Mosquito-borne virus multiplex fluorescent quantitative PCR (polymerase chain reaction) detection kit and detection method thereof

Abstract

The invention provides a multiplex fluorescent quantitative PCR (polymerase chain reaction) detection kit for mosquito-borne viruses and a detection method of the multiplex fluorescent quantitative PCR detection kit. The detection kit comprises multiple PCR reaction liquid, positive quality control and negative control, the multiplex PCR reaction liquid comprises four specific probes and four pairs of specific primers which are respectively used for detecting the dengue fever virus, the Japanese B encephalitis virus, the Zika virus and the west nile virus; the detection method comprises the following steps: extracting a to-be-detected sample, preparing a PCR mixed solution of a to-be-detected drug, performing PCR amplification and reading a fluorescence signal. Through the mode, the dengue virus, the Japanese B encephalitis virus, the Zika virus and the west nile virus can be specifically recognized, the dengue virus, the Japanese B encephalitis virus, the Zika virus and the west nile virus can be quantitatively detected by combining the standard curve, the detection efficiency is high, the implementation can be stable, the operation is simple, convenient and rapid, and the detection cost is low. The detection speed is high, and the detection accuracy and sensitivity are relatively high.

Description

Technical Field

[0001] The present invention relates to the technical field of molecular diagnostic biology, and in particular to a mosquito-borne virus multiplex fluorescence quantitative PCR detection kit and a detection method thereof. Background Art

[0002] Arboviruses are widely distributed and transmitted by arthropods. Among them, viruses that are transmitted by mosquitoes are called mosquito-borne viruses. They mainly belong to six RNA virus families, including Togaviridae, Flaviviridae, Bunyaviridae, Reoviridae, Rhabdoviridae, and Orthomyxoviridae, and therefore show high genetic variability. Mosquito-borne virus infections usually present as fever, which may be accompanied by skin, joint, neurological, or hemorrhagic symptoms and signs. The prevalence of mosquito-borne viruses poses a threat to both humans and animals, and it is necessary to accurately detect them.

[0003] At present, the most harmful and popular mosquito-borne viruses mainly include dengue virus, Japanese encephalitis virus, Zika virus, West Nile virus, etc. How to detect these viruses quickly and accurately is a problem that needs to be solved urgently. The ELISA method has high sensitivity and strong specificity, but it must use live hosts and live viruses, and the experimental safety requirements are high, which limits the implementation of this method in ordinary laboratories. Polymerase chain reaction (PCR) is a molecular method widely used to detect and identify pathogenic viruses. This method is fast, cheap and simple, and is one of the most widely used techniques in molecular biology. However, existing fluorescent quantitative detection methods are usually difficult to detect a variety of mosquito-borne viruses, and traditional detection probes mostly have problems of insufficient sensitivity and low accuracy when detecting corresponding mosquito-borne viruses.

[0004] In view of this, it is necessary to improve the existing mosquito-borne virus detection methods to increase the types of viruses that can be detected as well as the sensitivity and accuracy of detection. Summary of the invention

[0005] In view of the technical problems existing in the background technology, the present application provides a mosquito-borne virus multiplex fluorescence quantitative PCR detection kit and a detection method thereof, aiming to accurately quantitatively detect dengue virus, Japanese encephalitis virus, Zika virus, and West Nile virus, and to improve the sensitivity of detection.

[0006] In the first aspect, an embodiment of the present application provides a mosquito-borne virus multiplex fluorescent quantitative PCR detection kit, comprising a multiplex PCR reaction solution, a positive quality control and a negative control; the multiplex PCR reaction solution comprises four specific probes and four pairs of specific primers for detecting dengue virus, Japanese encephalitis virus, Zika virus and West Nile virus, respectively.

[0007] In the technical solution of the embodiment of the present application, by designing corresponding primers and probes for dengue virus, Japanese encephalitis virus, Zika virus and West Nile virus among mosquito-borne viruses as the main components of the multiplex PCR reaction solution, these four types of mosquito-borne viruses can be accurately identified and quantitatively detected through multiplex fluorescence quantitative PCR detection, and the detection efficiency and sensitivity can be improved.

[0008] In some embodiments, the four specific probes include:

[0009] Dengue virus probe as shown in SEQ ID NO: 1:

[0010] SEQ ID NO: 1: AGCATATTGACGCTGGGARAGAC;

[0011] Japanese encephalitis virus probe as shown in SEQ ID NO: 2:

[0012] SEQ ID NO:2: AGCWATGARGTTGTCRAATTTCCA;

[0013] Zika virus probe as shown in SEQ ID NO:3:

[0014] SEQ ID NO:3:CGCACCACYTGGGCTGARAACAT;

[0015] West Nile virus probe as shown in SEQ ID NO:4:

[0016] SEQ ID NO: 4: CTTGGGACTTTGGATCAGTTGGAGG.

[0017] In this embodiment, by performing sequence comparison on the genes of dengue virus, Japanese encephalitis virus, Zika virus, and West Nile virus, the temperature, length, GC value, etc. are set after screening the conservative regions, and then four specific probes for the genes of dengue virus, Japanese encephalitis virus, Zika virus, and West Nile virus are designed, which effectively improves the specificity and detection sensitivity compared with conventional probes.

[0018] In some embodiments, the 5' end fluorescent reporter group of the dengue virus probe is VIC, and the 3' end fluorescent quencher group is MGB, which is specifically represented as follows:

[0019] 5'-VIC-AGCATATTGACGCTGGGARAGAC-MGB-3';

[0020] The 5' end fluorescent reporter group of the Japanese encephalitis virus probe is Cy5, and the 3' end fluorescent quencher group is MGB, which is specifically expressed as follows:

[0021] 5'-Cy5-AGCWATGARGTTGTCRAATTTCCA-MGB-3';

[0022] The 5' end fluorescent reporter group of the Zika virus probe is FAM, and the 3' end fluorescent quencher group is MGB, which is specifically expressed as follows:

[0023] 5'-FAM-CGCACCACYTGGGCTGARAACAT-MGB-3';

[0024] The 5' end fluorescent reporter group of the West Nile virus probe is ROX, and the 3' end fluorescent quencher group is MGB, which is specifically expressed as follows:

[0025] 5'-ROX-CTTGGGACTTTGGATCAGTTGGAGG-MGB-3'.

[0026] In this embodiment, by specifically designing the 5'-end fluorescent reporter group and the 3'-end fluorescent quencher group of each probe, the 5'-end fluorescent reporter group of each virus probe is designed to be VIC, Cy5, FAM, and ROX, respectively, and the 3'-end fluorescent quencher group is designed to be MGB, which can further improve the detection efficiency and detection sensitivity.

[0027] In some embodiments, the four pairs of specific primers include:

[0028] The dengue virus upstream primer as shown in SEQ ID NO:5 and the dengue virus downstream primer as shown in SEQ ID NO:6:

[0029] SEQ ID NO: 5: AAGGACTAGAGGTTAGAGGAGAC;

[0030] SEQ ID NO:6: GCGTTCTGTGCCTGGAATGATG;

[0031] The Japanese encephalitis virus upstream primer as shown in SEQ ID NO:7 and the Japanese encephalitis virus downstream primer as shown in SEQ ID NO:8:

[0032] SEQ ID NO:7: CAAAAGAGGAGGAAATGAAGGC;

[0033] SEQ ID NO:8:AATGTCCGTGTTGTTGATGGTC;

[0034] The Zika virus upstream primer as shown in SEQ ID NO:9 and the Zika virus downstream primer as shown in SEQ ID NO:10:

[0035] SEQ ID NO:9: ATGGACAGACATTCCCTATTTGG;

[0036] SEQ ID NO:10:TGTAGACCCTTCTTCACCCAAG;

[0037] The West Nile virus upstream primer as shown in SEQ ID NO: 11 and the West Nile virus downstream primer as shown in SEQ ID NO: 12:

[0038] SEQ ID NO:11: GGCAAAGCCTTTACAACCAC;

[0039] SEQ ID NO: 12: CTCCTCCGAACACTTGATGG;

[0040] The above sequences are all labeled 5'-3'.

[0041] In this embodiment, based on the cooperation of the above four pairs of specific primers and four specific probes, dengue virus, Japanese encephalitis virus, Zika virus and West Nile virus can be specifically identified and quantitatively detected, respectively, and the detection efficiency, detection accuracy and detection sensitivity can be improved.

[0042] In some embodiments, the positive quality control includes dengue virus positive quality control, Japanese encephalitis virus positive quality control, Zika virus positive quality control and West Nile virus positive quality control; the dengue virus positive quality control is a plasmid liquid carrying dengue virus gene fragments; the Japanese encephalitis virus positive quality control is a plasmid liquid carrying Japanese encephalitis virus gene fragments; the Zika virus positive quality control is a plasmid liquid carrying Zika virus gene fragments; the West Nile virus positive quality control is a plasmid liquid carrying West Nile virus gene fragments.

[0043] In some embodiments, the negative control is nuclease-free water.

[0044] In some embodiments, the multiplex PCR reaction solution further comprises 2×PerfeCT qPCR ToughMix UNG.

[0045] In a second aspect, the present application provides a method for quantitative detection of mosquito-borne viruses by multiplex fluorescence quantitative PCR, comprising the following steps:

[0046] S1. Extract the RNA template of the sample to be tested, and convert it into a DNA template as the sample to be tested;

[0047] S2. Add the multiple PCR reaction solution in the above-mentioned kit to the sample to be tested to prepare a PCR mixed solution of the drug to be tested;

[0048] S3. Performing PCR amplification on the PCR mixture of the drug to be tested;

[0049] S4. After the PCR amplification is completed, the fluorescent signal is read and the copy numbers of dengue virus, Japanese encephalitis virus, Zika virus and West Nile virus are calculated.

[0050] In the technical solution of the embodiment of the present application, the above method, combined with external standards and standard curves, can be used to quantitatively detect dengue virus, Japanese encephalitis virus, Zika virus, and West Nile virus, and the detection efficiency is high, can be stably implemented, and the operation is simple and fast. The detection time is only 4 hours, which is suitable for rapid detection of a large number of samples.

[0051] In some embodiments, in the PCR mixture of the drug to be tested, the volume concentration of the sample to be tested is 20%; the concentration of the dengue virus probe is 0.2 μM, and the concentrations of the dengue virus upstream primer and the downstream primer are both 0.2 μM; the concentration of the Japanese encephalitis virus probe is 0.3 μM, and the concentrations of the Japanese encephalitis virus upstream primer and the downstream primer are both 0.1 μM; the concentration of the Zika virus probe is 0.2 μM, and the concentrations of the Zika virus upstream primer and the downstream primer are both 0.1 μM; the concentration of the West Nile virus probe is 0.3 μM, and the concentrations of the West Nile virus upstream primer and the downstream primer are both 0.1 μM.

[0052] In some embodiments, when performing the PCR amplification, the annealing temperature is set at 63-64°C.

[0053] In the above embodiments, the sensitivity of the detection result can be improved by regulating the primer concentration, probe concentration and annealing temperature in the detection process.

[0054] The above description is only an overview of the technical solution of the present application. In order to more clearly understand the technical means of the present application, it can be implemented in accordance with the contents of the specification. In order to make the above and other purposes, features and advantages of the present application more obvious and easy to understand, the specific implementation methods of the present application are listed below. BRIEF DESCRIPTION OF THE DRAWINGS

[0055] In order to more clearly illustrate the technical solution of the present application, the following is a brief introduction to the drawings used in the present application. Obviously, the drawings described below are only some embodiments of the present application, and for ordinary technicians in this field, other drawings can be obtained based on these drawings without creative work.

[0056] Figure 1 Results of primer concentration optimization for four mosquito-borne viruses;

[0057] Figure 2 Results of probe concentration optimization for four mosquito-borne viruses;

[0058] Figure 3 Optimization results of annealing temperature for four mosquito-borne viruses;

[0059] Figure 4 is the standard curve of fluorescent quantitative PCR for four mosquito-borne viruses;

[0060] Figure 5 The fluorescence quantitative PCR amplification curves and PCR gel images of four mosquito-borne viruses are shown;

[0061] Figure 6 Bar graph showing specific results for four mosquito-borne viruses. DETAILED DESCRIPTION

[0062] The following embodiments of the technical solution of the present application are described in detail in conjunction with the accompanying drawings. The following embodiments are only used to more clearly illustrate the technical solution of the present application, and are therefore only used as examples, and cannot be used to limit the scope of protection of the present application.

[0063] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by technicians in the technical field to which this application belongs; the terms used herein are only for the purpose of describing specific embodiments and are not intended to limit this application; the terms "including" and "having" in the specification and claims of this application and the above-mentioned figure descriptions and any variations thereof are intended to cover non-exclusive inclusions.

[0064] Reference to "embodiments" herein means that a particular feature, structure, or characteristic described in conjunction with the embodiments may be included in at least one embodiment of the present application. The appearance of the phrase in various locations in the specification does not necessarily refer to the same embodiment, nor is it an independent or alternative embodiment that is mutually exclusive with other embodiments. It is explicitly and implicitly understood by those skilled in the art that the embodiments described herein may be combined with other embodiments.

[0065] In order to solve the problem that the existing mosquito-borne virus detection methods are difficult to detect a variety of mosquito-borne viruses, and most of the traditional detection probes have insufficient sensitivity and low accuracy when detecting the corresponding mosquito-borne viruses, this application designs four non-interfering specific probes and four pairs of specific primers for dengue virus, Japanese encephalitis virus, Zika virus, and West Nile virus, respectively, for accurate absolute quantitative detection of the above four mosquito-borne viruses, and to improve the detection efficiency, sensitivity and accuracy of the detection. The following is explained in conjunction with specific embodiments. It should be noted that the embodiments described below are exemplary and are only used to explain this application, and cannot be understood as limitations on this application. If the specific techniques or conditions are not specified in the embodiments, they shall be carried out according to the techniques or conditions described in the literature in this field or according to the product instructions. The reagents or instruments used without indicating the manufacturer are all conventional products that can be purchased commercially.

[0066] Example 1

[0067] This embodiment provides a multiplex fluorescent quantitative PCR detection kit for mosquito-borne viruses, including a multiplex PCR reaction solution, a positive quality control, and a negative control. The multiplex PCR reaction solution includes 2×PerfeCT qPCR ToughMix UNG, upstream and downstream primers of dengue virus, upstream and downstream primers of Japanese encephalitis virus, upstream and downstream primers of Zika virus, upstream and downstream primers of West Nile virus, dengue virus probe, Japanese encephalitis virus probe, Zika virus probe, and West Nile virus probe, as shown below:

[0068] Dengue virus upstream primer: 5′-AAGGACTAGAGGTTAGAGGAGAC-3′;

[0069] Dengue virus downstream primer: 5′-GCGTTCTGTGCCTGGAATGATG-3′;

[0070] Japanese encephalitis virus upstream primer: 5′-CAAAAGAGGAGGAAATGAAGGC-3′;

[0071] Japanese encephalitis virus downstream primer: 5′-AATGTCCGTGTTGTTGATGGTC-3′;

[0072] Zika virus upstream primer: 5′-ATGGACAGACATTCCCTATTTGG-3′;

[0073] Zika virus downstream primer: 5′-TGTAGACCCTTCTTCACCCAAG-3′;

[0074] West Nile virus upstream primer: 5′-GGCAAAGCCTTTACAACCAC-3′;

[0075] West Nile virus downstream primer: 5′-CTCCTCCGAACACTTGATGG-3′;

[0076] Dengue virus probe: 5′-VIC-AGCATATTGACGCTGGGARAGAC-MGB-3′;

[0077] Japanese encephalitis virus probe:

[0078] 5'-Cy5-AGCWATGARGTTGTCRAATTTCCA-MGB-3';

[0079] Zika virus probe: 5′-FAM-CGCACCACYTGGGCTGARAACAT-MGB-3′;

[0080] West Nile Virus Probe:

[0081] 5'-ROX-CTTGGGACTTTGGATCAGTTGGAGG-MGB-3'.

[0082] The positive quality control includes dengue virus positive quality control, Japanese encephalitis virus positive quality control, Zika virus positive quality control and West Nile virus positive quality control; the dengue virus positive quality control is a plasmid liquid carrying a dengue virus gene fragment; the Japanese encephalitis virus positive quality control is a plasmid liquid carrying a Japanese encephalitis virus gene fragment; the Zika virus positive quality control is a plasmid liquid carrying a Zika virus gene fragment; the West Nile virus positive quality control is a plasmid liquid carrying a West Nile virus gene fragment. The negative control is nuclease-free water.

[0083] Example 2

[0084] This embodiment provides an operating procedure for the multiple fluorescence quantitative detection process of mosquito-borne viruses and a method for optimizing detection conditions to obtain optimal detection conditions so as to further improve the accuracy and sensitivity of the detection results.

[0085] First, this example constructs and verifies a standard plasmid, and the specific steps are as follows:

[0086] 1. Virus culture and target gene amplification

[0087] Virus culture: Culture virus-susceptible cells in 25cm 2 The cells were placed in a culture flask until they formed a dense monolayer, and then the virus was inoculated. The cells were cultured until the virus proliferation phase, and then the cell samples were collected.

[0088] RNA extraction: Lyse the cells with 1ml Trizol reagent per 6-well plate. Transfer the Trizol lysate of the above cells into an EP tube and place it at room temperature for 5 minutes. Add 0.2ml chloroform, vortex for 15 seconds, place it at room temperature for 2-3 minutes, and centrifuge it at 12000r / min (2℃~8℃) for 15 minutes. Take the upper aqueous phase and place it in a new EP tube, add 0.5ml isopropanol, place it for 10 minutes, and centrifuge it at 12000r / min (2℃~8℃) for 10 minutes. Discard the supernatant, add 1ml 75% ethanol for washing, vortex to mix, centrifuge it at 12000r / min (2℃~8℃) for 5 minutes, and discard the supernatant. Let the precipitated RNA dry naturally at room temperature, and add RNase-free water to dissolve the RNA precipitate.

[0089] Reverse transcription test: Determine the concentration of the extracted RNA, add 2μL of ABScript II EnzymeMix (10X), 10μL of ABScript II Reaction Mix (2X), 1μL of 10mM dNTPs, 2μL of Primer, 1μg of RNA template to the PCR tube, and finally add water to make up to 20μL. Incubate at 25℃ for 5min and 42℃ for 1h. Collect cDNA and store at 20℃ for later use.

[0090] Amplification of target gene: Use Phanta kit to perform PCR amplification on DNA after RNA inversion extracted with plasmid primers (the amount of each reagent is shown in Table 1). PCR reaction conditions: 95℃5min; 95℃15s, 60℃15s, 72℃1min (35 cycles); 72℃ extension for 5min, and finally storage at 4℃. According to different reaction systems and conditions, the corresponding target fragments were amplified.

[0091] Table 1 Amount of each reagent used for target gene amplification

[0092]

[0093]

[0094] 2. Detection, purification and recovery of PCR amplification products

[0095] (1) Mix 50 μL of PCR product with 5 μL of Loading Buffer and perform 1% agarose gel electrophoresis on each.

[0096] (2) Under ultraviolet light, cut the desired target fragment from the agarose gel according to the marker of DL 2000, place it in a 1.5 mL EP tube, and weigh the gel block;

[0097] (3) Add 300 μL Binding Buffer and mix in a metal bath at 55°C until completely melted.

[0098] (4) Take 700 μL of the melted liquid and add it to the HiBind DNA column. Centrifuge at 12000 rpm for 1 min. Repeat this step with the remaining liquid.

[0099] (5) Discard the filtrate, add 300 μL Binding Buffer to the HiBind DNA column, let stand for 1 min, and centrifuge at 12,000 rpm for 1 min.

[0100] (6) Discard the filtrate, add 700 μL Wash Buffer to the HiBind DNA column and centrifuge at 12,000 rpm for 1 min.

[0101] (7) Discard the filtrate and repeat step 6.

[0102] (8) Discard the filtrate and centrifuge at 12000 r / min for 2 min to completely dry the liquid.

[0103] (9) Place the HiBind DNA colum in a 1.5 mL EP tube, add 30 μL of Elution Buffer to the center of the membrane, incubate at 37°C for 3 min, centrifuge at 12,000 rpm for 1 min, elute the DNA, and repeat once. Determine the concentration and purity using a NanoDrop 2000 micro-nucleic acid protein analyzer.

[0104] 3. Connection and conversion

[0105] (1) Connection

[0106] The purified PCR product was connected to the PMD-19T vector system, gently blown to make it uniform, and incubated at 16°C for 30 minutes. The system is shown in Table 2.

[0107] Table 2 Reaction system during connection

[0108]

[0109] (2) Conversion

[0110] A. Place 50 μL of DH5α competent cells (-80°C) in an ice bath until thawed (about 5 min), and shake gently to mix.

[0111] B. Add 10 μL of the ligation reaction product and place in an ice bath for 30 min. Immediately heat-shock in a 42°C water bath for 45 s, quickly move to an ice bath, and cool for 2 min.

[0112] C. Under sterile conditions, add 800 μL LB culture medium (without ampicillin) and culture at 37°C with shaking (150 rpm) for 1 h.

[0113] D. Centrifuge at 5000 r / min for 5 min, discard the supernatant, add 100 μL of the mixed precipitate evenly, and evenly spread it on the LB (containing ampicillin antibiotic) plate.

[0114] E. Let the LB plate stand for 30 minutes. After it is fully absorbed, invert the plate and incubate it at 37°C overnight. Use a pipette to pick up a single white seedling for expansion and culture.

[0115] F. Place a single colony in a centrifuge tube containing 5 mL of LB culture medium (containing ammonia) and shake at 37°C and 230 r / min for 12 hours.

[0116] 4. Plasmid Extraction

[0117] A. Place the bacterial mixture in a high-speed centrifuge and centrifuge at 5000r / min for 15 minutes, discard the supernatant, and add 250μL of SoLutionⅠ to the precipitate to suspend the cells.

[0118] B. Add 250 μL of SoLution II, gently invert 4-6 times to mix, and incubate at room temperature for 2 minutes.

[0119] C. Add 350 μL of SoLution III and invert the tube until white flocculent sediment is suspended in the liquid.

[0120] D. Transfer the above mixture into a 1.5 mL EP tube and centrifuge at 12000 rpm for 10 min.

[0121] E. Transfer the supernatant to the DNA binding column, centrifuge at 12000r / min for 12min, and discard the filtrate.

[0122] F. Add 500 μL HBC Buffer, centrifuge at 12000 r / min for 1 min, and discard the filtrate.

[0123] G. Add 700 μL Wash Buffer, centrifuge at 12000 r / min for 1 min, discard the filtrate, and repeat this operation once.

[0124] H. 12000r / min in air for 2min, open the lid and evaporate at room temperature for 3min.

[0125] I. Place the DNA binding column in a new EP tube, add 50 μL EB (Elution Buffer), incubate at 37°C for 5 min, centrifuge at 12,000 rpm for 1 min, and elute the DNA.

[0126] J. Use Nano Drop 2000 to test the quality and concentration of the constructed recombinant plasmid, and determine the quality and concentration of the plasmid based on the detection of A260 / A280 and A260 / A230 ratios. Finally, store it at -20℃ for future use.

[0127] 5. Sequencing and Analysis of Standard Plasmids

[0128] The plasmids with positive identification results were reactivated and sent to Qingke Biotechnology Co., Ltd. for bidirectional sequencing. The sequencing results were input into NCBI for BLAST analysis and compared with the corresponding reference sequences in GenBank to analyze the homology.

[0129] After completing the construction and verification of the above standard plasmids, the sample preparation is carried out: the product concentration of the plasmid standard is measured and its copy number is calculated; after the copy number is calculated, 2 μL is taken as the sample to be tested, and a negative control is set up for each test. The calculation formula for the copy number is:

[0130] Product RNA copies (copies / μL) = (6.02×10 23 )×(purified product concentration ng / μL×10 -9 ) / (RNALength×340 Daltons / base)

[0131] Product DNA copy number (copies / μL) = (6.02×10 23 )×(plasmid concentration ng / μL×10 -9 ) / (DNALength×660 Daltons / base)

[0132] Among them, 6.02×10 23 is Avogadro's constant, DNA Length is the number of bases remaining in the target fragment after enzyme digestion, and 660 Daltons / base is the average molecular weight of each base of DNA.

[0133] After that, the annealing temperature, primer working concentration and probe working concentration were preliminarily determined. According to the reaction array method, the primer and probe working concentrations of the single-plex fluorescence quantification were optimized, and the single-plex primers and probes were selected and diluted with nuclease-free water to an initial concentration of 20 μM. The amount used is shown in Table 3, and sterile water was used as a negative control.

[0134] Table 3 Amount of each reagent in the reaction system

[0135]

[0136]

[0137] In order to explore the effects of different annealing temperatures and primer and probe concentrations on PCR reactions, these two conditions were optimized to obtain the best reaction conditions and provide guidance for each reaction condition of multiplex PCR. The specific optimization items are as follows:

[0138] (1) Adjust the annealing temperature and optimize it in 8 gradients (53.6℃~63.6℃).

[0139] (2) Adjust the primer concentration and optimize it by adding (0.05 μL to 0.2 μL) into the 10 μL system in four gradients.

[0140] (3) Adjust the probe concentration and optimize it by adding (0.05 μL to 0.2 μL) into the 10 μL system in four gradients.

[0141] The experimental results are shown in Tables 4-1 to 4-5. The optimal temperature for dengue virus was determined to be 61.9°C, the primer concentration was 0.3μM, and the probe concentration was 0.2μM through the reaction array; the optimal temperature for Japanese encephalitis virus was 61.9°C, the primer concentration was 0.3μM, and the probe concentration was 0.3μM; the optimal temperature for Zika virus was 61.9°C, the primer concentration was 0.1μM, and the probe concentration was 0.1μM; the optimal temperature for West Nile virus was 55.6°C, the primer concentration was 0.1μM, and the probe concentration was 0.3μM, which were quite different from the adjacent values, so the next step of optimization was carried out.

[0142] Table 4-1 Optimization of annealing temperature of DENV\JEV\ZIKV\WNV

[0143]

[0144] Table 4-2 Optimization of DENV primer concentration and probe concentration

[0145]

[0146] Table 4-3 Optimization of JEV primer concentration and probe concentration

[0147]

[0148] Table 4-4 Optimization of ZIKV primer concentration and probe concentration

[0149]

[0150] Table 4-5 Optimization of WNV primer concentration and probe concentration

[0151]

[0152] According to the results of Tables 4-1 to 4-5, four primer concentration ranges (0.1-0.2μM) and probe concentration ranges (0.2-0.3μM) with low CT values ​​for virus typing were selected, and 81 concentration combinations were established to select the optimal concentration ratio. Six gradients with annealing temperatures of 55.6℃ to 63.6℃ were selected for optimization. The primer concentration optimization results, probe concentration optimization results, and annealing temperature optimization results were obtained as follows: Figures 1 to 3 shown.

[0153] according to Figures 1 to 3 According to the results, the dengue virus primer concentration was 0.2μM, the probe concentration was 0.2μM; the Japanese encephalitis virus primer concentration was 0.1μM, the probe concentration was 0.3μM; the Zika virus primer concentration was 0.1μM, the probe concentration was 0.2μM; the West Nile virus primer concentration was 0.1μM, the probe concentration was 0.3μM, and the annealing temperature was 63.1℃.

[0154] According to the above optimization conditions, the concentration was selected as 1×10 0 ~1×10 10 The standard plasmid with copies / μL was used as a template to establish a standard curve for fluorescence quantitative PCR. The results are as follows: Figure 4 As shown in the figure, the X-axis is the logarithm of the copy number of the plasmid standard, and the Y-axis is the CT value detected by the plasmid standard.

[0155] Figure 4 DENV standard curve Y = -2.8756X + 35.312, R 2 =0.9933; JEV standard curve Y = -3.1503X + 35.610, R 2 =0.9909; ZIKV standard curve Y = -3.3412X + 37.603, R 2 =0.9908; WNV standard curve Y = -2.8049X + 33.544, R 2 =0.9911.

[0156] Example 3

[0157] This example is based on the kit provided in Example 1, and quantitative detection of dengue virus, Japanese encephalitis virus, Zika virus, and West Nile virus samples is performed, including the following steps:

[0158] 1. Materials and Methods

[0159] 1. Sample preparation and viral DNA acquisition

[0160] Sample preparation: Dengue virus, Japanese encephalitis virus, Zika virus, and West Nile virus plasmid standards were constructed by our laboratory, and the plasmids were successfully sequenced bidirectionally by Qingke Biotechnology Co., Ltd. The preparation method of the virus sample is as follows: virus-susceptible cells are cultured at 25 cm 2 The cells were placed in a culture flask until they formed a dense monolayer, and then the virus was inoculated. The cells were cultured until the virus proliferation phase, and then the cell samples were collected.

[0161] Obtaining viral DNA: Extract RNA template using Trizol method: Lyse cells with 1ml Trizol reagent to extract RNA from each 6-well plate. Determine the concentration of the extracted RNA, add 2μL of ABScript II Enzyme Mix (10X), 10μL of ABScript II Reaction Mix (2X), 1μL of 10mM dNTPs, 2μL of Primer, 1μg of RNA template to the PCR tube in sequence, and finally add water to 20μL. Incubate at 25℃ for 5min and 42℃ for 1h. Collect cDNA and store at 20℃ for later use. Take 2μL as the template DNA of the sample to be tested, and positive and negative controls should be set up for each test.

[0162] 2. Prepare PCR reaction system: Prepare PCR reaction system according to the dosage shown in Table 5. The total volume of the reaction system is 10 μL.

[0163] Table 5 PCR reaction system

[0164]

[0165]

[0166] The PCR reaction mixture prepared with the above ratio was added into a 384-well plate and centrifuged instantaneously.

[0167] 3. Fluorescence quantitative PCR amplification

[0168] Place the sealed PCR reaction plate in QuantStudio TM PCR amplification was performed in the Real-Time PCR Software amplification system. The quantitative PCR amplification reaction conditions were: incubation at 50°C for 2 min, denaturation at 95°C for 10 min, denaturation at 95°C for 15 s, annealing at 63.1°C for 1 min, for a total of 40 cycles.

[0169] 4. Read the fluorescence signal

[0170] After PCR amplification, in QuantStudio TMIn the Real-Time PCR Software reading and analysis system, dengue virus, Japanese encephalitis virus, Zika virus, and West Nile virus were detected in the VIC, Cy5, FAM, and ROX channels. TM Real-Time PCR Software was used for quantitative analysis to calculate the copy numbers of dengue virus, Japanese encephalitis virus, Zika virus, and West Nile virus.

[0171] 2. Determination of results

[0172] 1. Quality control standards

[0173] Negative control: The negative control was judged as negative if there was no signal or CT value ≥ 35 through VIC channel, FAM channel, Cy5 channel and ROX channel.

[0174] Positive control: dengue virus positive control was detected in the VIC channel, that is, dengue virus was detected in the VIC channel; Japanese encephalitis virus positive control was detected in the Cy5 channel, that is, Japanese encephalitis virus was detected in the Cy5 channel; Zika virus positive control was detected in the FAM channel, that is, Zika virus was detected in the FAM channel; West Nile virus positive control was detected in the ROX channel, that is, West Nile virus was detected in the ROX channel. According to the fluorescence quantitative CT value <35, the instrument was equipped with QuantStudio TM Real-Time PCR Software was used to construct a standard curve and calculate the copy numbers of dengue virus, Japanese encephalitis virus, Zika virus, and West Nile virus.

[0175] If one of the positive control or negative control does not meet the standard, the test will be invalid.

[0176] 2. Judgment results

[0177] Standard curve:

[0178] A standard curve was drawn with the measured CT value of the standard as the ordinate and the logarithm of the copy number of the standard as the abscissa, and a linear regression was performed to obtain a regression equation.

[0179] Calculation of virus copy number in sample:

[0180] The CT value of the sample was measured and substituted into the regression equation of the standard curve to calculate the number of viral copies in the sample. The results are shown in Table 6.

[0181] Table 6 DENV\JEV\ZIKV\WNV virus detection

[0182]

[0183] Example 4

[0184] This example tests the sensitivity, specificity and repeatability of the kit provided in Example 1, and the specific method is as follows:

[0185] 1. Sensitivity test of the kit

[0186] According to the previously optimized conditions, the concentration was selected as 1×10 0 ~1×10 10 The standard plasmid with 100 copies / μL was used as a template to detect the sensitivity of each virus fluorescence quantitative PCR. Fluorescence quantitative PCR and ordinary PCR tests were performed at the same time. The copy number results are shown in Table 7, and the amplification curve and PCR gel image results are shown in Figure 5 shown.

[0187] Table 7 DENV\JEV\ZIKV\WNV fluorescence quantitative PCR and PCR sensitivity

[0188]

[0189] As can be seen from Table 7, using the standard plasmid as a template, the minimum detection limit of DENV fluorescence quantitative PCR was 1×10 0 The minimum detectable number of copies / μL in conventional PCR is 1×10 4 copies / μL; the minimum detection limit of JEV fluorescence quantitative PCR is 1×10 0 The lowest detectable number of copies / μL in conventional PCR is 1×10 2 copies / μL; the minimum detection limit of ZIKV fluorescence quantitative PCR is 1×10 0 The minimum detectable number of copies / μL in conventional PCR is 1×10 0 copies / μL; the minimum detection limit of WNV fluorescence quantitative PCR is 1×10 0 The minimum detectable number of copies / μL in conventional PCR is 1×10 2 This indicates that the minimum detection limit of the detection method provided by the present application is significantly lower than that of ordinary PCR, and has higher sensitivity.

[0190] 2. Specificity test of the kit

[0191] Plasmid standards of dengue virus, Japanese encephalitis virus, Zika virus, West Nile virus, yellow fever virus, vesicular stomatitis virus, Rift Valley fever virus, chikungunya virus, Banna virus, and Geta virus were diluted to appropriate concentrations, and DNA templates of dengue virus, Japanese encephalitis virus, Zika virus, and West Nile virus were obtained to detect the specificity of fluorescent quantitative PCR for plasmid standards and viruses. The measured average Ct values ​​and copy numbers are shown in Table 8, and the specificity result bar graph is shown in Table 8. Figure 6 shown.

[0192] Table 8 Mosquito-borne virus specificity test results

[0193]

[0194]

[0195] From Table 8 and Figure 6 It can be seen that except for the target gene with a low CT value, the CT values ​​of other templates are high or not detected, indicating that the probe has good specificity.

[0196] 3. Repeatability test of the kit

[0197] The concentration is 1×10 8 copies / μL, 1×10 6 copies / μL, 1×10 4 The standard sample with 100 copies / μL was used as a template for repeatability test, and the coefficients of variation within and between plates were calculated. The results are shown in Table 9.

[0198] Table 9 Multiplex fluorescence quantitative PCR repeatability test

[0199]

[0200] As can be seen from Table 9, the intra-group coefficient of variation is between 0.30% and 2.01%, and the inter-group coefficient of variation is between 0.38% and 1.55%, both of which are less than 3%, indicating that the detection method provided in the present application has good repeatability.

[0201] In summary, the present application provides a mosquito-borne virus multiplex fluorescence quantitative PCR detection kit and a detection method thereof. Among them, the detection kit includes a multiplex PCR reaction solution, a positive quality control and a negative control; the multiplex PCR reaction solution includes four specific probes and four pairs of specific primers for detecting dengue virus, Japanese encephalitis virus, Zika virus, and West Nile virus respectively; the detection method includes extraction of the sample to be tested, preparation of the PCR mixture of the drug to be tested, PCR amplification, and reading of the fluorescence signal. Through the above-mentioned method, the present application can specifically identify dengue virus, Japanese encephalitis virus, Zika virus, and West Nile virus, and by combining the standard curve, the dengue virus, Japanese encephalitis virus, Zika virus, and West Nile virus can be quantitatively detected, and the detection efficiency is high, the implementation can be stable, the operation is simple and fast, the detection speed is fast, and the detection accuracy and sensitivity are high.

[0202] It should be noted that the present application is not limited to the above-mentioned embodiments. The above-mentioned embodiments are only examples, and the embodiments having the same structure as the technical idea and exerting the same effect within the scope of the technical solution of the present application are all included in the technical scope of the present application. In addition, without departing from the scope of the main purpose of the present application, various modifications that can be thought of by those skilled in the art to the embodiments and other methods of combining some of the constituent elements in the embodiments are also included in the scope of the present application.

Claims

1. A multiplex fluorescent quantitative PCR detection kit for mosquito-borne viruses, characterized in that: It comprises a multiplex PCR reaction solution, a positive quality control and a negative control; the multiplex PCR reaction solution comprises four specific probes and four pairs of specific primers respectively used for detecting dengue virus, Japanese encephalitis virus, Zika virus and West Nile virus.

2. The mosquito-borne virus multiplex fluorescence quantitative PCR detection kit according to claim 1, characterized in that: The four specific probes include: The dengue virus probe as shown in SEQ ID NO: 1; The Japanese encephalitis virus probe as shown in SEQ ID NO: 2; The Zika virus probe shown in SEQ ID NO:3; The West Nile virus probe is shown as SEQ ID NO:

4.

3. The mosquito-borne virus multiplex fluorescence quantitative PCR detection kit according to claim 2, characterized in that: The 5' end fluorescent reporter group of the dengue virus probe is VIC, and the 3' end fluorescent quencher group is MGB; The 5' end fluorescent reporter group of the Japanese encephalitis virus probe is Cy5, and the 3' end fluorescent quencher group is MGB; The 5' end fluorescent reporter group of the Zika virus probe is FAM, and the 3' end fluorescent quencher group is MGB; The 5' end fluorescent reporter group of the West Nile virus probe is ROX, and the 3' end fluorescent quencher group is MGB.

4. The mosquito-borne virus multiplex fluorescence quantitative PCR detection kit according to claim 1, characterized in that: The four pairs of specific primers include: A dengue virus upstream primer as shown in SEQ ID NO:5 and a dengue virus downstream primer as shown in SEQ ID NO:6; A Japanese encephalitis virus upstream primer as shown in SEQ ID NO:7 and a Japanese encephalitis virus downstream primer as shown in SEQ ID NO:8; A Zika virus upstream primer as shown in SEQ ID NO:9 and a Zika virus downstream primer as shown in SEQ ID NO:10; The West Nile virus upstream primer is shown as SEQ ID NO:11 and the West Nile virus downstream primer is shown as SEQ ID NO:

12.

5. The mosquito-borne virus multiplex fluorescence quantitative PCR detection kit according to claim 1, characterized in that: The positive quality control includes dengue virus positive quality control, Japanese encephalitis virus positive quality control, Zika virus positive quality control and West Nile virus positive quality control; the dengue virus positive quality control is a plasmid liquid carrying dengue virus gene fragments; the Japanese encephalitis virus positive quality control is a plasmid liquid carrying Japanese encephalitis virus gene fragments; the Zika virus positive quality control is a plasmid liquid carrying Zika virus gene fragments; the West Nile virus positive quality control is a plasmid liquid carrying West Nile virus gene fragments.

6. The mosquito-borne virus multiplex fluorescence quantitative PCR detection kit according to claim 1, characterized in that: The negative control was nuclease-free water.

7. The mosquito-borne virus multiplex fluorescence quantitative PCR detection kit according to claim 1, characterized in that: The multiplex PCR reaction solution also includes 2×PerfeCT qPCR ToughMix UNG.

8. A method for quantitative detection of mosquito-borne viruses by multiplex fluorescence quantitative PCR, using the kit described in any one of claims 1 to 7 for detection, characterized in that: The steps include: S1. Extract the RNA template of the sample to be tested, and convert it into a DNA template as the sample to be tested; S2. Add the multiple PCR reaction solution in the above-mentioned kit to the sample to be tested to prepare a PCR mixed solution of the drug to be tested; S3. Performing PCR amplification on the PCR mixture of the drug to be tested; S4. After the PCR amplification is completed, the fluorescent signal is read and the copy numbers of dengue virus, Japanese encephalitis virus, Zika virus and West Nile virus are calculated.

9. The method for quantitative detection of mosquito-borne viruses by multiplex fluorescence quantitative PCR according to claim 8, characterized in that: In the PCR mixed solution of the drug to be tested, the volume concentration of the sample to be tested is 20%; the concentration of the dengue virus probe is 0.2 μM, and the concentrations of the dengue virus upstream primer and the downstream primer are both 0.2 μM; the concentration of the Japanese encephalitis virus probe is 0.3 μM, and the concentrations of the Japanese encephalitis virus upstream primer and the downstream primer are both 0.1 μM; the concentration of the Zika virus probe is 0.2 μM, and the concentrations of the Zika virus upstream primer and the downstream primer are both 0.1 μM; the concentration of the West Nile virus probe is 0.3 μM, and the concentrations of the West Nile virus upstream primer and the downstream primer are both 0.1 μM.

10. The method for quantitative detection of mosquito-borne viruses by multiplex fluorescence quantitative PCR according to claim 8, characterized in that: When performing the PCR amplification, the annealing temperature is set at 63-64°C.

Images