Respiratory syncytial virus antigenic polypeptide, nucleic acid, vaccine and application thereof

Abstract

The invention provides a respiratory syncytial virus antigenic polypeptide, nucleic acid, a vaccine and application thereof. The invention firstly provides a respiratory syncytial virus antigenic polypeptide or an immunogenic fragment thereof, and the respiratory syncytial virus antigenic polypeptide has at least 26th-470th or full-length amino acid sequence as shown in SEQ ID NO: 1, or a derivative amino acid sequence which is formed by replacing, deleting or adding one or more amino acids on the basis of the amino acid sequences and has the same function. According to the invention, the pre-F immunogenicity can be improved and / or the protein expression level can be improved.

Description

Technical Field

[0001] The invention relates to a respiratory syncytial virus antigenic polypeptide, nucleic acid, vaccine and application thereof. Background Art

[0002] Respiratory syncytial virus (RSV) is a single-stranded negative-sense RNA virus that encodes 11 proteins. Based on the antigenic drift of the G protein, RSV can be divided into two subtypes, A and B. The F protein sequence of RSV is relatively conservative, but changes in splicing and fusion conformation occur during the infection of host cells.

[0003] Human respiratory syncytial virus (hRSV) can cause diseases including the upper respiratory tract, trachea, bronchi, bronchioles, alveoli, pleura and pleural cavity, as well as the nerves and muscles of breathing. RSV can be spread by respiratory droplets or infected pollutants, and can be transmitted to the lower respiratory tract through the nasopharynx or upper respiratory tract mucosa to induce severe infection (low respiratory tract infection, LRTI). RSV infection will first cause cold-like symptoms, such as runny nose, loss of appetite, cough, sneezing, fever, wheezing, infection, and these symptoms usually occur in stages.

[0004] RSV is the most common cause of bronchiolitis and pneumonia in children under 1 year old. A minority of infants infected with RSV may experience symptoms such as irritability, decreased activity, and difficulty breathing. If a more serious infection develops, it can develop into bronchiolitis, inflammation of the small airways in the lungs, pneumonia, and lung infection. Symptoms are more severe and may even lead to death in people with weakened immune systems, the elderly, and those with lung disease and heart failure. RSV-infected people may experience difficulty breathing or dehydration, and in severe cases may require additional oxygen or intubation and mechanical ventilation. If the condition continues to worsen, chronic obstructive pulmonary disease (COPD) will occur, as well as serious complications of the respiratory and other systems, including pneumonia, apnea, respiratory failure, heart failure, etc., which can develop into a serious and fatal disease within a year.

[0005] The most important reason why there has been no RSV vaccine product on the market for decades is the lack of effective antigen design. Long-term work results show that the RSV surface F glycoprotein is the most conservative among different strains and induces higher neutralizing antibody titers. In 2013, the National Institutes of Health (NIH) of the United States showed that the metastable F protein has conformational changes before and after fusion. The most important thing is the site with the highest antibody affinity. and site V only exist in the metastable conformation before the fusion of F protein (pre-F). The NIH research team achieved the purpose of stabilizing pre-F by introducing cysteine ​​at positions 155 and 290 to form disulfide bonds. In addition, the replacement of long-chain hydrophobic amino acids at the antibody binding position can also achieve the purpose of stabilization. The team finally obtained the excellent pre-F antigen, Ds-CaV1, through a combination of replacements at multiple positions. In 2016, the NIH team continued to optimize the structure and sequence on the existing basis, introducing GS linker at positions 104-144 to eliminate the allosteric effects of pep27 and fusion peptides, and introducing cysteine ​​at positions 149 and 458 to achieve the stability of the F protein trimer, thereby further improving the immunogenicity of the antigen. The clinical results of protein vaccines based on these mutations show a good protection rate, but judging from the data, there is still a lot of room for improvement. The application of mRNA technology is likely to improve the immunogenicity of antigens at the technical level.

[0006] CN10847235A discloses RSV antigenic polypeptides. Based on the work of NIH (GS linker + two groups of cysteine ​​+ two cavity fillings), the transmembrane region is retained, and the secretory protein is transformed into a membrane protein, which obtains better clinical results, indicating that the C-terminus of the transmembrane protein and the F protein helps to improve the immunogenicity of the antigen. In addition, the clinical results also show the high immunogenicity characteristics unique to mRNA technology.

[0007] The results of many years of research have shown that it is difficult to identify new mutation sites that can maintain pre-F, making it difficult to achieve an increase in the titer of pre-F neutralizing antibodies from an antigenic perspective. Summary of the invention

[0008] One object of the present invention is to provide a respiratory syncytial virus (RSV) antigenic polypeptide that can improve the immunogenicity of pre-F and / or help improve the protein expression level.

[0009] Another object of the present invention is to provide the application of the respiratory syncytial virus antigenic polypeptide.

[0010] Another object of the present invention is to provide a respiratory syncytial virus vaccine.

[0011] Another object of the present invention is to provide the application of the respiratory syncytial virus vaccine.

[0012] On the one hand, the present invention provides a respiratory syncytial virus antigenic polypeptide or an immunogenic fragment thereof, wherein the respiratory syncytial virus antigenic polypeptide has at least the 26th to 470th amino acid sequence or the full-length amino acid sequence shown in SEQ ID NO:1, or a derivative amino acid sequence with equivalent function formed by replacing, deleting or adding one or several amino acids on the basis of these amino acid sequences.

[0013] According to a specific embodiment of the present invention, the respiratory syncytial virus antigenic polypeptide of the present invention has at least the 25-470th position, at least the 24th-470th position, at least the 23rd-470th position, at least the 22nd-470th position, at least the 26th-510th position, at least the 25th-510th position, at least the 24th-510th position, at least the 23rd-510th position or at least the 22nd-510th amino acid sequence shown in SEQ ID NO:1.

[0014] According to a specific embodiment of the present invention, the immunogenic fragment of the respiratory syncytial virus antigenic polypeptide of the present invention refers to a fragment of a partial amino acid sequence derived from the respiratory syncytial virus antigenic polypeptide and capable of causing an immune response to RSV. That is, the immunogenic fragment has a truncated amino acid sequence compared to the respiratory syncytial virus antigenic polypeptide of the present invention. Preferably, the immunogenic fragment has the same mutation site as the respiratory syncytial virus antigenic polypeptide of the present invention.

[0015] According to a specific embodiment of the present invention, in the respiratory syncytial virus antigenic polypeptide or immunogenic fragment thereof of the present invention, the equivalent function includes promoting the improvement of pre-F immunogenicity and / or promoting the improvement of pre-F protein expression level.

[0016] According to a specific embodiment of the present invention, in the respiratory syncytial virus antigenic polypeptide or its immunogenic fragment of the present invention, the derived amino acid sequence is selected from at least the 26th to 470th amino acid sequence or the full-length amino acid sequence shown in any one of SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:9, SEQ ID NO:13, SEQ ID NO:15 or SEQ ID NO:16.

[0017] In the present invention, positions 1-21, 1-22, 1-23, 1-24 or 1-25 of the amino acid sequence shown in SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 9, SEQ ID NO: 13, SEQ ID NO: 15 or SEQ ID NO: 16 are generally considered to be signal peptides. Positions 471-510 of the amino acid sequence shown in SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 9, SEQ ID NO: 13, SEQ ID NO: 15 or SEQ ID NO: 16 are generally considered to be transmembrane regions.

[0018] According to a specific embodiment of the present invention, the immunogenic fragment of the respiratory syncytial virus antigenic polypeptide of the present invention has a mutation site that is the same as the mutation site of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 9, SEQ ID NO: 13, SEQ ID NO: 15 or SEQ ID NO: 16 compared to the wild-type pre-F protein.

[0019] On the other hand, the present invention also provides a polynucleotide encoding the amino acid sequence of the respiratory syncytial virus antigenic polypeptide or its immunogenic fragment described in the present invention.

[0020] According to some specific embodiments of the present invention, the polynucleotide of the present invention is DNA or RNA. The RNA may be mRNA or self-replicating RNA.

[0021] According to some specific embodiments of the present invention, the sequence of the polynucleotide encoding the respiratory syncytial virus antigenic polypeptide of the present invention is shown in any one of SEQ ID No.18, SEQ ID No.19, SEQ ID No.20, SEQ ID No.26, SEQ ID No.30, SEQ ID No.32, and SEQ ID No.33.

[0022] According to some specific embodiments of the present invention, the sequence of the polynucleotide encoding the immunogenic fragment of the respiratory syncytial virus antigenic polypeptide is a fragment from the sequence shown in SEQ ID No. 18, SEQ ID No. 19, SEQ ID No. 20, SEQ ID No. 26, SEQ ID No. 30, SEQ ID No. 32, and SEQ ID No. 33. That is, the polynucleotide encoding the immunogenic fragment of the respiratory syncytial virus antigenic polypeptide has a truncated nucleotide sequence compared to the polynucleotide encoding the respiratory syncytial virus antigenic polypeptide of the present invention.

[0023] On the other hand, the present invention also provides the use of the respiratory syncytial virus antigenic polypeptide or the immunogenic fragment thereof or the polynucleotide in the preparation of a respiratory syncytial virus vaccine.

[0024] On the other hand, the present invention also provides a respiratory syncytial virus vaccine, comprising:

[0025] at least one mRNA having an open reading frame encoding a respiratory syncytial virus antigenic polypeptide or an immunogenic fragment thereof according to the present invention, and

[0026] A pharmaceutically acceptable carrier.

[0027] According to some specific embodiments of the present invention, the respiratory syncytial virus vaccine of the present invention has one or more of the following characteristics:

[0028] The open reading frame is codon optimized; preferably, the codon optimization is as shown in SEQ ID No.18, SEQ ID No.19, SEQ ID No.20, SEQ ID No.26, SEQ ID No.30, SEQ ID No.32, SEQ ID No.33;

[0029] The open reading frame also has a sequence encoding a signal peptide connected to the RSV antigenic polypeptide or an immunogenic fragment thereof; preferably, the amino acid sequence of the signal peptide is as shown in positions 1-21, 1-22, 1-23, 1-24 or 1-25 of SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:9, SEQ ID NO:13, SEQ ID NO:15 or SEQ ID NO:16;

[0030] The open reading frame also has a sequence encoding a transmembrane region connected to the RSV antigenic polypeptide or an immunogenic fragment thereof; preferably, the amino acid sequence of the transmembrane region is as shown in positions 471-510 of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 9, SEQ ID NO: 13, SEQ ID NO: 15 or SEQ ID NO: 16;

[0031] The at least one mRNA comprises at least one chemical modification; preferably, the chemical modification is selected from the group consisting of pseudouridine, N1-methylpseudouridine, N1-ethylpseudouridine, 2-thiouridine, 4′-thiouridine, 5-methylcytosine, 2-thio-1-methyl-1-deaza-pseudouridine, 2-thiol-1-methyl-pseudouridine, 2-thiol-5-aza-uridine, 2-thiol-dihydropseudouridine, 2-thiol-dihydrouridine, 2-thiol-pseudouridine, 4-methoxy-2-thiol-pseudouridine, 4-methoxy-pseudouridine, 4-thiol-1-methyl-pseudouridine, 4-thiol-pseudouridine, 5-aza-uridine, dihydropseudouridine, 5-methoxyuridine and 2′-O-methyluridine; preferably, at least 80%, at least 90% or 100% of the uracils in the open reading frame have a chemical modification;

[0032] The at least one mRNA comprises at least one 5′ end cap structure;

[0033] The at least one mRNA comprises a 3′ polyA tail;

[0034] The vaccine is formulated in nanoparticles; preferably, the nanoparticles have an average diameter of 50 nm to 200 nm; preferably, the nanoparticles are lipid nanoparticles; preferably, the lipid nanoparticles comprise cationic lipids, PEG-modified lipids, sterols and non-cationic lipids; preferably, wherein the cationic lipids are ionizable cationic lipids, the non-cationic lipids are neutral lipids, and the sterols are cholesterol.

[0035] The experiments of the present invention show that the respiratory syncytial virus antigenic polypeptide or its immunogenic fragment of the present invention and the polynucleotide encoding the respiratory syncytial virus antigenic polypeptide or its immunogenic fragment of the present invention having the mutation site can achieve the improvement of pre-F immunogenicity and / or help to improve the protein expression level. BRIEF DESCRIPTION OF THE DRAWINGS

[0036] Figure 1 The quantitative statistics of RSV F protein expression levels in each group in Example 1. The data unit in the figure is ng / 100 μL.

[0037] Figure 2 This is the detection of binding antibody titer 14 days after the mice were immunized in Example 2.

[0038] Figure 3 The figures are for the binding antibody titers of mice immunized 28 days after the mice were immunized in Example 2.

[0039] Figure 4 The neutralizing antibody titer statistics of mice in Example 3 28 days after immunization. DETAILED DESCRIPTION

[0040] In order to have a clearer understanding of the technical features, purposes and beneficial effects of the present invention, the technical solution of the present invention is now described in detail below, but it should not be understood as limiting the scope of the present invention. The experimental methods without specific conditions in each embodiment are operated according to the conventional conditions in the field or the conditions recommended by the instrument manufacturer's instructions.

[0041] The present invention provides a variety of RSV F variants based on wild-type (WT) RSV F. The amino acid and encoding nucleotide sequences of each variant and wild-type RSV F are shown in Table 1.

[0042] Table 1

[0043]

[0044]

[0045] Example 1

[0046] In this example, the expression level of RSV F glycoprotein before fusion on the cell surface was detected by double antibody sandwich ELISA using antibodies specific to RSV F glycoprotein before fusion (D25, Mota), and the effect of each RSV F variant on the expression level of RSV pre-F was investigated.

[0047] 1. mRNA transfection into cells

[0048] 293T cells (293T cells were cultured in 6-well plates, with about 2 million cells per well) were transfected with 4 μg of mRNA of different sequences (SEQ ID No. 18-SEQ ID No. 34) (each mRNA was prepared according to conventional techniques in the art). The culture was terminated after 24 hours, and the intracellular proteins were collected and the total protein was quantified.

[0049] 2. Enzyme-linked immunosorbent assay (ELISA) to measure antigen expression

[0050] ① Antibody coated ELISA plate:

[0051] Take out the packaged antibody protein (Mota) from the refrigerator, dilute it to 2 μg / mL with Coating Buffer, Research Grade Motavizumab (DVV02803), take a 96-well plate (Greiner, 655061), add 100 μL to each well, cover the ELISA plate, and coat it in a refrigerator at 2-8°C overnight.

[0052] Take out the coated 96-well plate, pour off the coating solution, remove the excess solution to ensure that there is no residue in the well. Add 1× Washing Buffer diluted with ultrapure water to wash the plate, with a volume of 300μL per well, and repeat the wash 3 times. After firmly tapping the remaining liquid on absorbent paper, add blocking solution, 300μL per well, then seal the plate with a sealing film and incubate at 37℃ for 2h.

[0053] ② Add the sample to be tested:

[0054] First dilute the protein stock solution (cell lysate) in step 1 to 1-2 μg / μL, and then conduct the antigen test experiment. Especially for samples with unknown protein expression, previous studies recommend the use of gradient dilution method for preparation, and the gradient dilution multiples of the diluted samples are set to 40, 80, 160, 320, 640, 1280, and 2560 times.

[0055] Take out the sealed 96-well plate and remove the remaining liquid after washing. Add 100μl of sample diluent to the blank well, and add 100μl of standard or sample to be tested to the remaining wells (be careful not to have bubbles, add the sample to the bottom of the ELISA plate well, try not to touch the well wall, and one plate should be loaded with samples within 10 minutes). Cover the ELISA plate with film and react at 37℃ for 2h. To ensure the validity of the experimental results, please use a new standard solution for each experiment.

[0056] ③Add detection antibody:

[0057] Take out the blocked 96-well plate, pour off the coating solution, clean up the residual liquid and wash 5 times. Dilute the detection antibody Anti-HRSV-A F / Fusion glycoprotein F0 Antibody (D25) (RVV02809) - Bioti (concentration of 0.79 mg / ml) at 1:2000 times, add the diluted antibody to the 96-well plate at a volume of 100 μL per well, seal the plate with a sealing film, and incubate at 37°C in the dark for 1 hour.

[0058] ④Add substrate solution:

[0059] Take out the 96-well plate after adding the detection antibody, pour off the coating solution, and clean the residual liquid 5 times. Dilute HRP-conjugated Streptavidin (SA00001-0) at a ratio of 1:10000, add the diluted HRP-conjugated Streptavidin to the 96-well plate at a volume of 100 μL per well, seal the plate with a sealing film, and incubate at 37°C in the dark for 30 minutes.

[0060] ⑤ Color development and detection of OD value:

[0061] Turn off the indoor light source, take out the 96-well plate after incubation with the secondary antibody, pour out the primary antibody liquid and wash 5 times. Take out the disposable sample loading tank and put it in a light-proof box, pour the TMB solution into the sample loading tank, add 100μL TMB to each well with a discharge gun, and color for 20 minutes in the dark (do not exceed 25 minutes). At this time, the positive sample will appear blue. The sample must record the liquid addition time and the waiting time for each plate to prevent experimental errors. After the color development time is up, add 100μL Stop Solution to each well with a discharge gun. At this time, the sample will first appear yellow. Measure its absorbance at 450nm. Please read the plate within two minutes after adding Stop solution to each plate, otherwise the absorbance of the blank well will increase and the absorbance of the sample well will decrease. The program setting of the microplate reader is an absorbance value of 450nm and low-speed shaking for 5s.

[0062] The results of the pre-fusion RSV F glycoprotein detection on the cell surface can be found in Figure 1 and Table 2.

[0063] Table 2. RSV F glycoprotein detection results (ng / 100 μL)

[0064]

[0065] The results show that the RSV F variant of the present invention contributes to the increase in the expression amount of RSV pre-F.

[0066] Example 2

[0067] This example takes minpos7 in Example 1 as an example to investigate the in vivo immunogenicity (mouse binding antibodies) of the RSV F variants of the present invention in mice.

[0068] 1. Methods and Grouping

[0069] The in vitro synthesis of mRNA for the experiment was carried out according to the conventional operation in the art. In this embodiment, the target mRNA molecule of minpos7, in addition to the coding sequence (SEQ ID No. 18), also includes 5'UTR (GGAGATAAGAGAGAAAAGAAGAGTAAGAAGAAATATAAGAGCCGCCACC, SEQ ID No. 35) and 3'UTR (GCTGCCTTCTGCGGGGCTTGCCTTCTGGCCATGCCCTTCTTCTCTCCCTTGCACCTGTACCTCTTGGTCTTTGAATAAAGCCTGAGTAGGAAG, SEQ ID No. 36), 5'CAP is Cap2-6 (structure see formula I), 3' plus Poly A tail (AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA, SEQ ID No. 37), 100% m1ψ modification.

[0070]

[0071]

[0072] The target mRNA of minpos7 was encapsulated in T19-5 LNP (the composition and molar ratio of T19-5 LNP were: T19 of the structural formula II, 48%; DSPC, 16%; DMG-PEG2000, 1.5%; CHOL, 34.5%), with a particle size of about 100 nm, and injected intramuscularly (IM) into eight-week-old BALB / c mice (n=10 per group). The mRNA was administered at intervals of 2 weeks, with a single injection dose of 5 μg, and serum was collected every week. The serum binding antibody titers against D14 and D28 pre-F glycoproteins were determined by ELISA.

[0073] Prefusion F-specific IgG titers were measured two weeks after the first administration (i.e., 14 days after mice were immunized) and two weeks after the second administration (i.e., 28 days after mice were immunized).

[0074] 2. The specific experimental process is as follows:

[0075] ① Sample dilution

[0076] Blood was collected from the edge of the mouse eye, and the supernatant was collected by high-speed centrifugation, not less than 50 μL. Dilute serum (primary antibody): dilute the sample to a gradient of 4000x, 40000x, 400000x, 4000000x, 8000000x, 20000000x, 40000000x. The dilution method of serum can refer to the following steps: The control serum CK dilution gradient is 40x, 400x, 4000x, and the operation steps of adding liquid are the same as those of serum. Note that a control should be set for each 96-well plate.

[0077] ② ELISA

[0078] Take out the pre-F protein from the refrigerator, dilute it to 2μg / mL with Coating Buffer, HRSV (A) Fusion glycoprotein F0, His Tag (RSF-V52H7), take a 96-well plate (Greiner, 655061), add 100μL to each well, cover the ELISA plate, and coat it overnight in a refrigerator at 2-8℃. Take out the coated 96-well plate, pour the coating solution, remove the excess solution to ensure that there is no residue in the well. Wash the plate with ultrapure water diluted to 1× Washing Buffer, with a volume of 300μL per well, and repeat washing 3 times. After firmly tapping the residual liquid on absorbent paper, add blocking solution, 300μL per well, then seal the plate with a sealing film, and incubate at 37℃ for 2h.

[0079] Take out the coated 96-well plate and pour off the coating solution to ensure that there is no residue in the wells. Wash the plate with 1× Washing Buffer diluted with ultrapure water, with a volume of 300 μL per well, and repeat the wash 3 times. After removing the residual liquid, add Blockingdiluent, 300 μL per well, then seal the plate with a sealing film and incubate at 4°C for 2 hours.

[0080] Pour off the coating solution and clean up the residual liquid; add the diluted test serum sample and the control group serum sample, take each sample three times, 100μL each time, and make 3 parallel replicates. Note that a blank control and CK must be set up for each plate.

[0081] Dilute Goat pab to Ms IgG (HRP) with Dilution buffer, 1:10000 dilution (the dilution multiple needs to be diluted according to the instructions), and shake to mix. Take out the 96-well plate after incubation with the primary antibody, pour off the primary antibody liquid, and clean the residual liquid until there is no residue in the well. Wash the plate 5 times with a plate washer to clean the residual liquid; add the diluted antibody to the 96-well plate at a volume of 100 μL per well, seal the plate with a sealing film, and incubate at room temperature in the dark for 1 hour.

[0082] Turn off the indoor light source, take out the 96-well plate after incubation with the secondary antibody, pour out the primary antibody liquid and wash 5 times. Take out the disposable sample loading tank and put it in a light-proof box, pour the TMB solution into the sample loading tank, add 100μL TMB to each well with a discharge gun, and color for 20 minutes in the dark (do not exceed 25 minutes). At this time, the positive sample will appear blue. The sample must record the liquid addition time and the waiting time for each plate to prevent experimental errors. After the color development time is up, add 100μL Stop Solution to each well with a discharge gun. At this time, the sample will first appear yellow. Measure its absorbance at 450nm. Please read the plate within two minutes after adding Stop solution to each plate, otherwise the absorbance of the blank well will increase and the absorbance of the sample well will decrease. The program setting of the microplate reader is an absorbance value of 450nm and low-speed shaking for 5s.

[0083] Binding antibody titer test results are shown in Figure 2 and Figure 3 , showing that minpos7 of the present invention can induce higher pre-F binding antibody titers.

[0084] Example 3

[0085] This example provides a method of conducting neutralizing antibody detection on samples of the mice immunized 28 days after the mice were immunized in Example 2 to measure the level of RSV-A2 neutralizing antibodies in the serum of the immunized mice.

[0086] The main experimental operation is to inactivate the samples by warming them at 56°C for 30 minutes, and use the plaque reduction test (PRNT) to detect the anti-RSV neutralization titer in the serum.

[0087] RSV A2 strain (or RSV A2 strain with RFP fluorescent label) was diluted to about 80 plaque units (PFU) per inoculation dose, and an equal amount of progressively diluted serum was added. After 60 minutes at 37°C, 2 wells of a 24-well plate with cells that had formed a monolayer were inoculated at each dilution, 0.2 ml per well, and adsorbed at 37°C for 2 hours. The inoculation solution was poured off, and a culture medium containing 0.8% methylcellulose pre-warmed at 37°C was added, and the plate was cultured at 37°C for 72 hours. The number of plaques formed by virus infection in each well was counted by the antibody immunoplaque method (or fluorescent plaque), and the neutralizing titer of the serum that reduced the plaques by 50% was calculated.

[0088] Neutralization titer test results are shown in Figure 4 As shown. Figure 3 and Figure 4 It can be seen that the titer of the minpos7 antigen-binding antibody involved in the present invention is significantly different from that of WT. Figure 4The results showed that the minpos7 antigen designed by the present invention can induce a higher level of neutralizing antibody titer compared with the wild type.

Claims

1. A respiratory syncytial virus antigenic polypeptide or an immunogenic fragment thereof, wherein: The respiratory syncytial virus antigenic polypeptide has at least the 26th to 470th amino acid sequence or the full-length amino acid sequence shown in SEQ ID NO: 1, or a derivative amino acid sequence with equivalent function formed by replacing, deleting or adding one or more amino acids on the basis of these amino acid sequences.

2. The respiratory syncytial virus antigenic polypeptide or immunogenic fragment thereof according to claim 1, wherein: The respiratory syncytial virus antigenic polypeptide has at least the 25th-470th position, at least the 24th-470th position, at least the 23rd-470th position, at least the 22nd-470th position, at least the 26th-510th position, at least the 25th-510th position, at least the 24th-510th position, at least the 23rd-510th position or at least the 22nd-510th amino acid sequence shown in SEQ ID NO:

1.

3. The respiratory syncytial virus antigenic polypeptide or immunogenic fragment thereof according to claim 1, wherein: The derived amino acid sequence is selected from at least the 26th to 470th amino acid sequence or the full-length amino acid sequence shown in any one of SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:10, SEQ ID NO:13, SEQ ID NO:15 or SEQ ID NO:

16.

4. The respiratory syncytial virus antigenic polypeptide or immunogenic fragment thereof according to claim 1, wherein: The equivalent functions include promoting the improvement of pre-F immunogenicity and / or promoting the improvement of pre-F protein expression level.

5. The respiratory syncytial virus antigenic polypeptide or immunogenic fragment thereof according to claim 1, wherein: The immunogenic fragment has the same mutation site as the mutation site of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 10, SEQ ID NO: 13, SEQ ID NO: 15 or SEQ ID NO: 16 compared to the wild-type pre-F protein.

6. A polynucleotide encoding the amino acid sequence of the respiratory syncytial virus antigenic polypeptide or an immunogenic fragment thereof according to any one of claims 1 to 5.

7. The polynucleotide according to claim 6, which is DNA or RNA; Preferably, the sequence of the polynucleotide encoding the respiratory syncytial virus antigenic polypeptide is shown in any one of SEQ ID No.18, SEQ ID No.19, SEQ ID No.20, SEQ ID No.26, SEQ ID No.30, SEQ ID No.32, and SEQ ID No.

33.

8. Use of the respiratory syncytial virus antigenic polypeptide or immunogenic fragment thereof according to any one of claims 1 to 5 or the polynucleotide according to claim 6 or 7 in the preparation of a respiratory syncytial virus vaccine.

9. A respiratory syncytial virus vaccine comprising: at least one mRNA having an open reading frame encoding a respiratory syncytial virus antigenic polypeptide or an immunogenic fragment thereof according to any one of claims 1 to 5, and A pharmaceutically acceptable carrier.

10. The vaccine according to claim 9, having one or more of the following characteristics: The open reading frame is codon optimized; The open reading frame also has a sequence encoding a signal peptide linked to a respiratory syncytial virus antigenic polypeptide or an immunogenic fragment thereof; The open reading frame also has a sequence encoding a transmembrane region connected to a respiratory syncytial virus antigenic polypeptide or an immunogenic fragment thereof; The at least one mRNA comprises at least one chemical modification; preferably, the chemical modification is selected from the group consisting of pseudouridine, N1-methylpseudouridine, N1-ethylpseudouridine, 2-thiouridine, 4′-thiouridine, 5-methylcytosine, 2-thio-1-methyl-1-deaza-pseudouridine, 2-thiol-1-methyl-pseudouridine, 2-thiol-5-aza-uridine, 2-thiol-dihydropseudouridine, 2-thiol-dihydrouridine, 2-thiol-pseudouridine, 4-methoxy-2-thiol-pseudouridine, 4-methoxy-pseudouridine, 4-thiol-1-methyl-pseudouridine, 4-thiol-pseudouridine, 5-aza-uridine, dihydropseudouridine, 5-methoxyuridine and 2′-O-methyluridine; preferably, at least 80%, at least 90% or 100% of the uracils in the open reading frame have a chemical modification; The at least one mRNA comprises at least one 5′ end cap structure; The at least one mRNA comprises a 3′ polyA tail; The vaccine is formulated in nanoparticles; preferably, the nanoparticles have an average diameter of 50 nm to 200 nm; preferably, the nanoparticles are lipid nanoparticles; preferably, the lipid nanoparticles comprise cationic lipids, PEG-modified lipids, sterols and non-cationic lipids; preferably, wherein the cationic lipids are ionizable cationic lipids, the non-cationic lipids are neutral lipids, and the sterols are cholesterol.

Images