Method for rapidly detecting nipah virus nucleic acid

Abstract

The invention provides a method for rapidly detecting the Nipah virus, namely a method for detecting the Nipah virus based on RT-RAA-CRISPR / Cas13a is established on the basis of screening a group of RT-RAA primer probes for efficiently and specifically detecting the Nipah virus, so that the Nipah virus can be detected with high specificity and sensitivity. The RT-RAA technology and the CRISPR / Cas13a technology are combined, rapid and high-precision detection of the Nipah virus can be achieved, and the kit has important significance in prevention of rapid propagation and timely purification treatment of the Nipah virus in the future and has good application prospects.

Description

Technical Field

[0001] The invention belongs to the technical field of molecular biological gene diagnosis, and in particular relates to a method for rapidly detecting Nipah virus. Background Art

[0002] Nipah virus (NiV) is a highly pathogenic zoonotic virus belonging to the family Paramyxoviridae and the genus Henipavirus. The virus particles are spherical and enveloped, and the genome is a single-stranded negative-sense RNA, in which the L gene is relatively conservative. Fruit bats are its natural hosts, and pigs can serve as intermediate hosts. The transmission routes include animal-to-human transmission (such as contact with infected animal secretions, excrement, or eating contaminated food) and human-to-human transmission (close contact with patients' respiratory secretions and body fluids). Patients initially have flu-like symptoms such as fever and headache. In severe cases, they may develop into neurological diseases such as encephalitis and meningitis, or respiratory symptoms. The mortality rate is high, and it is classified as a biosafety level 4 (BSL-4) virus. International exchanges are becoming more frequent, but the outbreak areas of Nipah virus are all adjacent to my country. In this case, a more sensitive, rapid, specific and convenient detection method can more effectively block the epidemic outside the country. At present, the commonly used detection methods are laboratory tests, mainly based on fluorescent quantitative PCR, enzyme-linked immunosorbent assay, immunofluorescence and immunohistochemistry. These methods require good laboratory conditions, expensive professional instruments and experienced technicians, which are time-consuming and labor-intensive and inconvenient for on-site testing.

[0003] RT-RAA is an isothermal nucleic acid amplification technology that can quickly and efficiently amplify specific nucleic acid sequences at temperatures close to room temperature. It has the advantages of simple operation, fast reaction, and relatively low requirements for instruments and equipment. There have been patents on Nipah virus RT-RAA detection technology in the early stage, but the biggest disadvantage of RT-RAA technology is that non-specific amplification may sometimes occur, resulting in false positive results. Therefore, if there is a specific detection method that can be used in conjunction with RT-RAA, it can achieve high-specificity detection on the basis of giving full play to the high amplification and high sensitivity of RT-RAA detection technology. The CRISPR / Cas13 system is a powerful RNA editing tool. The Cas13 protein can specifically recognize the target RNA under the guidance of crRNA, activate its own side-cutting performance, and generate a detection signal when paired with a detection probe. Since crRNA will not be able to effectively recognize if the error exceeds 2 base mismatches when recognizing the template, the CRISPR / Cas13 detection system has a high detection specificity. The combination of RT-RAA technology and CRISPR / Cas13 detection system has many advantages. First, the rapid amplification ability of RT-RAA provides CRISPR / Cas13 with sufficient target RNA, which improves the sensitivity of detection and can realize the detection of trace nucleic acids, and is expected to be applied to the early diagnosis of diseases. Secondly, the specific cutting ability of CRISPR / Cas13 further enhances the accuracy of detection and greatly reduces the false positive rate. Finally, the cut detection probe can be captured by antibodies to prepare test strips for combination, thereby realizing the development of on-site diagnostic technology. However, this combination technology also faces some challenges in application, such as poor primer design during RT-RAA amplification, resulting in the inability to effectively amplify the template, and poor crRNA design resulting in reduced detection sensitivity. Summary of the invention

[0004] The object of the present invention is to provide a method for rapidly detecting Nipah virus based on RT-RAA-CRISPR / Cas13 technology, which can detect Nipah virus with high specificity and sensitivity.

[0005] The present invention first provides an RT-RAA primer pair for detecting Nipah virus, wherein the sequence of the nucleic acid fragment detected by the primer pair is as follows:

[0006] TACTGAAATAATCCTAAATCCGAATCTTATCTGCATTTTCAAATCAGACAAAACT

[0007] GGAAAGAAGTGTTATTATCTTACACCCGAAATGGTTCTAATGTATTGTGATGTCCTAGA

[0008] GGGAAGGATGATGATGGAGACAACAGTCAAATCGGATATCAAGTACCAACCTCTAATCT

[0009] CGAGATCCAATGCC (SEQ ID NO: 1).

[0010] As a specific record of the embodiment, the sequence information of the upstream and downstream primer pairs of the RT-RAA primer pair is as follows:

[0011] Upstream primer Nipah virus F10:

[0012] 5′-TACTGAAATAATCCTAAATCCGAATCTTATCTG-3′ (SEQ ID NO: 2), downstream primer Nipah virus R10B:

[0013] 5'-GGCATTGGATCTCGAGATTAGAGGTTGGTA-3' (SEQ ID NO: 3).

[0014] The RT-RAA primer pair screened and obtained by the present invention is used to prepare an RT-RAA-CRISPR / Cas13a detection preparation for detecting Nipah virus;

[0015] Furthermore, the detection preparation also includes CRISPR-Cas13a protein, crRNA, reporter molecule and lateral flow test paper used in conjunction with it;

[0016] The sequence of the crRNA is as follows:

[0017] GATTTAGACTACCCCAAAAACGAAGGGGACTAAAACTTGTCTCCATCATCATCCT TCCCTCTAG (SEQ ID NO: 4).

[0018] When the fluorescence method is used, the reporter molecule is a fluorescent reporter molecule, the sequence of which is 5′-UUUUUUUUUUU-3′, and both ends of the probe are labeled with FAM and BHQ1 respectively;

[0019] When the test strip method is used, the reporter molecule is a biotin reporter molecule, the sequence of which is 5′-UUUUUUUUUUU-3′, and both ends of the probe are labeled with FAM and biotin, respectively.

[0020] The present invention also provides a method for detecting Nipah virus using RT-RAA-CRISPR / Cas13a, comprising the following steps:

[0021] When the reporter molecule is a fluorescent reporter molecule, the nucleic acid of the sample to be tested is used as a template, the RT-RAA primer pair is used to perform RT-RAA reaction to obtain an amplified product, the fluorescent reporter molecule and the crRNA are used to perform CRISPR / Cas13a reaction on the amplified product to obtain a reaction product, and whether the sample to be tested contains Nipah virus is determined according to the fluorescence and fluorescence value of the reaction product, that is, the reaction product is observed under a blue light / ultraviolet light (wavelength of 440-460nm / 400nm), if the reaction product produces green fluorescence, the sample to be tested contains Nipah virus, if the reaction product does not produce green fluorescence, the sample to be tested does not contain Nipah virus;

[0022] When the reporter molecule is a biotin reporter molecule, the nucleic acid of the sample to be tested is used as a template, and the RT-RAA primer pair is used to perform RT-RAA reaction to obtain an amplification product. The amplification product is subjected to CRISPR / Cas13a reaction using the biotin reporter molecule and the crRNA to obtain a reaction product. The product after the CRISPR / Cas13a reaction is diluted with dd H2O at a ratio of 1:1, and a test strip is inserted into the diluted mixture for 10 minutes to read the test result. If the test line does not show color and the quality control line is visible to the naked eye, it is judged to be positive, and the sample to be tested contains Nipah virus, indicating that the nucleic acid probe is almost completely cut by the Cas enzyme. If the test line is colored and the quality control line is visible to the naked eye, it is judged to be positive, and the sample to be tested contains Nipah virus, indicating that part of the nucleic acid probe is cut by the Cas enzyme. If the test line is colored and the quality control line is not colored, it is judged to be negative, and the sample to be tested does not contain Nipah virus, indicating that the nucleic acid probe is not cut by the Cas enzyme. If both the test line and the quality control line are not colored, it indicates that the test result is invalid.

[0023] The present invention combines RT-RAA technology with CRISPR / Cas13a technology to achieve rapid and high-precision detection of Nipah virus, which is of great significance for preventing the rapid spread of Nipah virus and timely purification and treatment in the future, and has good application prospects. BRIEF DESCRIPTION OF THE DRAWINGS

[0024] Figure 1 This is a graph showing the screening results of ten pairs of RT-RAA primers, F1R1, F2R2, F3R3, F4R4, F5R5, F6R6, F7R7, F8R8, F9R9, and F10R10A in Example 1.

[0025] Figure 2 This is a diagram showing the results of the F10R10A RT-RAA primer screening in Example 1.

[0026] Figure 3 This is a diagram showing the screening results of the F10R10B RT-RAA primers in Example 1.

[0027] Figure 4 , Figure 5 They are respectively a photograph and a data statistical diagram of the crRNA screening results in Example 1, wherein 1: crRNA1+; 2: crRNA1-; 3: crRNA2+; 4: crRNA2-; 5: crRNA3+; 6: crRNA3-; 7: crRNA4+; 8: crRNA4-; 9: crRNA5+; 10: crRNA5-.

[0028] Figure 6 , Figure 7 They are respectively the photographs and data statistics of the sensitivity verification of the fluorescence method for detecting Nipah virus provided in Example 2, Figure 6 1:10 0 ; 2:10 -1 ; 3:10 -2 ; 4:10 -3 ; 5:10 -4 ; 6:10 -5 ; 7:10 -6 ; 8:10 -7 ; 9:10 -8 ; 10:10 -9 ; 11:10 -10 ;12:NC.

[0029] Figure 8 This is a graph showing the sensitivity verification results of the Nipah virus test strip method provided in Example 2, where 1:10 0 ; 2:10 -1 ; 3:10 -2 ; 4:10 -3 ; 5:10 -4 ; 6:10 -5 ; 7:10 -6 ; 8:10 -7 ; 9:10 -8 ; 10:10 -9 ; 11:10 -10 ;12:NC.

[0030] Fig. 9 , Fig.10 They are photographs and statistical graphs for the verification of the specific method for detecting Nipah virus by fluorescence method provided in Example 3, wherein 1: Seneca virus (SVA); 2: foot-and-mouth disease virus (FMDV); 3: classical swine fever virus (CSFV); 4: porcine epidemic diarrhea virus (PEDV); 5: African swine fever virus (ASFV); 6: pseudorabies virus (PRV); 7: Nipah virus; 8: NC.

[0031] Fig.11This is a graph showing the validation results of the specific method for detecting Nipah virus by the test strip method provided in Example 3, wherein 1: Seneca virus (SVA); 2: foot-and-mouth disease virus (FMDV); 3: classical swine fever virus (CSFV); 4: porcine epidemic diarrhea virus (PEDV); 5: African swine fever virus (ASFV); 6: pseudorabies virus (PRV); 7: Nipah virus; 8: NC. DETAILED DESCRIPTION

[0032] The present invention first collects and analyzes the existing Nipah virus conservative sequences worldwide, and finds the target sequence on its L gene, thereby ensuring that the detection method has good detection performance for all Nipah virus strains. Since Nipah virus has not yet been introduced into my country, the applicant designed and prepared Nipah virus RNA standards and used them for the performance test of the detection method.

[0033] Moreover, in actual operation, it was found that when the RT-RAA amplification efficiency is not strong, the template amplification amount will be low, reducing the sensitivity of the RT-RAA-CRISPR / Cas 13 detection system; when the crRNA has poor binding ability with the target sequence, it will cause the crRNA to be unable to bind to the target template, and thus fail to activate the Cas enzyme cutting activity and generate detection signals.

[0034] To avoid these shortcomings, the present invention will first analyze the pathogen sequence and design 10 pairs of RT-RAA amplification primers, and screen out the amplification primers with the strongest amplification efficiency and the strongest specificity. Based on the strongest amplification primer, three downstream optimized primers are designed to further optimize the amplification primer efficiency, so that its amplification limit is increased from 10 -3 Dilute the standard up to 10 -8 The sensitivity of the dilute standard was increased by 100,000 times, ensuring the amplification efficiency and specificity of the RT-RAA reaction. At the same time, 5 crRNAs were designed for the RT-RAA amplification sequence, and their specificity of binding to the target was tested one by one to screen the best crRNA.

[0035] In order to realize on-site detection, the present invention applies the established RT-RAA-CRISPR / Cas13 technology to the test strips, thereby realizing the function of on-site detection.

[0036] The present invention is further described in detail below in conjunction with specific embodiments, and the examples provided are only for illustrating the present invention, rather than for limiting the scope of the present invention. The examples provided below can be used as a guide for further improvements by those of ordinary skill in the art, and do not constitute a limitation of the present invention in any way.

[0037] Example 1: Establishment of a Nipah virus detection method

[0038] 1. Preparation of Nipah virus RNA standards

[0039] 1. The highly conserved sequence obtained by screening is used as the positive plasmid for the synthesis of the target gene fragment for detection, and in vitro transcription is performed. The transcription product is purified to prepare the Nipah virus RNA standard.

[0040] 2. Dilute the Nipah virus RNA standard 10-fold and take 1×10 0 —1×10 -9 A total of 10 serial dilutions of Nipah virus RNA standard were prepared. A digital PCR instrument was used to quantify the diluted 1×10 -5 —1×10 -9 A total of 5 serial dilutions of Nipah virus RNA standard were used for nucleic acid copy number calibration. The reaction program was set as follows: reverse transcription at 50°C for 20 min, pre-denaturation at 95°C for 5 min, amplification at 95°C for 15 s, 60°C for 30 s, 45 cycles. The reaction system was: 2×MP Buffer 10 μL, Enzyme mix 1 μL ( V C58P2 Multiplex One Step RT-qPCR Probe Kit, YEASEN), 0.5 μL each of upstream and downstream primers and fluorescent probe (10 μM) (primer and probe sequences are shown in Table 1), 5 μL of diluted Nipah virus RNA standard, and ddH2O was added to 20 μL.

[0041] 3. The calibrated 10 0 —10 -10 The dilutions of Nipah virus RNA standards were packaged and frozen at -80°C for future use. The copy numbers were 52935.615copy / μL (10 -5 )、1409.226copy / μL(10 -6 )、94.775copy / μL(10 -7 )、43.923copy / μL(10 -8 )、18.746copy / μL(10 -9 )、9.864copy / μL(10 -10 ).

[0042] Table 1: Sequence information of primers and fluorescent probes for amplification of Nipah virus RNA standards

[0043]

[0044]

[0045] 2. Design and screening of RT-RAA primers

[0046] 68 full gene sequences of Nipah virus were obtained from Genebank for comparison, and the highly conserved L gene was selected as the detection target. According to the RT-RAA design principle, 21 conserved region gene primers were designed, and the T7 promoter sequence (lowercase English) was added to the front end of the upstream primer to facilitate in vitro transcription (as shown in Table 2).

[0047] Table 2: Nipah virus RT-RAA primer sequence list

[0048]

[0049]

[0050] 3. Screening of the best primer pairs

[0051] Take 10 0 The diluted Nipah virus RNA standard was used as a template, and the ten pairs of primers F1R1, F2R2, F3R3, F4R4, F5R5, F6R6, F7R7, F8R8, F9R9, and F10R10A shown in Table 1 were used for RT-RAA reaction. The kit was purchased from Jiangsu Qitian Gene Biotechnology Co., Ltd. (the reaction system is shown in Table 3), and the reaction temperature was 37°C and 40min. After the reaction, 5 μL of the reaction product was subjected to 2% agarose gel electrophoresis, and the results were observed on the gel imaging system ( Figure 1 ), the results show that ( Figure 1 ) The amplified band of primer F10R10A is brighter, and the amplified band of primer F10R10A is brighter. -0 ~10 -10 Using the diluted Nipah virus RNA standard as a template, the sensitivity of the two primer pairs F10R10A and F10R10B was tested (the reaction system is shown in Table 3). The results showed that ( Figure 2 , Figure 3 ), F10R10B has better sensitivity than F10R10A, so F10R10B was selected as the best primer pair for detecting Nipah virus.

[0052] Table 3: RT-RAA reaction system

[0053]

[0054]

[0055] 3. Design, transcription and purification of Nipah virus crRNA

[0056] 1. Five crRNAs were designed based on the target fragment sequence amplified by RT-RAA and combined with the characteristics of LwaCas13a recognizing crRNA (the sequences are shown in Table 4).

[0057] 2. The oligonucleotide T7-crRNA-F synthesizing the crRNA transcription template was combined with crRNA-R (1-5) respectively, and the dry powdered synthetic oligonucleotide chain combination was dissolved in 1x annealing buffer to a concentration of 10 μmol / L. The mixture was mixed in equal volumes, denatured at 95°C for 5 min, and slowly cooled to 25°C for no less than 45 min to anneal to form double-stranded DNA (annealing system is shown in Table 5).

[0058] 3. Using the above double-stranded DNA as a template, in vitro transcription (T7 RNA Polymerase, Vazyme) was performed and purified to obtain crRNA1-5 (the transcription system is shown in Table 6), the crRNA concentration was determined, and the crRNA was aliquoted and frozen at -80°C for later use.

[0059] Table 4: crRNA, reporter molecule sequence information

[0060]

[0061]

[0062] Table 5: Composition of annealing system

[0063] Components Volume / μL T7-crRNA-F 10 crRNA-R 10 <![CDATA[RNase-free ddH2O]]> 20

[0064] Table 6: crRNA in vitro transcription system

[0065] Components Volume / μL 10×Transcription Buffer 4 ATP / CTP / GTP / UTP (100mM) 0.3 each T7 RNA Polymerase (50U / μL) 4 RNase Inhibitor 2 template 1 μg <![CDATA[RNase-free ddH2O]]> Replenish to 40

[0066] 4. Screening of Nipah virus crRNA

[0067] Take 10 0 The diluted Nipah virus RNA standard was used as a template, and the Nipah virus F10R10B primer was used for RT-RAA reaction to obtain the amplified product. ddH2O was set as the negative control of the template (the reaction system is shown in Table 3). The CRISPR / Cas13a fluorescence method and test strip method reaction system 1 was incubated in a PCR instrument at 37°C for 10 minutes (as shown in Table 7). The amplified products were added to the CRISPR / Cas13a fluorescence method and test strip method reaction system 2 (as shown in Table 8), respectively, and reacted in a 37°C constant temperature metal bath for 30 minutes. At this time, the reporter molecule used was a fluorescent reporter molecule. After the reaction is completed, the fluorescence intensity is observed and the fluorescence value is detected to screen out an optimal crRNA. Use blue light irradiation to observe the fluorescence results, and use a multifunctional microplate reader to detect and read the fluorescence intensity value. The results are shown in Figure 4 , Figure 5Cas13a protein was purchased from GenScript Biotech Co., Ltd., and the fluorescent reporter molecule modified with a fluorescent group (FAM) and a fluorescent quencher group (BHQ1) at the 5′ and 3′ ends was synthesized by Sangon Biotech (Shanghai) Co., Ltd. (sequences are shown in Table 4).

[0068] Table 7: CRISPR / Cas13a fluorescence and test strip method reaction system Table 1

[0069]

[0070] Table 8: CRISPR / Cas13a fluorescence and test strip method reaction system Table 2

[0071]

[0072]

[0073] The experimental results showed that crRNA1 had the highest fluorescence intensity value, so crRNA1 was selected for subsequent experiments ( Figure 4 , Figure 5 ).

[0074] Example 2: Sensitivity of the Nipah virus detection method

[0075] Use the calibrated 10 0 —10 -9 The dilution of Nipah virus RNA standard was used as a template, and the copy number was 52935.615copy / μL (10 -5 )、1409.226copy / μL(10 -6 )、94.775copy / μL(10 -7 )、43.923copy / μL(10 -8 )、18.746copy / μL(10 -9 )、9.864copy / μL(10 -10 ), prepare the fluorescence and test strip detection systems of RT-RAA-CRISPR / Cas13a.

[0076] When the reporter molecule is a fluorescent reporter molecule, the result is as follows Figure 6 , Figure 7 The results showed that when the template concentration was as low as 18.746 copies / μL, there was fluorescence, and 9.864 copies / μL did not emit fluorescence. The experiment was repeated three times, and the results showed the same pattern. This shows that the detection limit of the fluorescence method for Nipah virus is 18.746 copies / μL.

[0077] When the reporter molecule is a biotin reporter molecule, the result is as follows Figure 8The results showed that when the template dilution was 10 0 —10 -7 When the template dilution is 10 -8 , 10 -9 As the nucleic acid content in the sample decreases, very clear bands will appear on the test line and the quality control line on the test strip at the same time; when the template dilution is 10 -10 When the test strip was tested, only the quality control line showed a red line, and only the quality control line of the negative control also showed a red line. The experiment was repeated three times, and the results showed the same pattern. This shows that the detection limit of the test strip method for Nipah virus is 18.746copy / μL.

[0078] Example 3: Specificity of RT-RAA-CRISPR / Cas13a method for detecting Nipah virus

[0079] 1. Common swine disease virus nucleic acids such as Seneca virus (SVA), foot-and-mouth disease virus (FMDV), classical swine fever virus (CSFV), porcine epidemic diarrhea virus (PEDV), African swine fever virus (ASFV), and pseudorabies virus (PRV) were selected to compare with Nipah virus RNA standards to verify the specificity of the fluorescence method and test strip method. ddH2O was used as a negative control.

[0080] 2. The RT-RAA amplification was performed using the method for screening the best primer pair in Example 3. After the amplification was completed, 5 μL of the RT-RAA product was taken to prepare the fluorescence method and the test strip method detection system of RT-RAA-CRISPR / Cas13a.

[0081] When the reporter molecule is a fluorescent reporter molecule, whether the sample to be tested contains Nipah virus is determined based on the fluorescence and fluorescence value of the product after the CRISPR / Cas13a reaction. Fig. 9 , Fig.10 The results showed that only the reaction product of the Nipah virus positive control showed obvious green fluorescence, while the samples of other control viruses and the negative control did not produce green fluorescence, which proved that the fluorescence detection method designed by the present invention has high specificity;

[0082] When the reporter molecule is a biotin reporter molecule, whether the sample to be tested contains Nipah virus is determined based on the test result of the test strip inserted into the product after the CRISPR / Cas13a reaction. Fig.11 The results showed that only the reaction product detection line and the quality control line of the Nipah virus positive control had obvious red lines, while only the quality control line of the samples of other control viruses and the negative control had red lines, which proved that the test strip detection method designed by the present invention has high specificity.

[0083] In summary, the present invention combines RT-RAA technology with CRISPR / Cas13a technology to achieve high-sensitivity, high-specificity, and low-complexity visual detection of Nipah virus.

[0084] The above is only a preferred embodiment of the present invention, and does not limit the present invention in other forms. Any technician familiar with the profession may use the above disclosed technical content to change or modify it into an equivalent embodiment with equivalent changes. However, any simple modification, equivalent change and modification made to the above embodiment according to the technical essence of the present invention without departing from the technical solution of the present invention still belongs to the protection scope of the technical solution of the present invention.

Claims

1. An RT-RAA primer pair for detecting Nipah virus, characterized in that: The sequence of the nucleic acid fragment detected by the primer pair is SEQ ID NO:

1.

2. The RT-RAA primer pair according to claim 1, characterized in that: The upstream primer of the RT-RAA primer pair has a sequence of SEQ ID NO: 2 and a sequence of the downstream primer of SEQ ID NO:

3.

3. Use of the RT-RAA primer pair described in claim 1 in preparing an RT-RAA-CRISPR / Cas13a detection preparation for detecting Nipah virus.

4. A RT-RAA-CRISPR / Cas13a detection preparation, characterized in that The detection preparation also includes CRISPR-Cas13a protein, crRNA, reporter molecules and lateral flow test paper.

5. The detection preparation according to claim 4, characterized in that The sequence of the crRNA is SEQ ID NO:

4.

6. The detection preparation according to claim 4, characterized in that The sequence of the reporter molecule is 5′-UUUUUUUUUUU-3′.

7. The detection preparation according to claim 4, characterized in that The two ends of the reporter molecule are respectively labeled with FAM and BHQ1; or the two ends are respectively labeled with FAM and biotin.

8. A method for detecting Nipah virus, characterized in that: The method is to use the detection preparation described in claim 4 for detection.

9. The method according to claim 8, characterized in that The method, when the reporter molecule is a fluorescent reporter molecule, uses the nucleic acid of the sample to be tested as a template, uses an RT-RAA primer pair to perform an RT-RAA reaction to obtain an amplification product, uses a fluorescent reporter molecule and crRNA to perform a CRISPR / Cas13a reaction on the amplification product to obtain a reaction product, and determines whether the sample to be tested contains Nipah virus based on the fluorescence and fluorescence value of the reaction product, that is, observes the reaction product under a blue light / ultraviolet light with a wavelength of 440-460nm / 400nm, if the reaction product produces green fluorescence, the sample to be tested contains Nipah virus, if the reaction product does not produce green fluorescence, the sample to be tested does not contain Nipah virus.

10. The method according to claim 8, characterized in that In the method, when the reporter molecule is a biotin reporter molecule, the nucleic acid of the sample to be tested is used as a template, and an RT-RAA primer pair is used to perform an RT-RAA reaction to obtain an amplification product. The amplification product is subjected to a CRISPR / Cas13a reaction using a biotin reporter molecule and crRNA to obtain a reaction product. The product after the CRISPR / Cas13a reaction is diluted with dd H2O at a ratio of 1:1, and a test strip is inserted into the diluted mixture for 10 minutes to read the test result. If the test line does not show color and the quality control line is visible to the naked eye, it is judged to be positive, and the sample to be tested contains Nipah virus, indicating that the nucleic acid probe is almost completely cut by the Cas enzyme. If the test line is colored and the quality control line is visible to the naked eye, it is judged to be positive, and the sample to be tested contains Nipah virus, indicating that part of the nucleic acid probe is cut by the Cas enzyme. If the test line is colored and the quality control line is not colored, it is judged to be negative, and the sample to be tested does not contain Nipah virus, indicating that the nucleic acid probe is not cut by the Cas enzyme. If both the test line and the quality control line are not colored, it indicates that the test result is invalid.

Images