Antigenic respiratory syncytial virus polypeptide, nucleic acid, and vaccine

Abstract

An antigenic respiratory syncytial virus polypeptide, a nucleic acid, and a vaccine. Compared with a respiratory syncytial virus wild-type Pre-F protein, the antigenic respiratory syncytial virus polypeptide or an immunogenic fragment thereof has the following changes of amino acid sites: replacing the 104th-144th areas of the Pre-F protein with a GS linker; introducing two groups of disulfide bonds into S155C, S290C, A149C, and Y458C; enabling S190F and V207L to implement cavity filling; and P102A, L373R, I379V, and M447V. Moreover, the C terminal comprises a cytoplasmic tail fragment, and the cytoplasmic tail fragment is a continuous 3-10 amino acid residue fragment derived from the cytoplasmic tail of the Pre-F protein. The improvement of the immunogenicity and / or stability of the Pre-F can be realized, and the increase of the protein expression level is facilitated.

Description

Respiratory syncytial virus antigenic peptides, nucleic acids and vaccines Technical Field

[0001] The present invention relates to a respiratory syncytial virus antigenic polypeptide, nucleic acid and vaccine, as well as related applications thereof. Background Art

[0002] Respiratory syncytial virus (RSV) is a single-stranded, negative-sense RNA virus that encodes 11 proteins. Based on antigenic drift within the G protein, RSV is divided into subtypes A and B. The RSV F protein sequence is relatively conserved, but undergoes splicing and fusion conformational changes during infection.

[0003] Human respiratory syncytial virus (hRSV) can cause diseases including the upper respiratory tract, trachea, bronchi, bronchioles, alveoli, pleura and pleural cavity, as well as the nerves and muscles of breathing. RSV can be spread by respiratory droplets or infected pollutants, and can be passed to the lower respiratory tract through the nasopharynx or upper respiratory tract mucosa to induce severe infection (low respiratory tract infection, LRTI). RSV infection will first cause cold-like symptoms, such as runny nose, loss of appetite, cough, sneezing, fever, wheezing, infection, and these symptoms usually occur in stages.

[0004] RSV is the most common cause of bronchiolitis and pneumonia in children under one year old. A small number of infants infected with RSV may experience symptoms such as irritability, decreased activity, and difficulty breathing. If the infection becomes more serious, it can develop into bronchiolitis, inflammation of the small airways in the lungs, pneumonia, and lung infection. For people with weakened immune systems, the elderly, and those with lung disease and heart failure, the symptoms are more severe and may even lead to death. RSV-infected people may experience difficulty breathing or dehydration, and in severe cases, may require additional oxygen or intubation and mechanical ventilation. If the condition continues to worsen, chronic obstructive pulmonary disease (COPD) will occur, as well as serious complications of the respiratory and other systems, including pneumonia, apnea, respiratory failure, heart failure, etc., which can develop into a serious and fatal disease within a year.

[0005] The most important reason why there has been no RSV vaccine product on the market for decades is the lack of effective antigen design. Long-term research results show that the RSV surface F glycoprotein is the most conserved among different strains and induces high neutralizing antibody titers. In 2013, the National Institutes of Health (NIH) of the United States found that the metastable F protein undergoes conformational changes before and after fusion, and the most important site is the site with the highest antibody affinity. Site V exists only in the metastable conformation before fusion with the F protein (pre-F). The NIH research team stabilized the pre-F antigen by introducing cysteines at positions 155 and 290 to form disulfide bonds. Furthermore, substitutions at the antibody-binding site with long hydrophobic amino acids also achieved stabilization. Through a combination of substitutions at multiple positions, the team ultimately obtained the highly effective pre-F antigen, Ds-CaV1. In 2016, the NIH team continued to optimize the structure and sequence, introducing a GS linker at positions 104-144 to eliminate the allosteric effects of pep27 and the fusion peptide, and cysteines at positions 149 and 458 to stabilize the F protein trimer, further enhancing the antigen's immunogenicity. Clinical trials using protein vaccines based on these mutations have shown good protection rates, but the data suggest significant room for improvement. The application of mRNA technology has the potential to improve the antigen's immunogenicity at a technical level.

[0006] CN10847235A discloses RSV antigenic peptides. Building on the NIH work (GS linker + two groups of cysteines + two cavity fillings), the transmembrane region was retained, transforming the secreted protein into a membrane protein. This resulted in superior clinical results, demonstrating that the transmembrane protein and the C-terminus of the F protein contribute to enhanced antigen immunogenicity. Furthermore, the clinical results demonstrate the high immunogenicity unique to mRNA technology.

[0007] Years of research have shown that it is difficult to identify new mutation sites that can maintain pre-F, making it difficult to increase the titer of pre-F neutralizing antibodies from an antigenic perspective.

[0008] Summary of the Invention

[0009] One object of the present invention is to provide a respiratory syncytial virus (RSV) antigenic polypeptide that can achieve improved pre-F immunogenicity, improved stability, and / or help improve protein expression levels.

[0010] Another object of the present invention is to provide the respiratory syncytial virus antigenic nucleic acid.

[0011] Another object of the present invention is to provide an application of the respiratory syncytial virus antigenic polypeptide.

[0012] Another object of the present invention is to provide an application of the respiratory syncytial virus antigenic nucleic acid.

[0013] Another object of the present invention is to provide a respiratory syncytial virus vaccine.

[0014] Another object of the present invention is to provide an application of the respiratory syncytial virus vaccine.

[0015] In one aspect, the present invention provides a respiratory syncytial virus antigenic polypeptide or an immunogenic fragment thereof, which has the following amino acid changes compared to the wild-type Pre-F protein of respiratory syncytial virus:

[0016] The 104-144 region of the Pre-F protein was replaced with a GS linker; S155C, S290C, A149C, and Y458C introduced two disulfide bonds; S190F and V207L ​​achieved cavity filling; and P102A, L373R, I379V, and M447V;

[0017] Furthermore, the C-terminus of the respiratory syncytial virus antigenic polypeptide or the immunogenic fragment thereof comprises a cytoplasmic tail region fragment, and the cytoplasmic tail region fragment is a fragment of 3-10 consecutive amino acid residues derived from the cytoplasmic tail region of the Pre-F protein.

[0018] According to a specific embodiment of the present invention, the respiratory syncytial virus antigenic polypeptide or immunogenic fragment thereof of the present invention further has at least one of the following modifications compared to the respiratory syncytial virus Pre-F protein:

[0019] Cavity filling of V296F; and / or

[0020] One or more mutations among S46G, E92D, K465Q.

[0021] According to a specific embodiment of the present invention, the respiratory syncytial virus antigenic polypeptide or immunogenic fragment thereof of the present invention, wherein the cytoplasmic tail fragment is a fragment of 4-6 consecutive amino acid residues derived from the cytoplasmic tail of the Pre-F protein.

[0022] According to a specific embodiment of the present invention, the respiratory syncytial virus antigenic polypeptide or immunogenic fragment thereof of the present invention, wherein the cytoplasmic tail region fragment is CKARS.

[0023] According to a specific embodiment of the present invention, the immunogenic fragment of the respiratory syncytial virus antigenic polypeptide of the present invention refers to a fragment of a partial amino acid sequence derived from the respiratory syncytial virus antigenic polypeptide and capable of eliciting an immune response against RSV. That is, the immunogenic fragment has a truncated amino acid sequence compared to the respiratory syncytial virus antigenic polypeptide of the present invention. Preferably, the immunogenic fragment has the same mutation site as the respiratory syncytial virus antigenic polypeptide of the present invention.

[0024] According to a specific embodiment of the present invention, in the respiratory syncytial virus antigenic polypeptide or immunogenic fragment thereof of the present invention, the equivalent function includes promoting the improvement of pre-F immunogenicity, the improvement of stability and / or the promotion of the improvement of pre-F protein expression level compared to wild-type pre-F.

[0025] According to a specific embodiment of the present invention, the respiratory syncytial virus antigenic polypeptide or immunogenic fragment thereof of the present invention has at least the 26th to 515th or full-length amino acid sequence shown in SEQ ID NO: 1, SEQ ID NO: 2 or SEQ ID NO: 3, or a derivative amino acid sequence with equivalent function formed by replacing, deleting or adding one or more amino acids on the basis of these amino acid sequences.

[0026] In the present invention, positions 1-21, 1-22, 1-23, 1-24, or 1-25 of the amino acid sequence shown in SEQ ID NO: 1, SEQ ID NO: 2, or SEQ ID NO: 3 are generally considered to be signal peptides. Positions 471-510 of the amino acid sequence shown in SEQ ID NO: 1, SEQ ID NO: 2, or SEQ ID NO: 3 are generally considered to be transmembrane regions.

[0027] On the other hand, the present invention also provides a nucleic acid encoding the amino acid sequence of the respiratory syncytial virus antigenic polypeptide or an immunogenic fragment thereof of the present invention.

[0028] According to some specific embodiments of the present invention, the nucleic acid of the present invention is DNA or RNA. The RNA may be mRNA or self-replicating RNA.

[0029] According to some specific embodiments of the present invention, the sequence of the nucleic acid encoding the respiratory syncytial virus antigenic polypeptide of the present invention is shown in any one of SEQ ID No. 6 to SEQ ID No. 17.

[0030] According to some specific embodiments of the present invention, the sequence of the nucleic acid encoding the immunogenic fragment of the respiratory syncytial virus antigenic polypeptide is a fragment of the sequence shown in any one of SEQ ID No. 6 to SEQ ID No. 17. That is, the nucleic acid encoding the immunogenic fragment of the respiratory syncytial virus antigenic polypeptide has a truncated nucleotide sequence compared to the nucleic acid encoding the respiratory syncytial virus antigenic polypeptide of the present invention.

[0031] On the other hand, the present invention also provides the use of the respiratory syncytial virus antigenic polypeptide or the immunogenic fragment thereof or the nucleic acid in the preparation of a respiratory syncytial virus vaccine.

[0032] On the other hand, the present invention also provides a respiratory syncytial virus vaccine comprising:

[0033] at least one mRNA having an open reading frame encoding a respiratory syncytial virus antigenic polypeptide or an immunogenic fragment thereof according to the present invention, and

[0034] Pharmaceutically acceptable carrier.

[0035] According to some specific embodiments of the present invention, the respiratory syncytial virus vaccine of the present invention has one or more of the following characteristics:

[0036] The open reading frame is codon-optimized; preferably, the codon optimization is as shown in SEQ ID No.6, SEQ ID No.7, SEQ ID No.8, SEQ ID No.9, SEQ ID No.10, SEQ ID No.11, SEQ ID No.12, SEQ ID No.13, SEQ ID No.14, SEQ ID No.15, SEQ ID No.16 or SEQ ID No.17;

[0037] The open reading frame further comprises a sequence encoding a signal peptide connected to an RSV antigenic polypeptide or an immunogenic fragment thereof; preferably, the amino acid sequence of the signal peptide is as shown in positions 1-21, 1-22, 1-23, 1-24 or 1-25 of SEQ ID NO: 1, SEQ ID NO: 2 or SEQ ID NO: 3;

[0038] The at least one mRNA comprises at least one chemical modification; preferably, the chemical modification is selected from the group consisting of pseudouridine, N1-methylpseudouridine, N1-ethylpseudouridine, 2-thiouridine, 4′-thiouridine, 5-methylcytosine, 2-thio-1-methyl-1-deaza-pseudouridine, 2-thiol-1-methyl-pseudouridine, 2-thiol-5-aza-uridine, 2-thiol-dihydropseudouridine, 2-thiol-dihydrouridine, 2-thiol-pseudouridine, 4-methoxy-2-thiol-pseudouridine, 4-methoxy-pseudouridine, 4-thiol-1-methyl-pseudouridine, 4-thiol-pseudouridine, 5-aza-uridine, dihydropseudouridine, 5-methoxyuridine and 2′-O-methyluridine; preferably, at least 80%, at least 90% or 100% of the uracils in the open reading frame have a chemical modification;

[0039] The at least one mRNA comprises at least one 5′ end cap structure; preferably, the 5′ end cap structure is Cap2-6 (see formula I for structure):

[0040] The at least one mRNA comprises a 5'UTR; preferably, the sequence of the 5'UTR is: GGAGATAAGAGAGAAAAGAAGAGTAAGAAGAAATATAAGAGCCGCCACC, SEQ ID No. 20;

[0041] The at least one mRNA comprises a 3'UTR; preferably, the sequence of the 3'UTR is: GCTGCCTTCTGCGGGGCTTGCCTTCTGGCCATGCCCTTCTTCTCTCCCTTGCACCTGTACCTCTTGGTCTTTGAATAAAGCCTGAGTAGGAAG, SEQ ID No. 21;

[0042] The at least one mRNA comprises a 3′ polyA tail; preferably, the sequence of the 3′ polyA tail is AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA, SEQ ID No. 22;

[0043] The vaccine is in the form of nanoparticles; preferably, the nanoparticles have an average diameter of 50 nm to 200 nm; preferably, the nanoparticles are lipid nanoparticles; preferably, the lipid nanoparticles comprise cationic lipids, PEG-modified lipids, sterols and non-cationic lipids; preferably, the cationic lipids are ionizable cationic lipids, the non-cationic lipids are neutral lipids, and the sterols are cholesterol.

[0044] Experiments of the present invention show that the respiratory syncytial virus antigenic polypeptide or its immunogenic fragment of the present invention and the nucleic acid encoding the respiratory syncytial virus antigenic polypeptide or its immunogenic fragment of the present invention having the mutation site can achieve the improvement of pre-F immunogenicity and / or stability, and / or help to improve the protein expression level. BRIEF DESCRIPTION OF THE DRAWINGS

[0045] FIG1 is a schematic diagram of the antigen structure of the present invention.

[0046] FIG2 is the quantitative results of RSV F protein expression levels of different codon optimization strategies and structural modifications in Example 1.

[0047] FIG3 is the statistical results of RSV F protein expression levels of different codon optimization strategies and structural modifications in Example 1.

[0048] FIG4 shows the binding antibody titer data of mice immunized 14 days after Example 2.

[0049] FIG5 is the statistical results of the binding antibody titer detection data 14 days after the mice were immunized in Example 2.

[0050] FIG6 shows the binding antibody titer data of mice immunized 35 days after Example 2.

[0051] FIG7 is the statistical result of the binding antibody titer detection data 35 days after the mice were immunized in Example 2.

[0052] Figure 8 shows the neutralizing antibody titer data of mice 35 days after immunization in Example 3.

[0053] Figure 9 is the statistical results of the neutralizing antibody titer detection data of mice 35 days after immunization in Example 3.

[0054] FIG10 shows the results of the neutralizing antibody titer test against RSV-A2 in Example 4.

[0055] FIG. 11 shows the results of the RSV-B neutralizing antibody titer detection in Example 4.

[0056] Figure 12 shows the results of lung viral load detection after challenge in Example 4.

[0057] FIG. 13 shows the lung assessment scoring results in Example 4. DETAILED DESCRIPTION

[0058] To provide a clearer understanding of the technical features, objectives, and beneficial effects of the present invention, the following detailed description of the technical solutions of the present invention is provided. However, this description is not intended to limit the scope of the present invention. Experimental methods in the examples where specific conditions are not specified were performed according to conventional conditions in the field or the conditions recommended by the instrument manufacturer's instructions.

[0059] To enhance the immunogenicity of pre-F, the present invention designed a variety of RSV allosteric antigens, wherein the mutation schemes of V1, V2, and V4 are as follows:

[0060] V1: The 104-144 region of the Pre-F protein was replaced with a GS linker to reduce the structural changes caused by the conformational changes of pep27 and the fusion peptide; S155C, S290C and A149C, Y458C introduced two sets of disulfide bonds; S190F and V207L ​​achieved cavity filling; the C-terminus contained 5 intracellular amino acids of CKARS; and P102A, L373R, I379V, and M447V.

[0061] V2: In order to enhance the immunogenicity of the antigen, this group of antigens introduced a new cavity filling V296F based on the first group.

[0062] V4: To enhance the immunogenicity of the antigens, this group of antigens introduced S46G, E92D, and K465Q based on the first group.

[0063] The structures of the three groups of antigens V1, V2, and V4 of the present invention are shown in Figure 1.

[0064] The amino acid and encoding nucleotide sequences of each variant and wild-type RSV F are shown in Table 1.

[0065] Table 1

[0066] Example 1

[0067] In this example, the expression level of RSV F glycoprotein before fusion on the cell surface was detected by double antibody sandwich enzyme-linked immunosorbent assay using antibodies specific for RSV F glycoprotein before fusion (D25, Mota), and the effect of each RSV F variant on the expression level of RSV pre-F was investigated.

[0068] 1. mRNA transfection into cells

[0069] 293T cells (293T cells were cultured in 6-well plates, with approximately 2 million cells per well) were transfected with 4 μg of mRNA of different sequences (SEQ ID No. 6-SEQ ID No. 19) (each mRNA was prepared according to conventional techniques in the art). The culture was terminated after 24 hours, and intracellular protein was collected and quantified for total protein.

[0070] 2. Enzyme-linked immunosorbent assay (ELISA) to measure antigen expression

[0071] ① Antibody-coated ELISA plate:

[0072] Take out the packaged antibody protein (Mota) from the refrigerator, dilute it to 2 μg / mL with Coating Buffer, Research Grade Motavizumab (DVV02803), take a 96-well plate (Greiner, 655061), add 100 μL to each well, cover the ELISA plate, and coat it in a refrigerator at 2-8°C overnight.

[0073] Remove the coated 96-well plate, pour off the coating solution, and remove any excess solution to ensure no residue remains in the wells. Add 300 μL of 1x Washing Buffer diluted in ultrapure water to each well and wash the plate three times. Firmly tap off any remaining liquid on absorbent paper, then add 300 μL of blocking solution to each well. Seal the plate with film and incubate at 37°C for 2 hours.

[0074] ②Add the sample to be tested:

[0075] First, dilute the protein stock solution (cell lysate) in step 1 to 1-2 μg / μL, and then perform the antigen test experiment. Especially for samples with unknown protein expression, previous studies recommend using the gradient dilution method to prepare them. The gradient dilution multiples of the diluted samples are set to 40, 80, 160, 320, 640, 1280, and 2560 times.

[0076] Remove the sealed 96-well plate and remove any remaining liquid after washing. Add 100 μl of sample diluent to the blank well and 100 μl of the standard or test sample to each of the remaining wells (be careful not to create bubbles. Add the sample to the bottom of the plate well, minimizing contact with the well walls. Load each plate within 10 minutes). Cover the plate with film and incubate at 37°C for 2 hours. To ensure the validity of the results, use a fresh standard solution for each experiment.

[0077] ③Add detection antibodies:

[0078] Remove the blocked 96-well plate, pour off the coating solution, clean up the remaining liquid, and wash five times. Dilute the detection antibody Anti-HRSV-A F / Fusion glycoprotein F0 Antibody (D25) (RVV02809) - Bioti (concentration 0.79 mg / ml) at a ratio of 1:2000, add 100 μL of the diluted antibody to each well of the 96-well plate, seal the plate with film, and incubate at 37°C in the dark for 1 hour.

[0079] ④Add substrate solution:

[0080] Remove the 96-well plate after adding the detection antibody, pour off the coating solution, and clean the residual liquid five times. Dilute HRP-conjugated Streptavidin (SA00001-0) at a ratio of 1:10,000 and add 100 μL of the diluted HRP-conjugated Streptavidin to each well of the 96-well plate. Seal the plate with film and incubate at 37°C in the dark for 30 minutes.

[0081] ⑤ Color development and detection of OD value:

[0082] Turn off the room light, remove the 96-well plate after incubation with the secondary antibody, and rinse five times by discarding the primary antibody solution. Remove the disposable sample reservoir and place it in a light-proof box. Pour the TMB solution into the reservoir and use a dispenser to add 100 μL of TMB to each well. Develop the plate in the dark for 20 minutes (do not exceed 25 minutes). Positive samples will appear blue. Be sure to record the addition time and waiting time for each plate to prevent experimental errors. After the development time is up, use a dispenser to add 100 μL of Stop Solution to each well. The samples will initially appear yellow. Measure the absorbance at 450 nm. Read the plate within two minutes after adding the Stop Solution to each plate, otherwise the absorbance of the blank well will increase and the absorbance of the sample well will decrease. Set the microplate reader to absorbance at 450 nm and low-speed shaking for 5 seconds.

[0083] The results of RSV F glycoprotein detection before cell surface fusion are shown in Figures 2 and 3.

[0084] The results presented in Figures 2 and 3 indicate that different codon optimization strategies and cumulative structural modifications contribute to the increase in the expression of RSV pre-F. The antigen expression level of the mRNA in this example is 30-80 times higher than that of the WT group.

[0085] Example 2

[0086] This example provides the in vivo immunogenicity (mouse binding antibodies) of the four groups of RSV F glycoproteins (V1-m9, V2-m9, V4-m2, and V4-m4) screened in Example 1 in mice.

[0087] 1. Methods and Grouping

[0088] The in vitro synthesis of mRNA for the experiment was carried out according to conventional operations in the art. In this example, the target mRNA molecule, in addition to the coding sequences of V1-m9, V2-m9, V4-m2-1, and V4-m4 (SEQ ID No. 14, SEQ ID No. 10, SEQ ID No. 7, and SEQ ID No. 6), also includes a 5'UTR (GGAGATAAGAGAGAAAAGAAGAGTAAGAAGAAATATAAGAGCCGCCACC, SEQ ID No. 20) and a 3'UTR (GCTGCCTTCTGCGGGGCTTGCCTTCTGGCCATGCCCTTCTTCTCTCCCTTGCACCTGTACCTCTTGGTCTTTGAATAAAGCCTGAGTAGGAAG, SEQ ID No. 21), the 5'CAP is Cap2-6 (structure shown in Formula I), a 3' poly A tail is added (AAAAAAAAAAAAAAAAA AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA, SEQ ID No. 22), and 100% m1ψ modification.

[0089] Each mRNA was encapsulated in T19-5 LNPs (T19-5 LNP composition and molar ratio: T19 (structural formula II, 48%); DSPC (16%); DMG-PEG2000 (1.5%); and CHOL (34.5%), with a particle size of approximately 100 nm. Eight-week-old BALB / c mice (n=10 per group) were injected intramuscularly (IM). The mRNA was administered at two-week intervals, with a single injection dose of 5 μg. Serum was collected weekly. Serum binding antibody titers against the D14 and D28 pre-F glycoproteins were determined by ELISA.

[0090] Prefusion F-specific IgG titers were measured two weeks after the first administration (i.e., 14 days after immunization of mice) and three weeks after the second administration (i.e., 35 days after immunization of mice).

[0091] Among them, a group of single-injection immunization and double-injection freeze-dried dosage forms were arranged to test the effects of the number of immunizations and storage methods on the immune effect.

[0092] 2. The specific experimental process is as follows:

[0093] ① Sample dilution

[0094] Bleed the mouse from the rim of the eye and centrifuge at high speed to obtain a supernatant of no less than 50 μL. Dilute serum (primary antibody): Dilute the sample to a gradient of 4000x, 40000x, 400000x, 4000000x, 8000000x, 20000000x, and 40000000x. The serum dilution method can refer to the following steps: The control serum CK dilution gradient is 40x, 400x, and 4000x. The addition steps are the same as for serum. Note that a control should be set up for each 96-well plate.

[0095] ② Enzyme-linked immunosorbent assay

[0096] Remove the pre-F protein from the refrigerator and dilute it to 2 μg / mL with Coating Buffer. Add 100 μL of sample to each well of a 96-well plate (Greiner, 655061). Cover the plate and coat overnight at 2-8°C. Remove the coated 96-well plate, pour off the coating buffer, and remove any excess solution to ensure no residue remains in the wells. Wash the plate with 1× Washing Buffer diluted with ultrapure water, adding 300 μL per well. Repeat this wash three times. Firmly tap off any remaining liquid on absorbent paper. Add 300 μL of Blocking Buffer to each well. Seal the plate with film and incubate at 37°C for 2 hours.

[0097] Remove the coated 96-well plate and pour off the coating solution, ensuring no residue remains in the wells. Wash the plate three times with 300 μL of Washing Buffer diluted to 1x with ultrapure water. After removing any residual liquid, add 300 μL of Blocking Diluent to each well. Seal the plate with film and incubate at 4°C for 2 hours.

[0098] Pour off the coating solution and clean up the residual liquid; add the diluted test serum sample and the control group serum sample, take each sample three times, 100 μL each time, and make 3 parallel replicates. Note that a blank control and CK must be set up for each plate.

[0099] Dilute Goat pab to Ms IgG (HRP) in dilution buffer at a 1:10,000 dilution (the dilution factor should be determined according to the manufacturer's instructions) and vortex to mix. Remove the 96-well plate after primary antibody incubation, discard the primary antibody solution, and clean any remaining liquid from the wells. Wash the plate five times with a microplate washer to remove any remaining liquid. Add 100 μL of the diluted antibody to each well of the 96-well plate, seal with film, and incubate at room temperature in the dark for 1 hour.

[0100] Turn off the indoor light, remove the 96-well plate after incubation with the secondary antibody, and discard the primary antibody solution and wash five times. Next, remove the disposable sample reservoir and place it in a light-proof box. Pour the TMB solution into the reservoir and use a dispenser to add 100μL of TMB to each well. Develop the color in the dark for 20 minutes (do not exceed 25 minutes). At this point, positive samples will appear blue. The addition time and waiting time for each plate must be recorded to prevent experimental errors. After the color development time is up, use a dispenser to add 100μL of Stop Solution to each well. The samples will initially appear yellow. Measure the absorbance at 450nm. Read the plate within two minutes after adding the Stop Solution to each plate, otherwise the absorbance of the blank well will increase and the absorbance of the sample well will decrease. Set the microplate reader to an absorbance of 450nm and low-speed shaking for 5 seconds.

[0101] The experimental results are shown in Figures 4 to 7, among which the V4-m4 cap1 group is a group in which the Cap2-6 cap structure is replaced with a commercial cap structure (CleanCap-Cap1 GAG); the V4-m4 SM102 group is a group using the commercial SM102 preparation; the V4-m4 freeze-dried group is a group using the freeze-dried preparation stored at 4 degrees Celsius; and the V4-M4 single-injection group is a group immunized with a single injection.

[0102] According to the results of Figures 4 and 5, the sequence used in the present invention has a faster immune response after a single injection, and can induce an immune response in animals earlier than the control. In addition, the cap structure Cap2-6 helps the antigen sequence to exert an immune effect earlier than the commercial Cap1. The T19-5 LNP formula with independent intellectual property rights used by the company is comparable to the commercial SM102. In addition, the present invention also includes a comparison of the vaccine state (lyophilized and non-lyophilized), and the results show that there is no statistical difference between the freeze-dried preparation stored at 4 degrees Celsius and the liquid sample stored at minus 80 degrees Celsius.

[0103] As shown in Figure 6, 35 days after immunization, the modified mRNA exhibited binding antibody serum titers 5-24 times higher than the control (A2 strain; GenBank GI: 138251). Furthermore, the formulations and lyophilized formulations of the cap structures Cap2-6 and T19-5 demonstrated binding antibody titers comparable to those of the commercially available original.

[0104] The results in Figure 7 show that three weeks after the double-dose immunization, all samples reached saturation. There were no statistical differences between the antigen sequences, and the effects of individual factors were reduced with increasing immunization frequency and duration. It is worth noting that the single-dose immunization of the present invention was significantly less effective than the double-dose immunization.

[0105] Example 3

[0106] This example provides a method for conducting neutralizing antibody detection on samples 35 days after immunization of the mice in Example 2 to measure the level of RSV-A2 neutralizing antibodies in the serum of the immunized mice.

[0107] The main experimental operation is to inactivate the sample by heating it at 56°C for 30 minutes, and use the plaque reduction neutralization test (PRNT) to detect the anti-RSV neutralization titer in the serum.

[0108] RSV A2 strain (or RSV A2 strain with RFP fluorescent label) was diluted to approximately 80 plaque units (PFU) per inoculation dose. Equal amounts of progressively diluted serum were added and incubated at 37°C for 60 minutes. Two wells of a 24-well plate with cells already forming a monolayer were inoculated with 0.2 ml of each dilution at each dilution. The cells were incubated at 37°C for 2 hours. The inoculum was then removed and pre-warmed 37°C culture medium containing 0.8% methylcellulose was added. The cells were then incubated at 37°C for 72 hours. The number of virus-infected plaques in each well was counted using the antibody immunoplaque assay (or fluorescent plaque assay), and the neutralizing titer of the serum required to reduce the number of plaques by 50% was calculated.

[0109] The results are shown in Figures 8 and 9. As shown in Figures 8 and 9, although there was no significant difference in the binding antibodies of all samples 35 days after mouse immunization, the neutralizing antibody levels of the three groups of antigens involved in the present invention were significantly higher, especially the two groups of antigen sequences of V4 (V4-m2-1 and V4-m4). In addition, the cap structure and formulation used in the present invention are not inferior to commercial products. It is worth noting that Figure 8 shows that the level of V4-m4 binding antibodies after single-shot immunization is low, but the neutralizing antibody level is higher than the control (two shots), which also shows that this design combination has a better immune effect.

[0110] Example 4. In vivo immunogenicity study (cotton rats)

[0111] The immunogenicity of V4-m4 was evaluated in cotton rats. The research aims to evaluate the immunogenicity, efficacy, and safety of V4-m4 as an antigen in this cotton rat model and to assess the potential for enhanced respiratory disease (ERD) at the proposed dose, including viral load and lung pathology assessment after challenge.

[0112] V4-m4 mRNA (same as Example 2) is configured in lipid nanoparticles, and the lipid nanoparticle components are the same as the T19-5 LNP of Example 2. The RSV virus after formaldehyde treatment and the non-immune, non-challenged group are used as controls. Female cotton rats (6-8 weeks old) were divided into 4 groups of 10 each, and rat immunization was carried out according to the time shown in Table 2. The first group was the LNP-mRNA (V4-m4) group, the second group was the RSV virus group (FI-RSV) after formaldehyde treatment, and the third and fourth groups were respectively the non-immune, non-challenged groups. On the 56th day, blood was collected to carry out neutralizing antibody titer identification, and mice were challenged with 5 log10 RSV A2 intranasal administration. On the 61st day, the animals were sacrificed, and lung tissue was collected for viral load determination and pathological evaluation.

[0113] Table 2

[0114] For evaluation, the neutralizing antibody detection method is the same as Example 3. The extraction of samples for lung pathology and viral load evaluation includes transferring the right lung (4 lobes) into MACS tissue grinding M tubes and tightening the lid for the next step. Add 2mL of DPBS to the tissue grinding tube. Place the tissue grinding tube on a MACS tissue cell disruptor and use the RNA-01-01 program for tissue disruption. Centrifuge the tissue grinding tube at 1000g for 5 minutes, centrifuge the foam and tissue residue, transfer to a biosafety cabinet, and freeze the homogenate at -80°C.

[0115] The results of the cotton rat evaluation experiment are shown in Figures 10 to 13. The results showed that after vaccination with V4-m4, neutralizing antibodies against RSV A and RSV B strains were induced. After the challenge, the lung viral load of the immunized cotton rats was significantly lower than that of the non-immunized mice, and the weight loss rate was also lower than that of the non-vaccinated group. The lung damage was also alleviated. The vaccine effect was evaluated by clinical symptoms, weight changes, neutralizing antibody titers, lung tissue pathological changes and viral load in mice. The following conclusions can be drawn: In the cotton rat model, vaccination with 10μg / mouse and 20μg / mouse vaccines can induce neutralizing antibodies against A / B strains of respiratory syncytial virus and has a protective effect against A / B strain infection.

Claims

1. A respiratory syncytial virus antigenic polypeptide or an immunogenic fragment thereof, which has the following amino acid site changes compared to the wild-type Pre-F protein of respiratory syncytial virus: The 104-144 region of the Pre-F protein was replaced with a GS linker; S155C, S290C, A149C, and Y458C introduced two sets of disulfide bonds; S190F and V207L ​​achieved cavity filling; and P102A, L373R, I379V, and M447V; Furthermore, the C-terminus of the respiratory syncytial virus antigenic polypeptide or its immunogenic fragment comprises a cytoplasmic tail region fragment, and the cytoplasmic tail region fragment is a fragment of continuous 3-10 amino acid residues derived from the cytoplasmic tail region of the Pre-F protein.

2. The respiratory syncytial virus antigenic polypeptide or immunogenic fragment thereof according to claim 1, which has at least one of the following modifications compared to the respiratory syncytial virus Pre-F protein: Cavity filling of V296F; and / or One or more mutations among S46G, E92D, K465Q.

3. The respiratory syncytial virus antigenic polypeptide or immunogenic fragment thereof according to claim 1, wherein: The cytoplasmic tail region fragment is a fragment of 4-6 consecutive amino acid residues derived from the cytoplasmic tail region of the Pre-F protein; Preferably, the cytoplasmic tail fragment is CKARS.

4. The respiratory syncytial virus antigenic polypeptide or immunogenic fragment thereof according to any one of claims 1 to 3, which has at least the 26th to 515th amino acid sequence or the full-length amino acid sequence shown in SEQ ID NO: 1, SEQ ID NO: 2 or SEQ ID NO: 3, or a derivative amino acid sequence with equivalent function formed by replacing, deleting or adding one or more amino acids on the basis of these amino acid sequences.

5. The respiratory syncytial virus antigenic polypeptide or immunogenic fragment thereof according to claim 1, wherein: The equivalent functions include promoting the improvement of the immunogenicity and / or stability of pre-F and / or promoting the improvement of the expression level of pre-F protein.

6. A nucleic acid encoding the amino acid sequence of the respiratory syncytial virus antigenic polypeptide or an immunogenic fragment thereof according to any one of claims 1 to 5.

7. The nucleic acid according to claim 6, which is DNA or RNA; Preferably, the sequence of the nucleic acid encoding the respiratory syncytial virus antigenic polypeptide is shown in any one of SEQ ID No.6-SEQ ID No.

17.

8. Use of the respiratory syncytial virus antigenic polypeptide or immunogenic fragment thereof according to any one of claims 1 to 5 or the nucleic acid according to claim 6 or 7 in the preparation of a respiratory syncytial virus vaccine.

9. A respiratory syncytial virus vaccine comprising: At least one mRNA encoding the respiratory syncytial virus antigenic polypeptide according to any one of claims 1 to 5 The open reading frame of the peptide or an immunogenic fragment thereof, and A pharmaceutically acceptable carrier.

10. The vaccine according to claim 9, having one or more of the following characteristics: The open reading frame is codon optimized; The open reading frame also has a sequence encoding a signal peptide linked to a respiratory syncytial virus antigenic polypeptide or an immunogenic fragment thereof; The at least one mRNA comprises at least one chemical modification; preferably, the chemical modification is selected from the group consisting of pseudouridine, N1-methylpseudouridine, N1-ethylpseudouridine, 2-thiouridine, 4′-thiouridine, 5-methylcytosine, 2-thio-1-methyl-1-deaza-pseudouridine, 2-thiol-1-methyl-pseudouridine, 2-thiol-5-aza-uridine, 2-thiol-dihydropseudouridine, 2-thiol-dihydrouridine, 2-thiol-pseudouridine, 4-methoxy-2-thiol-pseudouridine, 4-methoxy-pseudouridine, 4-thiol-1-methyl-pseudouridine, 4-thiol-pseudouridine, 5-aza-uridine, dihydropseudouridine, 5-methoxyuridine and 2′-O-methyluridine; preferably, at least 80%, at least 90% or 100% of the uracils in the open reading frame have a chemical modification; The at least one mRNA comprises at least one 5′ end cap structure; The at least one mRNA comprises a 3′ polyA tail; The vaccine is in the form of nanoparticles; preferably, the nanoparticles have an average diameter of 50 nm to 200 nm; preferably, the nanoparticles are lipid nanoparticles; preferably, the lipid nanoparticles contain cationic lipids, PEG-modified lipids, sterols and non-cationic lipids; preferably, the cationic lipids are ionizable cationic lipids, the non-cationic lipids are neutral lipids, and the sterols are cholesterol.

Images