Bacillus velezensis BL-LM and application of bacillus velezensis BL-LM in preparation of special-flavor liquor yeast

Abstract

The invention belongs to the technical field of white spirit brewing, and particularly relates to bacillus velezensis BL-LM and application thereof in preparation of special-flavor white spirit yeast. The bacterial strain is classified and named as Bacillus velezensis, and is preserved in the China General Microbiological Culture Collection Center (CGMCC), and the preservation number is CGMCC No.30130. The invention further discloses a preparation method of the bacterial strain. When the bacillus velezensis BL-LM is added into starter propagation raw materials, in the starter propagation process, the top fire temperature of a starter blank is high, the temperature rising time is long, the liquefying power and saccharifying power activity of the starter blank is higher, the capacity of producing white spirit characteristic flavor substances such as pyrazines, guaiacol and 4-vinyl guaiacol is higher, and the content of organic acid is high. The bacillus velezensis BL-LM disclosed by the invention has a relatively good promotion effect on physicochemical property optimization and flavor substance generation of the specially-fragrant yeast, and has a very obvious effect in the aspect of modifying the quality of the specially-fragrant yeast.

Description

Technical Field

[0001] The invention belongs to the technical field of liquor brewing, and more specifically, relates to Bacillus Velez BL-LM and application thereof in preparing special-flavor liquor Daqu. Background Art

[0002] The production and fermentation of Chinese liquor Daqu play an extremely important role in the winemaking process. They not only affect the flavor and quality of liquor, but also are the key links in the winemaking process. Microorganisms are enriched and evolved in the process of Daqu production. The Daqu microbial community is related to the specific koji-making process and koji-making raw materials. Through the specific koji-making process and raw material ratio, the microbial community suitable for winemaking can be screened. In the process of Daqu production, the metabolic activities of microorganisms will produce various enzymes, which can catalyze chemical reactions in the raw materials and further promote the formation of flavor substances. This is of irreplaceable importance in the production and fermentation process of Daqu, affecting the flavor and quality of liquor, and is an important link in the winemaking process. Therefore, in the process of liquor brewing, it is necessary to attach great importance to the optimization and innovation of the production and fermentation process of Daqu.

[0003] The types and quantity of microorganisms directly affect the flavor composition of medium-high temperature Daqu and determine the quality of special-flavor liquor. However, due to the openness of the raw material koji making process, the complexity and diversity of the multi-enzyme and multi-bacteria solid-state mixed fermentation system, and the difficulty in monitoring and regulating solid-state fermentation, the quality of special-flavor Daqu is often unstable.

[0004] The types and quantity of functional microorganisms contained in Daqu are the key to determining the quality of Daqu, affecting the yield and quality rate of liquor. Therefore, in order to improve and enhance the quality and stability of special-flavor Daqu, it is necessary to add pure functional microorganisms during the production of Daqu, optimize the types and quantity of functional microorganisms contained in Daqu prepared by the existing traditional koji making process, and stabilize and improve the quality of Daqu. However, the existing microorganisms used to prepare special-flavor liquor Daqu have a low effect on improving the characteristic aroma substances of liquor in Daqu and the types of improved substances are relatively few. Summary of the invention

[0005] In view of the above technical problems, the present invention provides Bacillus Velez BL-LM and application thereof in preparing special-flavor liquor Daqu.

[0006] The present invention specifically adopts the following technical solutions:

[0007] In a first aspect, the present invention provides Bacillus velezensis BL-LM, which is deposited in the General Microbiology Center of China National Microbiological Culture Collection Administration, with a deposit number of CGMCC No. 30130 and a deposit date of March 25, 2024.

[0008] The invention separates a Bacillus Velezii from a special-flavor Daqu sample, adds the Bacillus Velezii into the special-flavor liquor Daqu raw material for fermentation, significantly increases the contents of 15 pyrazines and their precursor compounds, 5 aromatic compounds and 5 organic acid compounds in the Daqu, enhances the contents of Daqu flavor substances, and makes the Daqu base have obvious sauce flavor and rich flavor.

[0009] In a second aspect, the present invention provides an application of the Bacillus Velez BL-LM in the preparation of special-flavor liquor Daqu, wherein the Bacillus Velez BL-LM is used to increase the content of pyrazines and their precursor compounds, aromatic compounds, and volatile organic acid compounds in the Daqu of special-flavor liquor.

[0010] Among them, the pyrazines and their precursor compounds include: 2,3,5,6-tetramethylpyrazine, 2,3,5-trimethylpyrazine, 2,3-dimethylpyrazine, 2,3,5-trimethyl-6-ethylpyrazine, 2-isobutyl-3,5,6-trimethylpyrazine, 2,3,5-trimethyl-6-propylpyrazine, 2,6-dimethylpyrazine, 2-ethyl-6-methylpyrazine, 5-isobutyl-2,3-dimethylpyrazine, 3,5-diethyl-2-methylpyrazine, 3-ethyl-2,5-dimethylpyrazine, 2-acetyl-3,4,6-trimethylpyrazine, 2,5-dimethyl-3-propylpyrazine, 2-methyl-5-propylpyrazine, and acetoin.

[0011] The aromatic compounds include: benzaldehyde, phenylethyl alcohol, guaiacol methyl ether, guaiacol, and 4-vinylguaiacol.

[0012] The organic acid compounds include: acetic acid, L-malic acid, 2-methylbutyric acid, 3-methylbutyric acid, and 2-methylhexanoic acid.

[0013] In a third aspect, the present invention provides a method for preparing special-flavor liquor Daqu using the Bacillus Velez BL-LM, comprising the following steps:

[0014] S1, activating Bacillus Velezii BL-LM to obtain a primary seed solution;

[0015] S2, the first-level seed solution is expanded and cultured to a bacterial cell concentration of 1×10 8 -5×10 8 CFU / mL, and the secondary seed solution was obtained;

[0016] S3, dilute the secondary seed solution to a bacterial concentration of 1×10 6 -1×10 7 CFU / mL, the diluted secondary seed liquid is evenly mixed with flour, wheat bran and discarded grains, molded and fermented to obtain the special-flavor liquor Daqu.

[0017] The mass ratio of the flour, wheat bran, waste grains and diluted secondary seed liquid is 40-50:40-60:5-10:45-60.

[0018] The present invention has the following beneficial effects:

[0019] The daqu prepared by the Bacillus Velez BL-LM provided by the present invention has greatly improved qu quality, a high top-fire temperature and a long temperature-holding time during qu making, significantly enhanced liquefaction and saccharification power, and a distinct sauce flavor and rich qu aroma.

[0020] The special-flavor liquor Daqu prepared by the Bacillus Velezii BL-LM provided by the present invention has high content and rich variety of pyrazines and aromatic flavor compounds, and also has increased organic acids, which is very beneficial to the fermentation of liquor Daqu and the improvement of Daqu quality. BRIEF DESCRIPTION OF THE DRAWINGS

[0021] Figure 1 These are morphological identification diagrams of Bacillus Velezii BL-LM, where Figure A is a plate colony morphology diagram and Figure B is a colony scanning electron microscope morphology diagram.

[0022] Figure 2 This is the growth curve of Bacillus Velez BL-LM.

[0023] Figure 3 Create a flow chart to strengthen Daqu production.

[0024] Figure 4 This is a graph showing the changes in Daqu product temperature during the koji making period for unfortified Daqu and Daqu fortified with Bacillus Velez BL-LM.

[0025] Figure 5 This is a graph showing the changes in moisture content during the koji making period for unfortified Daqu and Daqu fortified with Bacillus Velez BL-LM.

[0026] Figure 6 This is a graph showing the acidity changes during the koji making period for unfortified Daqu and Daqu fortified with Bacillus Velez BL-LM.

[0027] Figure 7 This is a comparison chart of the liquefaction capacity of unfortified Daqu and Daqu fortified with Bacillus Velez BL-LM.

[0028] Figure 8 This is a comparison chart of the saccharification capacity of unfortified Daqu and Daqu fortified with Bacillus Velez BL-LM.

[0029] Fig. 9 This is the accumulation diagram of aroma substances in unfortified Daqu and Daqu fortified with Bacillus Velez BL-LM. DETAILED DESCRIPTION

[0030] The present invention is described in detail below in conjunction with the accompanying drawings and specific examples, but should not be construed as limiting the present invention. Unless otherwise specified, the technical means used in the following examples are conventional means well known to those skilled in the art, and the materials, reagents, etc. used in the following examples, unless otherwise specified, can be obtained from commercial sources.

[0031] Example 1: Isolation and identification of Bacillus velez BL-LM

[0032] 1. Heat treatment of Daqu samples

[0033] In a clean bench, weigh 2g of crushed special-flavor Daqu sample into a 250mL conical flask, add 50mL of sterilized saline, seal the flask, and place the sample in a 37℃ constant temperature shaker for 30min to obtain Daqu suspension. Place the suspension in a 55℃ water bath for 2d.

[0034] 2 Preliminary screening of strains

[0035] Take 100 μL of the treated Daqu suspension and aspirate it into a centrifuge tube containing 900 μL of sterile water. -1 Then take 100 μL of the bacterial suspension in the first centrifuge tube and add it to the second centrifuge tube containing 900 μL of sterile water to make 10 -2 The dilution of Daqu suspension is diluted to 10 -8 Dilution. -8 Take 100 μL of the diluted Daqu suspension and inoculate it evenly on the LB plate, make three parallel plates, and culture it in a 50°C constant temperature incubator after the suspension is fully absorbed. The grown bacterial colonies are stored in LB slant medium and the strains are identified.

[0036] 3. Morphological identification of strains

[0037] The strain that grew fastest on the LB plate was screened in the above steps for colony and microscopic morphological identification. Figure 1 It can be seen that the colonies of Bacillus Velez BL-LM are transparent, approximately round, moist, transparent, with no wrinkles on the surface, relatively glossy, and smooth edges. Under a scanning electron microscope, the single-cell morphology of the bacteria is short rod-shaped, solitary, with a body length of 1-3μm and a thickness of 0.5-1.0μm.

[0038] 4. Molecular biological identification of strains

[0039] The single colony on the LB solid plate was inoculated into LB liquid medium and cultured overnight at 37°C in a shaking incubator. The bacteria were collected by centrifugation the next day, and the total genomic DNA of the bacteria was extracted using the Gram-positive bacteria DNA extraction kit Solarbio BacteriaDNA Kit. Universal primers 27F and 1492R were used for amplification, and the extracted total DNA was used as a template for PCR amplification of 16srDNA.

[0040] Table 1 16S rDNA universal primers

[0041] Primer name Primer sequence (5'-3') SEQ ID NO. 27F AGAGTTTGATCCTGGCTCAG 2 1492R TACGGYTACCTTGTTAYGACTT 3

[0042] The amplified PCR product was subjected to agarose gel electrophoresis and the PCR product was recovered. The PCR product was sent to Beijing Qingke Biotechnology Co., Ltd. for sequencing. Sequencing identification results: The size of the PCR product was 1517bp, and the 16s rDNA sequence of the strain was shown in SEQ ID NO.1. The sequence was compared with the rRNA / ITS databases in NCBI by Blast online comparison, and the species information of the 16s rDNA sequence closest to the 16s rDNA sequence of the identified strain was obtained: Bacillus velezensis FZB42 strain, so the strain was identified as Bacillus velezensis (Bacillus velezensis), named BL-LM.

[0043]

[0044] Example 2: Determination of the logarithmic growth phase of Bacillus Velezii BL-LM

[0045] The Velezella BL-LM was inoculated into a conical flask containing an appropriate amount of LB medium, cultured in a shaking incubator at 37°C and 180 r / min, and samples were taken at regular intervals. The absorbance (OD) of the samples at 600 nm was measured using a spectrophotometer. 600 ), the experiment was repeated three times. The growth curve of BL-LM strain was plotted with time as the horizontal axis and bacterial concentration OD600 as the vertical axis. The results are shown in Figure 2 As shown, the logarithmic growth phase of Bacillus velez BL-LM is 1-10h, and it enters the stable phase after 10h.

[0046] Example 3: Analysis of physical and chemical indicators in the special-flavor liquor Daqu prepared by Bacillus Velez BL-LM 1 Experimental method

[0047] (1) Preparation method of Daqu

[0048] Preparation of Daqu fortified with Bacillus Velez BL-LM Figure 3 As shown, the strain was streaked on a plate and cultured overnight at 37°C. The next day, a single colony was picked and placed in a 250mL triangular flask and cultured at 37°C and 180r / min for 5-6h until the mid-logarithmic growth period, which was the first-level seed solution. The bacterial concentration was calculated to be about 10 after culturing in a 5L fermenter at a 1% inoculation rate for 16h. 8 CFU / mL is the secondary seed liquid. The solid culture medium adopts the formula ratio for the production of special aroma Daqu, and the secondary seed liquid is diluted with tap water to prepare 10 6 CFU / mL of bacterial liquid, according to the mass ratio of flour: wheat bran: waste: bacterial liquid = 45:50:7.25:53 and the amount of 1060mL bacterial liquid per block of Daqu, the production raw materials are mixed and stirred evenly. Then the koji material is molded into a rectangular block of 210mm×80mm×120mm, and the prepared fortified Daqu is placed in the koji room for fermentation. The ordinary unfortified control (CK) Daqu is to replace the seed liquid with the same volume of water, and the other production processes are the same.

[0049] The conditions for solid fermentation of Daqu are: using the traditional solid fermentation method in the koji room, using the method of placing a single or double koji on the ground and covering it with straw, after two koji turning processes, the koji reaches the peak temperature, and the koji is rolled 10-12 days after entering the room. After about 25-30 days of solid fermentation culture, the koji temperature drops to room temperature, and the solid fermentation in the koji room is ended, and the Daqu is taken out of the room.

[0050] Three pieces of Daqu fortified with Bacillus Velez BL-LM and ordinary Daqu were randomly sampled at 0d, 5d, 10d, 15d, 20d and 30d, respectively. The samples were crushed, mixed and sieved, and 200g was weighed to determine the physical and chemical indicators and enzyme activity of the Daqu.

[0051] (2) Testing

[0052] 1) Determination of billet temperature

[0053] Insert the thermometer into the Daqu to a depth of about 2 cm, and randomly measure the temperature of three pieces of Daqu once a day. Calculate the average of the measured temperatures to obtain the Daqu temperature.

[0054] 2) Determination of water content of Daqu

[0055] The water content of Daqu was tested by direct drying method. A clean weighing bottle was placed in a 105°C drying oven to dry to constant weight. 10 g of the sample was weighed and placed in a weighing bottle. The bottle was placed in a drying oven to dry to constant weight, and the water content was calculated.

[0056] 3) Determination of acidity of Daqu

[0057] 10g sample was added to 100mL of neutral water, stirred and mixed, and after leaching for 30min, the filtrate was filtered with filter paper and collected for later use. 10mL of the filtrate was taken and titrated with 0.1M NaOH standard solution, and the volume of NaOH solution consumed was recorded as V1 (with pH = 7.0 as the titration end point); using distilled water as a control, the steps of the experimental group were repeated, and the volume of NaOH standard solution consumed was recorded as V0.

[0058] The calculation formula is as follows:

[0059] Acidity (mmol / 10g) = c0×(V1-V0)×10×m×(1-W).

[0060] Wherein: c0 is the concentration of sodium hydroxide standard solution (0.1 mol / L); V1 is the volume of NaOH solution consumed by the experimental group (mL); V0 is the volume of NaOH solution consumed by the blank group (mL); 10 is the ratio of the sample dilution volume to the volume of the sampling solution for titration; m is the mass of dry koji; W is the water content of the sample (%).

[0061] 4) Determination of liquefaction capacity of Daqu

[0062] The activity of liquefaction amylase was determined by spectrophotometry. One enzyme activity unit (U / g) is defined as the amount of enzyme required to liquefy 1g of soluble starch in 1h at 60℃ and pH 6.0 with 1g of dry koji.

[0063] For sample treatment, add 200 mL of disodium hydrogen phosphate-citric acid buffer preheated to 40°C into a beaker with 10 g of Daqu powder, soak in a water bath for 1 h (40°C), filter with filter paper and take the filtrate for later use.

[0064] Place 20 mL of starch solution (20 g / L) and 5 mL of sodium dihydrogen phosphate-citric acid buffer (pH 6.0) in a 50 mL colorimetric tube and place in a 60°C water bath for 10 min. Add 1 mL of filtrate to the colorimetric tube, shake well and accurately react for 5 min. Take 1 mL of the reaction solution and add it to a test tube containing 5 mL of dilute iodine solution and shake well. Use the dilute iodine solution as a blank and place it in a spectrophotometer to measure the absorbance at 660 nm.

[0065] The calculation formula is as follows:

[0066]

[0067] Where c is the enzyme concentration, unit: U / mL; 200 is the total volume of enzyme leaching solution; m is the mass of dry koji; 5 is the reaction time; and 60 is the coefficient for conversion to hours.

[0068] 5) Determination of saccharification capacity of Daqu

[0069] Refer to the determination method of "GB8276-2006 Food Additives Saccharifying Enzyme Preparations". It is defined as the number of milligrams of glucose converted from soluble starch by 1g of Daqu in 1 hour at 40℃ and pH4.6 as one saccharifying enzyme activity unit.

[0070] For sample treatment, 5 g of Daqu powder was placed in a beaker, 90 mL of water and 10 mL of sodium acetate buffer (pH 4.6) were added, and the mixture was leached in a 30°C water bath for 1 h, and then filtered with filter paper to obtain the filtrate for later use.

[0071] 25mL starch solution (20g / L) and 5mL sodium acetate buffer were placed in a test tube in a water bath for 5min (40℃), then 2mL of filtrate was added and the mixture was placed in a water bath at 40℃ for 30min. After the reaction was completed, 0.2mL NaOH (200g / L) was added and shaken to terminate the reaction. Three parallel samples were prepared for each group of Daqu samples, and the blank control was prepared by adding NaOH and then adding filtrate.

[0072] Take 5 mL of the above saccharification solution and place it in an iodine volumetric flask, add 10 mL of iodine solution (0.1 mol / L) and then add 15 mL of NaOH solution (0.1 mol / L) to react in the dark for 15 minutes. After the reaction is completed, add 2 mL of sulfuric acid solution (2 mol / L) and immediately titrate with sodium thiosulfate standard solution (0.05 mol / L). The end point is when the blue color disappears.

[0073] The calculation formula is as follows:

[0074]

[0075] In the formula, c is the concentration of Na2S2O3 standard solution; V0 and V are the volumes of Na2S2O3 standard solution consumed by blank and sample respectively; 90.05 is the mass of glucose in grams equivalent to 1mL Na2S2O3 standard solution; 32.2 is the total volume of the reaction solution; 5 is the volume of the absorbed saccharification solution; 1 / 2 is 2mL of the absorbed enzyme solution, calculated as 1.00mL; n is the sample dilution multiple; 2 is the reaction time of 0.5h; m is the mass of dry koji; 100 is the total volume of the sample extract.

[0076] 2. Test results

[0077] (1) Daququ temperature test results

[0078] The change of koji temperature during the fermentation process is a key physical and chemical indicator reflecting the solid fermentation process. The koji temperature affects the types and quantity of koji microbial flora, biochemical reactions and enzyme activities, thus affecting the fermentation performance of koji and the generation of characteristic flavor substances. Figure 4 As shown. In the fermentation chamber, the temperature of the Daqu fortified with BL-LM strains rises slowly in the early stage, the top fire temperature in the middle stage is higher than that of the control Daqu, and the temperature after the pile is above 45°C for a long time. The temperature of the late Daqu drops more slowly during the 15-17 days of fermentation, with the characteristics of "slow at the beginning" and "slow at the end". The Daqu fortified with Bacillus Velez BL-LM drops to the same temperature as the control Daqu in the late fermentation. The long-term high temperature maintained by the Daqu fortified with Bacillus Velez BL-LM can increase the biochemical reaction rate and is conducive to the formation of characteristic aroma substances. For example, the content of pyrazines and their precursor compound 3-hydroxy-2-butanone (acetoin) is higher in high-temperature Daqu.

[0079] (2) Results of determination of water content in Daqu

[0080] The changes of water content during Daqu fermentation are as follows Figure 5 As shown. The change pattern of the water content of Daqu fortified with Bacillus Velez BL-LM is the same as that of the control Daqu. The water content gradually decreases with the fermentation time. However, in the late fermentation process, the water content of Daqu fortified with Bacillus Velez BL-LM is significantly higher than that of the control Daqu and decreases slowly. This is closely related to the high temperature maintained in the late solid fermentation. The water content of Daqu fortified with Bacillus Velez BL-LM is about 25% at the end of fermentation, which is higher than that of the control Daqu.

[0081] (3) Results of determination of acidity of Daqu

[0082] The changes of acidity during Daqu fermentation are as follows Figure 6The formation of Daqu acidity mainly comes from the organic acid metabolism of acid-producing microorganisms and the degradation of fat, starch and protein. It is the result of the comprehensive action of Daqu microorganisms. Appropriate acidity can inhibit the growth of some harmful bacteria in Daqu, and also provide nutrition for beneficial microorganisms and participate in esterification reactions to produce flavor substances. Figure 6 It can be seen that the acidity change pattern of Daqu fortified with Bacillus Velez BL-LM and the control Daqu is roughly the same, gradually decreasing from 10 to 15 days, and slightly increasing from 15 to 20 days, and the increase of Daqu fortified with Bacillus Velez BL-LM is the highest, reaching a peak value of 1.7mmol / 10g. This may be due to the fact that the growth of other acid-producing bacteria was inhibited in the early stage of inoculation, resulting in little change in acidity, while the acid-producing bacteria multiplied in large numbers in the later stage, resulting in an increase in acidity. The results of the volatile substance detection of Daqu fortified with Bacillus Velez BL-LM found a large number of volatile acids such as acetic acid, 2-methylbutyric acid and 3-methylbutyric acid, indicating that Bacillus Velez BL-LM can increase the acidity during the fermentation process of Daqu.

[0083] (4) Results of Daqu liquefaction test

[0084] The changes of liquefaction force during Daqu fermentation are as follows Figure 7 As shown. The degradation of raw materials during the fermentation of Daqu is due to the action of amylase and saccharifying enzyme. These two enzymes are relatively important enzymes in Daqu, and their enzyme activity directly affects the degradation rate of raw materials. The liquefaction power, i.e., α-amylase, plays a role in degrading raw starch during the fermentation process, providing nutrients for various microorganisms and playing a key role in the production of flavor substances. The changes in amylase activity during the fermentation of Daqu fortified with Bacillus Velez BL-LM and the control Daqu are shown in the figure. Figure 7 As shown, the amylase activity of the enhanced Daqu increased significantly during 5-10 days, the amylase activity of the ordinary Daqu decreased, and the enzyme activity of the BL-LM strain enhanced Daqu reached the highest point of 66.93U / g. 10-15 days, the enzyme activity of the BL-LM strain enhanced Daqu showed a downward trend, and the control Daqu showed an upward trend. 15-20 days, the amylase activity of the BL-LM strain enhanced Daqu and the control Daqu showed the same trend of first increasing and then decreasing. During the entire Daqu fermentation cycle, the amylase activity of the Daqu enhanced by Bacillus Velez BL-LM was much higher than that of the control Daqu. At the end of the 30-day fermentation, the liquefaction power of the Daqu enhanced by Bacillus Velez BL-LM was 40%-50% higher than that of the control Daqu, which was related to the strong amylase secretion ability of Bacillus Velez BL-LM. This can also explain that the degradation rate of sugar substances in the Daqu enhanced by Bacillus Velez BL-LM is faster, which is conducive to the growth of various microorganisms.

[0085] (5) Results of saccharification capacity test of Daqu

[0086] Changes in saccharification power during Daqu fermentation Figure 8 As shown. Glucoamylase, also known as glucoamylase or γ-amylase, is an extracellular enzyme with exonuclease activity. The main function of saccharifying enzyme is to hydrolyze α-1,4 glycosidic bonds from the non-reducing ends of carbon chains such as starch, dextrin, and glycogen in sequence, cut off glucose units one by one, and change the configuration of the hydrolyzed glucose to form β-D-glucose. Figure 8 As shown in the figure, the activity of saccharifying enzymes in Daqu fortified with Bacillus Velez BL-LM was higher than that in the control Daqu during the whole fermentation cycle. At the end of fermentation, the saccharifying power of Daqu fortified with Bacillus Velez BL-LM and the control were 3719.25U / g and 2761.80U / g, respectively, which was beneficial to the later fermentation and improving the yield of wine in the brewing stage.

[0087] Example 4: Detection and analysis of aroma substances in the special-flavor liquor Daqu prepared by Bacillus Velez BL-LM

[0088] The Bacillus Velezii BL-LM, the Daqu prepared therefrom, the preparation method of the Daqu and the experimental grouping method are as described in Example 3. The types and contents of volatile aroma components in the koji were analyzed by headspace solid phase microextraction technology combined with gas chromatography-mass spectrometry.

[0089] Sample pretreatment: Accurately weigh 0.5g Daqu sample, grind it thoroughly, add it to the headspace injection bottle, add 5mL deionized water to soak for 10min, and then add NaCl until saturated. The sample was ultrasonically treated for 30min. The headspace solid phase microextraction used a 50 / 30DVB / CAR / PDMS extraction head to be inserted 2-3mm above the liquid surface in the headspace bottle for headspace adsorption, the extraction temperature was 55℃, and the headspace adsorption time was 30min. Quickly remove the extraction head and immediately insert it into the gas chromatograph injection port (temperature 250℃), and thermal desorption was injected for 4min. The volatile components were detected by Agilent gas chromatography (GC 6890N) / mass spectrometry (MS 5975) coupling instrument, the chromatographic column was DB-Wax (30m×0.25mm×0.25mm), the injection port and detector temperature were 250℃, the carrier gas was He, and the flow rate was 2mL / min. The gas phase detection program started at 50°C and maintained for 2 min, then heated to 85°C at a heating rate of 2°C / min, maintained for 0.1 min, and then heated to 230°C at a heating rate of 5°C / min, maintained for 2 min. The volatile components were detected in full scan mode, and the mass spectrometry conditions were: electron bombardment energy 70eV, ion source temperature 230°C. The volatile aroma substances in the fortified Daqu and the control Daqu fermented for 30 days were identified and analyzed by headspace solid phase microextraction technology combined with gas chromatography-mass spectrometry. The results are shown in Table 1 and Fig. 9 As shown. Alcohols, aldehydes, ketones, organic acids, etc.

[0090] Table 1 Table of characteristic aroma substances of Daqu

[0091]

[0092]

[0093] Note: “+” represents low but detectable content, and “-” represents undetectable content.

[0094] The results in Table 1 show that a total of 62 aroma substances were identified, and the main aroma substances are: 15 pyrazines, 8 aromatic compounds, 12 esters, 10 alcohols, 6 aldehydes, 5 ketones and 5 acids. Among them, the contents of 2,3,5,6-tetramethylpyrazine, 2,3,5-trimethylpyrazine, 3-methyl-1-butanol, guaiacol, phenylethanol and ethyl hexanoate are relatively high. These Daqu aroma components play an important role in the formation of the aroma of the later liquor.

[0095] The pyrazine compounds in Chinese liquor are derived from microorganisms, mainly the metabolism of Bacillus, and their precursors are acetoin and ammonia. From the data in Table 1, it can be seen that the content of pyrazine flavor compounds and the content of precursor acetoin in the Daqu fortified by Bacillus Velez BL-LM are significantly higher than those in the control Daqu, and the types of pyrazine compounds detected in the fortified Daqu are also richer. Therefore, it is predicted that Bacillus Velez BL-LM has good potential for producing pyrazine compounds.

[0096] Aromatic compounds are another important class of compounds in liquor and koji. Although the content of aromatic compounds is small, the threshold is low, the aroma intensity is strong, and the retention time is long. The main aromatic compounds include phenylethanol, benzaldehyde, and 3-phenylpropionic acid ethyl ester. In addition, high-boiling point aromatic compounds such as guaiacol, 4-ethylguaiacol, and 4-vinylguaiacol are related to the sauce flavor. From Table 1 and Fig. 9 The data show that the content of aromatic flavor compounds in Daqu fortified with Bacillus Velez BL-LM is significantly higher than that in the control Daqu, and the types are also richer. Therefore, it can be predicted that Bacillus Velez BL-LM has a good potential for producing aromatic flavor compounds.

[0097] From Table 1 and Fig. 9 From the comparison of the overall volatile aroma compound composition spectrum, the volatile aroma compounds detected in the Daqu fortified with Bacillus Velez BL-LM strain are rich in variety and high in relative content.

[0098] It should be noted that when the claims of the present invention involve numerical ranges, it should be understood that the two endpoints of each numerical range and any numerical value between the two endpoints can be selected. In order to avoid redundancy, the present invention describes a preferred embodiment.

[0099] Although the preferred embodiments of the present invention have been described, those skilled in the art may make other changes and modifications to these embodiments once they have learned the basic creative concept. Therefore, the appended claims are intended to be interpreted as including the preferred embodiments and all changes and modifications that fall within the scope of the present invention.

[0100] Obviously, those skilled in the art can make various changes and modifications to the present invention without departing from the spirit and scope of the present invention. Thus, if these modifications and variations of the present invention fall within the scope of the claims of the present invention and their equivalents, the present invention is also intended to include these modifications and variations.

Claims

1. Bacillus velezensis BL-LM, characterized in that It is deposited in the General Microbiology Center of China Microorganism Culture Collection Administration, with the deposit number CGMCC No.30130 and the deposit date March 25, 2024.

2. Use of the Bacillus Velez BL-LM described in claim 1 in preparing special-flavor liquor Daqu.

3. The use of Bacillus Velez BL-LM in the preparation of special-flavor liquor Daqu according to claim 2, characterized in that: The Velez Bacillus BL-LM is used for increasing the content of pyrazines and their precursor compounds, aromatic compounds and volatile organic acid compounds in the special-flavor liquor Daqu.

4. The use of Bacillus Velez BL-LM in the preparation of special-flavor liquor Daqu according to claim 3, characterized in that: The pyrazines and their precursor compounds include: 2,3,5,6-tetramethylpyrazine, 2,3,5-trimethylpyrazine, 2,3-dimethylpyrazine, 2,3,5-trimethyl-6-ethylpyrazine, 2-isobutyl-3,5,6-trimethylpyrazine, 2,3,5-trimethyl-6-propylpyrazine, 2,6-dimethylpyrazine, 2-ethyl-6-methylpyrazine, 5-isobutyl-2,3-dimethylpyrazine, 3,5-diethyl-2-methylpyrazine, 3-ethyl-2,5-dimethylpyrazine, 2-acetyl-3,4,6-trimethylpyrazine, 2,5-dimethyl-3-propylpyrazine, 2-methyl-5-propylpyrazine, and acetoin.

5. The use of Bacillus Velez BL-LM in the preparation of special-flavor liquor Daqu according to claim 3, characterized in that: The aromatic compounds include: benzaldehyde, phenylethyl alcohol, guaiacol methyl ether, guaiacol, and 4-vinylguaiacol.

6. The use of Bacillus Velez BL-LM in the preparation of special-flavor liquor Daqu according to claim 5, characterized in that: The organic acid compounds include: acetic acid, L-malic acid, 2-methylbutyric acid, 3-methylbutyric acid, and 2-methylhexanoic acid.

7. A method for preparing special-flavor liquor Daqu, characterized in that: The following steps are involved: S1. activating the Bacillus Velezii BL-LM according to claim 1 to obtain a primary seed solution; S2, the first-level seed solution is expanded and cultured until the bacterial concentration is 1×10 8 -5×10 8 CFU / mL, and the secondary seed solution was obtained; S3, dilute the secondary seed solution to a bacterial concentration of 1×10 6 -1×10 7 CFU / mL, the diluted secondary seed liquid is evenly mixed with flour, wheat bran and discarded grains, molded and fermented to obtain the special-flavor liquor Daqu.

8. The method for preparing special-flavor liquor Daqu by using Bacillus Velez BL-LM according to claim 7, characterized in that: The mass ratio of flour, wheat bran, lees and diluted secondary seed liquid is 40-50:40-60:5-10:45-60.

Images