to study the function of hsa_circ_0055038, the hsa_circ_0055038 shRNA expression vector was first constructed to effectively inhibit the expression of hsa_circ_0055038 in esophageal cancer cell lines KYSE30 and KYSE150. Control refers to the group that was transfected with an empty plasmid when transfecting cells, that is, the control group; hsa_circ_0055038 refers to the group transfected with hsa_circ_0055038 shRNA vector. Take out the six-well plate, discard the old culture medium, replace it with 1.5mL of serum-free culture medium, and prepare it as a cell plate for liposome transfection. Add 250uL of serum-free MEM culture medium to a sterile 1.5mL EP tube, then add 5uL of Lipofectamine2000, mix gently, and place at room temperature for 5 minutes. Add 250uL of serum-free MEM medium to a sterile 1.5mL EP tube, then add 5uL of hsa_circ_0055038inhibitor solution and mix well. Mix the solutions in the above two EP tubes together and place at room temperature for 20 minutes. Add 500uL of the mixture to the above six-well plate cells, shake well, and culture in a cell culture incubator at 37°C and 5% CO2. After 6h, change to 1640 medium containing 10% FBS and culture for 48 hours. Take out the esophageal cancer cell lines KYSE30 and KYSE150 cells in the logarithmic growth phase that have been transfected for 24 hours in the six-well plate, pour out the old medium, wash the cells with PBS, add an appropriate amount of trypsin to digest the cells, add 1640 medium containing 10% FBS to resuspend the cells, and terminate digestion. Count the number of cells with a hemocytometer, add 100uL of cell suspension to a 96-well plate, and inoculate about 1000 cells in the 96-well plate. Set up well plates and control groups, with 3-5 replicate wells in each group. Place in an incubator and continue culturing. Take out a 96-well plate for testing at 0 hours (6 hours after plating, cells are completely attached to the wall and positioned at 0 hours), 24 hours, 48 ​​hours, and 72 hours. Add 10uL of CCK-8 reagent to each well, shake gently and place in a 37°C incubator. Timing for one hour. Use an enzyme marker to measure the absorbance at a wavelength of 450nm. Analyze the data based on the absorbance values ​​obtained, draw a cell growth curve, and evaluate the effect of hsa_circ_0055038 silencing on cell proliferation.

[0097] After silencing the expression of hsa_circ_0055038 in esophageal cancer cell lines KYSE30 and KYSE150, the cell proliferation ability was detected by CCK8 assay. Figure 4 As shown, this indicates that the growth of esophageal cancer cells is significantly inhibited, and the inhibition rates are:

[0098] The cell line KYSE30 is 56%; the cell line KYSE150 is 44%.

[0099] In summary, the present invention provides a circRNA marker for the diagnosis and treatment of esophageal cancer, namely, the hsa_circ_0055038 circular RNA gene. The inventor detected by fluorescence quantitative PCR that the expression of the circular RNA gene in the serum of esophageal cancer patients was significantly increased compared with that of healthy people, which shows that the circRNA marker can predict the occurrence of esophageal cancer and can be used as a diagnostic marker for esophageal cancer. Further, the effect of hsa_circ_0055038 on cell proliferation was detected by CCK8 experiment. The results showed that after hsa_circ_0055038 was silenced in esophageal cancer cell lines KYSE30 and KYSE150, the growth of esophageal cancer cells was significantly inhibited. This shows that hsa_circ_0055038 can be used as a marker for the diagnosis of esophageal cancer and as a potential target for the treatment of esophageal cancer. The reagent for detecting hsa_circ_0055038 can be used in products for the diagnosis or treatment of cancer, such as chips, kits or nucleic acid membrane strips.

[0100] Finally, it should be noted that the above description is only a preferred embodiment of the present invention and is not intended to limit the protection scope of the present invention. Any modification, equivalent replacement, improvement, etc. made within the spirit and principle of the present invention shall be included in the protection scope of the present invention.

Claims

1. A circRNA marker for diagnosis and treatment of esophageal cancer, characterized in that: The circRNA marker is hsa_circ_0055038 whose nucleotide sequence is shown in SEQ ID No.

1.

2. A primer set for a circRNA marker according to claim 1, characterized in that: The primer set includes a forward primer and a reverse primer; The nucleotide sequence of the forward primer is shown in SEQ ID NO.2; The nucleotide sequence of the reverse primer is shown in SEQ ID NO.

3.

3. Use of the circRNA marker as claimed in claim 1 in preparing a product for diagnosing or treating esophageal cancer.

4. Use of a reagent for detecting the circRNA marker as claimed in claim 1 in the preparation of a product for diagnosing or treating esophageal cancer.

5. The use according to claim 4, characterized in that: The reagent is selected from: a probe, a gene chip or a detection primer set that has detection specificity for the circRNA marker; Preferably, the detection primer set includes a forward primer and a reverse primer, the nucleotide sequence of the forward primer is shown as SEQ ID NO.2, and the nucleotide sequence of the reverse primer is shown as SEQ ID NO.

3.

6. The use according to claim 5, characterized in that: The reagents also include RNA extraction reagents, reverse transcription reaction systems and fluorescent quantitative PCR reagents.

7. The use according to claim 4, characterized in that: The product includes a chip, a test kit or a nucleic acid membrane strip.

8. A kit for diagnosing or treating esophageal cancer, characterized in that: The kit comprises a specific primer set for the circRNA marker described in claim 1. Preferably, the primer set comprises a forward primer and a reverse primer, the nucleotide sequence of the forward primer is shown as SEQ ID NO.2, and the nucleotide sequence of the reverse primer is shown as SEQ ID NO.

3.

9. Use of the circRNA marker expression inhibitor according to claim 1 in the preparation of a drug for treating esophageal cancer.

10. A drug for treating esophageal cancer, characterized in that: Its active ingredients include the expression inhibitor of the circRNA marker as claimed in claim 1.

Images