A molecular marker related to the blister-shaped wrinkled leaf trait of cucumber and its application

Abstract

The present invention belongs to the field of plant molecular genetics and breeding, and relates to a molecular marker related to the bubble-shaped wrinkled leaf trait of cucumber and its application. The SNP molecular marker is a C / T polymorphic site at position 841 of the nucleotide sequence shown in SEQ ID NO:1. The present invention has developed corresponding molecular marker primers, including a forward primer with a nucleotide sequence shown in SEQ ID NO.2 and a reverse primer with a nucleotide sequence shown in SEQ ID NO.3. After PCR amplification, genotype interpretation is performed using Sanger sequencing. It has been verified that the molecular marker can be used to distinguish between the wild type and mutant types of the cucumber bubble-shaped wrinkled leaf gene Csbcl (cucumber genome ID: CsGy7G020590), which is helpful for the identification of the bubble-shaped wrinkled leaf trait of cucumber and the auxiliary breeding of cucumber varieties with ideal plant types.

Description

Technical Field

[0001] The invention belongs to the field of plant molecular genetic breeding and relates to molecular marker technology, and in particular to a molecular marker related to the bubble-shaped wrinkled leaf trait of cucumber and an application thereof. Background Art

[0002] Cucumber (Cucumis sativus L.) is an important vegetable crop in the Cucurbitaceae family, genus Muskmelon. Due to its short growing season, monoecious sex, lack of inbreeding degeneration, small genome size (~367 Mb), and single-copy distribution of most genes, cucumber is also a model crop for genetic research in the Cucurbitaceae family.

[0003] With the completion of cucumber genome sequencing, the construction of a high-density genetic map, and the establishment of a cucumber genetic transformation system, genes associated with multiple cucumber disease resistance (downy mildew, powdery mildew, and vine blight), stress tolerance (low temperature, salt, and waterlogging tolerance), and fruit quality traits (fruit size, shape, reticulation, and cavity) have been mapped. In cucumber breeding, short internodes, moderate leaf size, small leaf-branch angles, and suitable for dense planting are key priorities for selecting high-yielding varieties. This has significant theoretical and practical implications for efficient cucumber production. Understanding the regulatory mechanisms for important traits such as plant height, branching, leaf size and angle, and internode length is crucial and a prerequisite for cultivating ideal cucumber varieties.

[0004] Among them, leaf morphology plays an important role in photosynthesis, planting density, crop yield and cultivation labor costs. In addition to capturing light energy for photosynthesis to synthesize carbohydrates, leaves can also sense and transmit environmental signals, including light, temperature, water, insects and microorganisms. Typical cucumber leaves are palm-shaped with five main veins extending from the petiole at the base of the leaf to the leaf margin to form shallowly lobed leaves. Currently reported mutants with abnormal cucumber leaf morphology mainly include round leaves (rl), mango leaves (mango fruit), curly leaves (curly leaf), small leaves (little leaf) and wrinkle leaves (wrinkle leaf).

[0005] There are currently two reports of wrinkled leaf mutants in cucumber. Liu Mengying et al. reported on the wrinkled dwarf mutant C1056. After the 3-4 leaf stage, the true leaves of the mutant darken from the veins, the veins thicken, the leaves become wrinkled, and the leaf tips curl inward. Fine-grained gene mapping identified a key regulatory gene, CsGME1, that controls this trait. This gene is crucial for ascorbic acid synthesis and the formation of the cell wall pectin component RG-II (Liu Mengying. Identification of the leaf dwarf mutant C1056 and cloning of the mutant gene WRC-1 [T]. Northwest Agriculture and Forestry University, Master's thesis, 2019). Zhu Gaoxiang et al. reported a wrinkled leaf mutant of Leting cucumber. Compared with the wild type, the mutant lc showed wrinkled leaves, changed leaf shape, close proximity of leaf bases along the depression, compact plant shape, and normal plant growth. Genetic analysis preliminarily determined that the mutant trait was controlled by a single recessive gene (Zhu Gaoxiang, Zhang Meidi, Song Xiaofei, Cui Haonan, Li Xiaoli, Zhu Xueyun, Yan Liying. Phenotypic identification and genetic analysis of cucumber wrinkled leaf mutants [J]. Chinese Vegetables, 2022, 35(3): 9-15.).

[0006] During their research, the inventors discovered a naturally occurring cucumber leaf mutant with a bubble-like wrinkle. This mutant is significantly different from previously reported leaf mutants, with prominent bulges between the veins, giving it a bubble-like appearance. Currently, the gene and function of the leaf mutant have not been reported. Summary of the Invention

[0007] The present invention aims to address the aforementioned problems existing in the prior art. It proposes a molecular marker associated with the bubble-crinkle leaf trait in cucumber and its application. The present invention maps the gene controlling this trait and develops corresponding molecular marker primers targeting this variant. After PCR amplification, genotyping is performed using Sanger sequencing. This molecular marker has been shown to be highly effective in distinguishing wild-type and mutant forms of the cucumber Csbcl gene (cucumber genome ID: CsGy7G020590).

[0008] The technical solution of the present invention is:

[0009] The present invention provides a SNP molecular marker related to the bubble-shaped wrinkled leaf trait of cucumber, wherein a C / T polymorphic site exists at position 841 of the nucleotide sequence shown in SEQ ID NO: 1.

[0010] Specifically, the SNP molecular marker is a mutation from C to T at the 841 bp position on the 9th exon of the cucumber bubble wrinkle gene (cucumber genome ID: CsGy7G020590) 0 transcript.

[0011] The present invention also provides primers for amplifying SNP molecular markers associated with cucumber bubble-shaped wrinkled leaves, comprising:

[0012] Forward primer: 5'-TTCTTATCTCTTTCCCGGAGG-3' (SEQ ID NO. 2);

[0013] Reverse primer: 5'-TCGGTTCTTGAAGTTGTACCA-3' (SEQ ID NO. 3).

[0014] The present invention also provides the use of the SNP molecular marker in the identification of the bubble-shaped wrinkled leaf trait of cucumber and / or the auxiliary breeding of ideal cucumber plant type varieties.

[0015] Furthermore, when the base of the polymorphic site of the SNP molecular marker is C, it is a wild type; when the base of the polymorphic site of the SNP molecular marker is T, it is a bubble-shaped wrinkled leaf mutant.

[0016] The present invention further provides the use of the SNP molecular marker primer in the identification of the cucumber bubble-shaped wrinkled leaf genotype and / or the auxiliary breeding of new cucumber varieties with ideal plant types.

[0017] Furthermore, the application is that the SNP molecular marker primer can be used to identify the bubbly and wrinkled leaf genotype of cucumber and assist in the breeding of new varieties with ideal plant types. The specific operation process is as follows:

[0018] (1) Using the genomic DNA of the cucumber material to be tested as a template, conventional PCR amplification was performed using the sequences shown in SEQ ID NO. 2 and SEQ ID NO. 3 as primers;

[0019] (2) The PCR product obtained in step (1) is subjected to Sanger sequencing, and then sequence analysis is performed using peak analysis software: If the mutation site is base C, that is, the target fragment sequence is as follows (the bold underlined base at position 145 is a single nucleotide site mutation SNP):

[0020] TTCTTATCTCTTTCCCGGAGGAGACCGGAACTTGTTAACACATGGACCCCAGGCATGGACGATAGAGCGGTTAGGTCTTCATGCGGTTCCGACATGTCGATCGATGACCCCACTGAAGATCCTATTGGAAGGCACAACAAGCCA C AGTACCAAACAGAGAATAAGCACGATCCTCAATCTGGTACAACTTCAAGAACCGA (SEQ ID NO.4); the cucumber material to be tested is a wild genotype;

[0021] If the mutation site is base T, that is, the target fragment sequence is as follows (the bold underlined base at position 145 is the single nucleotide variant SNP):

[0022] TTCTTATCTCTTTCCCGGAGGAGACCGGAACTTGTTAACACATGGACCCCAGGCATGGACGATAGAGCGGTTAGGTCTTCATGCGGTTCCGACATGTCGATCGATGACCCCACTGAAGATCCTATTGGAAGGCACAACAAGCCATAGTACCAAACAGAGAATAAGCACGATCCTCAATCTGGTACAACTTCAAGAACCGA (SEQ ID NO.5); the cucumber material to be tested is a homozygous mutant genotype, with bubble-like protrusions on the leaves and dwarf plants;

[0023] If the mutation site is C / T, the cucumber material to be tested is a heterozygous genotype and the phenotype is consistent with the wild type.

[0024] Furthermore, the PCR amplification system (50 μL) is: 2×PCR buffer 25 μL (containing Mg 2+ , dNTPs), 2 μL each of forward and reverse primers (10 μmol / L), 1 μL of genomic DNA, 1 μL of high-fidelity DNA polymerase, and 20 μL of ddH2O;

[0025] The PCR reaction program was as follows: pre-denaturation at 95°C for 5 min; denaturation at 95°C for 30 s, annealing at 55°C for 30 s, and extension at 72°C for 30 s, for a total of 35 cycles; extension at 72°C for 5 min; and storage at 4°C.

[0026] Beneficial effects of the present invention:

[0027] The cucumber mutants screened by the present invention exhibit shrunken, blister-like leaves, shortened internodes, and dwarfed plants, while fruit growth remains normal. The bulged, shrunken leaves significantly increase the surface area of ​​cucumber leaves and improve their light energy capture efficiency. Furthermore, the shortened internodes help reduce vine drop during production. These characteristics of the mutants make it possible to develop ideal plant types in cucumber breeding, and they have promising application prospects and value in cultivating new cucumber varieties with ideal plant types.

[0028] The SNP molecular markers and related primers developed by the present invention can quickly identify wild genotypes and wrinkled leaf mutant genotypes, and can be used to screen heterozygous genetic materials containing the mutation. The molecular markers are helpful in identifying the bubble-shaped wrinkled leaf trait of cucumber and assisting in the breeding of new cucumber varieties with ideal plant types. BRIEF DESCRIPTION OF THE DRAWINGS

[0029] Figure 1 Phenotypic traits of cucumber wild type and mutants; A: cucumber wild type, mutant and F1 generation seed phenotype; B: cucumber wild type, mutant and F1 generation leaf phenotype; C: cucumber wild type and mutant male flower phenotype; D: cucumber wild type and mutant plant phenotype; E: cucumber mutant fruit phenotype; F: cucumber wild type fruit phenotype.

[0030] Figure 2 is the result of SNP-index association analysis; among them, the vertical axis SNP-index (highbulk) is the linkage map of mutant offspring; SNP-index (lowbulk) is the linkage map of wild offspring; ΔSNP-index is the linkage map of the population; the horizontal axis Chromosome (Mb) represents the chromosome number.

[0031] Figure 3 The PCR results of molecular markers for wild-type and mutant cucumbers are shown. M: DL2000 molecular weight marker; 1-2: mutant plants; 3-4: wild-type plants; 5-6: F1 generation plants.

[0032] Figure 4 The peak diagram of sequencing of molecular marker PCR products of wild-type and mutant cucumber; A: bubble-shaped wrinkled leaf mutant plant; B wild-type plant; C: heterozygous F1 generation plant. DETAILED DESCRIPTION

[0033] The following will clearly and completely describe the technical solutions in the embodiments of the present invention in conjunction with the accompanying drawings. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without making creative efforts are within the scope of protection of the present invention.

[0034] In order to further understand the present invention, the present invention will be further described with reference to the accompanying drawings and embodiments.

[0035] Example 1

[0036] Phenotypic Analysis of Cucumber Bubble-Leaf Mutant

[0037] During the research on cucumber breeding, the inventors screened and obtained a naturally occurring cucumber bubble-shaped wrinkled leaf mutant, which is now preserved in this laboratory. Field observations revealed that the interveinal spaces between the leaves of this mutant were significantly bulging and bubble-shaped. Compared with wild-type plants, the mutant plants had shorter internodes and significantly reduced plant height, but they could still flower and bear fruit normally (Table 1 and Figure 1 ).

[0038] Table 1 Growth indicators of cucumber bubble-shaped wrinkled leaf mutant and wild type

[0039] Plant type Plant height (cm) Stem diameter (mm) Internode (mm) <![CDATA[Leaf area (cm 2 )]]> Bullose leaf mutant 130.80±7.60 9.27±1.02 59.70±2.17 142.86±20.47 wild type 223.0±2.74** 10.23±0.47 99.04±6.19** 511.79±14.65**

[0040] Note: Data are expressed as mean ± SD; ** indicates significant difference between data (t test, P < 0.05)

[0041] Example 2

[0042] Reciprocal crosses between the cucumber bubble-shaped leaf mutant and the wild type revealed normal leaves in all F1 generations, indicating that the mutant trait is regulated by a recessive nuclear gene. In the F2 generation segregating population constructed from self-pollinations of the F1 generation, the segregation ratio between wild-type and mutant plants was 3:1. This preliminarily indicates that the cucumber bubble-shaped leaf mutation is a quality trait controlled by a single recessive nuclear gene, designated Csbcl.

[0043] A BSA-seq strategy was used to construct four pools: one for the paternal parent (a pool of 10 leaves), one for the maternal parent (a pool of 10 leaves), and one for the F2 normal-leaf group (a pool of 50 leaves), and one for the F2 wrinkled-leaf group (a pool of 50 leaves). Genomic DNA was extracted from each pool. DNA samples that passed electrophoresis were randomly fragmented into 350-500 bp fragments using a Covaris ultrasonic disruptor. The DNA was then prepared using the TruSeq DNALT Sample Prep kit. The DNA fragments underwent end-repair, ployA tailing, sequencing adapter addition, purification, and PCR amplification to complete the sequencing library construction. The constructed libraries were sequenced by Shanghai Ouyi Biomedical Technology Co., Ltd.

[0044] Raw sequencing reads were filtered using fastp software. Unqualified sequences, such as adapter sequences, were removed to obtain clean reads. Clean reads were aligned to the reference genome (http: / / cucurbitgenomics.org / ftp / genome / cucumber / Gy14 / v2 / ) using BWA software. Alignment results were converted to a new format using SAMtools, de-redundant sequences were removed using Picard software, and the alignment results were analyzed using Qualimap software.

[0045] Based on the sequencing data of BSA-seq and the whole genome information of cucumber GY14, 12 indel candidate sites and 2 SNP candidate sites were initially obtained, which were located on cucumber chromosomes 1, 2, 4, 6 and 7 ( Figure 2Further analysis revealed that most mutations were located within transcribed spacer regions or introns. Only one SNP was detected in exon 9 of the CsGy7G020590 gene transcript on chromosome 7. The corresponding cDNA sequence mutated from a C to a T at bp 841, resulting in a structural change in the protein. Therefore, it was preliminarily determined that the CsGy7G020590 mutation was responsible for the cucumber's bubble-like, wrinkled leaf phenotype. The CsGy7G020590 gene is annotated in the cucumber genome database as a GPI-anchored adhesin-like protein, but its function remains unknown.

[0046] Example 3

[0047] Design and validation of molecular markers for the variation loci of cucumber's bubble-shaped wrinkled leaf phenotype

[0048] Based on the CsGy7G020590 gene sequence information in the cucumber genome database, forward and reverse primers were designed within 250 bp of the 841st mutation base in the CsGy7G020590 gene coding region using Oligo7 primer design software. Primer design principles include a Tm value of approximately 55°C-60°C, a product size of 150-500 bp, and a primer length of 20-24 bp. The designed primers were synthesized by Shanghai Sangon Biotechnology Co., Ltd. and have the following sequences:

[0049] Forward primer: 5'-TTCTTATCTCTTTCCCGGAGG-3' (SEQ ID NO. 2)

[0050] Reverse primer: 5'-TCGGTTCTTGAAGTTGTACCA-3' (SEQ ID NO. 3)

[0051] The PCR amplification system (50 μL) is:

[0052] 2×PCR buffer 25μL (containing Mg 2+ , dNTPs), 2 μL each of forward and reverse primers (10 μmol / L), 1 μL of genomic DNA, 1 μL of high-fidelity DNA polymerase, and 20 μL of ddH2O.

[0053] The PCR reaction program was as follows: pre-denaturation at 95°C for 5 min; denaturation at 95°C for 30 s, annealing at 56°C for 30 s, and extension at 72°C for 30 s, for a total of 35 cycles; extension at 72°C for 5 min; and storage at 4°C.

[0054] The PCR amplification products are approximately 200 bp in length and are SEQ ID NO. 4:

[0055] TTCTTATCTCTTTCCCGGAGGAGACCGGAACTTGTTAACACATGGACCCCAGGCATGGACGATAGAGCGGTTAGGTCTTCATGCGGTTCCGACATGTCGATCGATGACCCCACTGAAGATCCTATTGGAAGGCACAACAAGCCACAGTACCAAACAGAGAATAAGCACGATCCTCAATCTGGTACAACTTCAAGAACCGA;

[0056] and / or SEQ ID NO.5:

[0057] TTCTTATCTCTTTCCCGGAGGAGACCGGAACTTGTTAACACATGGACCCCAGGCATGGACGATAGAGCGGTTAGGTCTTCATGCGGTTCCGACATGTCGATCGATGACCCCACTGAAGATCCTATTGGAAGGCACAACAAGCCATAGTACCAAACAGAGAATAAGCACGATCCTCAATCTGGTACAACTTCAAGAACCGA;

[0058] Then, 1% agarose gel electrophoresis was used to separate the PCR products that matched the target fragment size, and the PCR products were recovered and sent to the company for Sanger sequencing ( Figure 3 The results of sequencing peak analysis showed that the mutation site of the wild-type single strain (target fragment 145) was C base, and the mutation site of the mutant single strain was T base, indicating that the marker can well distinguish wild-type and mutant genes ( Figure 4 ).

[0059] The above description is merely a preferred embodiment of the present invention and is not intended to limit the present invention. Although the present invention has been described in detail with reference to the aforementioned embodiments, those skilled in the art may still modify the technical solutions described in the aforementioned embodiments or replace some of the technical features therein with equivalents. Any modifications, equivalent replacements, and modifications made within the spirit and principles of the present invention shall be included within the scope of protection of the present invention.

Claims

1. A SNP molecular marker associated with the blister-shaped wrinkled leaf trait of cucumber, characterized in that: The SNP molecular marker is shown in SEQ ID NO: 1, and a C / T polymorphic site exists at position 841 of the nucleotide sequence shown in SEQ ID NO:

1.

2. The primer for amplifying the SNP molecular marker according to claim 1, characterized in that: It includes a forward primer with a nucleotide sequence as shown in SEQ ID NO.2 and a reverse primer with a nucleotide sequence as shown in SEQ ID NO.

3.

3. Use of the SNP molecular marker according to claim 1 in the identification of the bubble-shaped wrinkled leaf trait of cucumber and / or in the assisted breeding of cucumber varieties.

4. The use according to claim 3, characterized in that When the base of the polymorphic site of the SNP molecular marker is C, it is a wild type; when the base of the polymorphic site of the SNP molecular marker is T, it is a bubble-shaped wrinkled leaf mutant.

5. Use of the SNP molecular marker primers according to claim 2 in the identification of cucumber bubble-shaped wrinkled leaf genotypes and / or in the assisted breeding of new cucumber varieties.

6. The use according to claim 5, characterized in that The application is to use the SNP molecular marker primers to identify the cucumber bubble-shaped wrinkled leaf genotype or assist in the breeding of new cucumber varieties, and the steps are as follows: (1) Using the genomic DNA of the cucumber material to be tested as a template, PCR amplification was performed using the sequences shown in SEQ ID NO. 2 and SEQ ID NO. 3 as primers; (2) The amplified PCR product is subjected to Sanger sequencing to obtain the nucleotide sequence shown in SEQ ID NO.4 and / or SEQ ID NO.5, and then sequence analysis is performed using peak diagram interpretation software. If the 145th mutation site of the target sequence is base C, the cucumber material to be tested is a wild genotype; if the mutation site is base T, the cucumber material to be tested is a homozygous mutant genotype, the leaves are bubble-shaped and the plant is dwarfed; if the mutation site is C / T, the cucumber material to be tested is a heterozygous genotype, and the phenotype is consistent with the wild type.

7. The use according to claim 6, characterized in that The PCR amplification system is 2×PCR buffer 25 μL, and the 2×PCR buffer contains Mg 2+ , dNTPs, 2 μL each of 10 μmol / L forward and reverse primers, 1 μL of genomic DNA, 1 μL of high-fidelity DNA polymerase, 20 μL of ddH2O; a total of 50 μL; The PCR reaction program was as follows: pre-denaturation at 95°C for 5 min; denaturation at 95°C for 30 s, annealing at 55°C for 30 s, and extension at 72°C for 30 s, for a total of 35 cycles; extension at 72°C for 5 min; and storage at 4°C.

Images