Herbicide-resistant rice mutant gene, protein and application thereof

Abstract

The present application relates to the technical field of biological genes, and particularly relates to a herbicide-resistant rice mutant gene, a protein and application thereof. The herbicide-resistant rice mutant gene provided by the present application is a wild-type rice OsEPSPS gene which is mutated at the 1415th position in the nucleotide sequence, and T is mutated into C, and the nucleotide sequence is shown as SEQ ID NO. 1. A plant containing the herbicide-resistant rice mutant gene or the herbicide-resistant rice mutant protein provided by the present application has excellent resistance to glyphosate herbicide, and the herbicide-resistant rice mutant gene can be widely applied to the work of plant herbicide-resistant breeding.

Description

TECHNICAL FIELD

[0001] The present application relates to the technical field of biological genes, and particularly relates to a herbicide-resistant rice mutant gene, a protein and application thereof. BACKGROUND

[0002] With the popularization of direct seeding technology of rice, problems such as increasing weeds in rice fields and increasing use of herbicides gradually appear. The occurrence of weed species and the diversification of dominant populations increase the resistance of weeds to herbicides, leading to difficulties in weed control and affecting the high yield and stable yield of direct seeding rice. At the same time, the overuse of herbicides in direct seeding rice fields has brought about production safety problems that deserve attention.

[0003] Glyphosate is a non-selective herbicide that can kill weeds and other plants that compete with crops for protection of agricultural and horticultural crops. Due to long-term and large-scale application of glyphosate, at least 48 types of weeds have developed resistance to glyphosate. Glyphosate mainly spreads through its translocation throughout the plant meristem to exert herbicidal effect, so any mechanism that prevents glyphosate from reaching its target enolpyruvyl shikimate phosphate synthase (EPSPS) can lead to glyphosate resistance in plants.

[0004] Generally, glyphosate can bind well to natural EPSPS, and studies have found that the binding ability of mutant EPSPS to glyphosate is reduced, which can tolerate glyphosate. In the 1990s, the agricultural giant Monsanto first isolated the mutant CP4 gene of the EPSPS gene in Agrobacterium and transferred the gene into plants to make them resistant to glyphosate, and obtained glyphosate-resistant soybeans, corn and cotton. With the study of glyphosate-resistant weeds, new EPSPS proteins insensitive to glyphosate have been found, opening up a new path for the cultivation of glyphosate-resistant crops. For example, some variants of EPSPS protein were found in glyphosate-resistant elephant grass, such as the simultaneous mutation of Thr (T) to lle (I) at position 102 and Pro (P) to Ser (S) at position 106.

[0005] However, when using gene editing and other biotechnology methods to create TIPS double mutations of endogenous EPSPS in crops such as rice, it is found that the obtained plants can only survive in the heterozygous state of the EPSPS mutant gene. According to the current crop biological breeding supervision policy, gene editing improved varieties cannot be directly used in the production process. Therefore, it is urgent to develop genes that do not affect plant growth and development and have glyphosate resistance to crops, which is of great significance for the development of homozygous varieties resistant to glyphosate herbicides. SUMMARY

[0006] In order to solve the above technical problems, the application provides an anti-herbicide rice mutant gene, protein and application thereof, a plant containing the anti-herbicide rice mutant gene or the anti-herbicide rice mutant protein provided by the application has excellent resistance to glyphosate herbicide, and the anti-herbicide rice mutant gene can be widely applied to plant anti-herbicide breeding.

[0007] To this end, the application provides the following technical solutions,

[0008] In a first aspect, the application provides, in optional embodiments, an anti-herbicide rice mutant gene, wherein the anti-herbicide rice mutant gene is a wild-type rice OsEPSPS gene which is mutated at the 1415th position in the nucleotide sequence from T to C, and the nucleotide sequence is shown as SEQ ID NO. 1.

[0009] Preferably, the anti-herbicide rice mutant gene is a wild-type rice OsEPSPS gene which is simultaneously mutated at the 1415th position and the 1416th position in the nucleotide sequence, the 1415th position is mutated from T to C, and the 1416th position is mutated from G to T, and the nucleotide sequence is shown as SEQ ID NO. 2.

[0010] Preferably, the anti-herbicide rice mutant gene is a wild-type rice OsEPSPS gene which is simultaneously mutated at the 1415th position and the 1416th position in the nucleotide sequence, the 1415th position is mutated from T to C, and the 1416th position is mutated from G to C, and the nucleotide sequence is shown as SEQ ID NO. 3.

[0011] Preferably, the anti-herbicide rice mutant gene is a wild-type rice OsEPSPS gene which is simultaneously mutated at the 1415th position and the 1416th position in the nucleotide sequence, the 1415th position is mutated from T to C, and the 1416th position is mutated from G to A, and the nucleotide sequence is shown as SEQ ID NO. 4.

[0012] In a second aspect, the application provides, in optional embodiments, an anti-herbicide rice mutant protein, wherein the anti-herbicide rice mutant protein is a wild-type rice OsEPSPS protein which is mutated at the 472nd position in the amino acid sequence from methionine to threonine.

[0013] Preferably, the amino acid sequence of the rice mutant protein is shown as SEQ ID NO. 5, and the amino acid sequence of the wild-type rice OsEPSPS protein is shown as SEQ ID NO. 6.

[0014] In a third aspect, the present application provides, in optional embodiments, a kit, a recombinant vector or a recombinant cell containing the above-mentioned herbicide-resistant rice mutant gene or the above-mentioned herbicide-resistant rice mutant protein.

[0015] In a fourth aspect, the present application provides, in optional embodiments, a herbicide-resistant rice containing the above-mentioned herbicide-resistant rice mutant gene, the above-mentioned herbicide-resistant rice mutant protein or the above-mentioned kit, recombinant vector or recombinant cell.

[0016] Preferably, the herbicide is glyphosate.

[0017] In a fifth aspect, the present application provides, in optional embodiments, a method for obtaining a herbicide-resistant rice, which makes the rice contain the above-mentioned herbicide-resistant rice mutant gene; or makes the rice express the above-mentioned herbicide-resistant rice mutant protein.

[0018] In a sixth aspect, the present application provides, in optional embodiments, the above-mentioned herbicide-resistant rice mutant gene, the above-mentioned herbicide-resistant rice mutant protein, the above-mentioned kit, recombinant vector or recombinant cell for use in making a plant resistant to glyphosate herbicide.

[0019] Preferably, the use comprises introducing the above-mentioned herbicide-resistant rice mutant gene, the above-mentioned herbicide-resistant rice mutant protein, the above-mentioned kit, recombinant vector or recombinant cell into a target plant, so as to make the target plant resistant to glyphosate herbicide.

[0020] The method for introducing the above-mentioned herbicide-resistant rice mutant gene into a target plant comprises chemical mutagenesis, transgenesis, gene editing, hybridization or backcrossing.

[0021] In a seventh aspect, the present application provides, in optional embodiments, the above-mentioned herbicide-resistant rice mutant gene or the above-mentioned herbicide-resistant rice mutant protein for use in breeding plant offspring or plant seeds.

[0022] The nucleotide sequence represented by SEQ ID NO. 1 is as follows:

[0023]

[0024] The nucleotide sequence represented by SEQ ID NO. 2 is as follows:

[0025] ATGGCGTCCAACGCCGCGGCTGCGGCGGCGGTGTCCCTGGACCAGGCCGTGG

[0026] CGGCGTCGGCGGCGTTCTCGTCGCGGAAGCAGCTGCGGCTGCCCGCCGCGGCGCG

[0027] CGGGGGGATGCGGGTGCGGGTGCGGGCGCGGGGGCGGCGGGAGGCGGTGGTGGT

[0028] GGCGTCCGCGTCGTCGTCGTCGGTGGCAGCGCCGGCGGCGAAGGCGGAGGAGAT

[0029] CGTGCTCCAGCCCATCAGGGAGATCTCCGGGGCGGTTCAGCTGCCAGGGTCCAAG

[0030] TCGCTCTCCAACAGGATCCTCCTCCTCTCCGCCCTCTCCGAGGGCACAACAGTGGT

[0031] GGACAACTTGCTGAACAGTGAGGATGTTCACTACATGCTTGAGGCCCTGAAAGCC

[0032] CTCGGGCTCTCTGTGGAAGCAGATAAAGTTGCAAAAAGAGCTGTAGTCGTTGGCT

[0033] GTGGTGGCAAGTTTCCTGTTGAGAAGGATGcGAAAGAGGAAGTGCAACTCTTCTT

[0034] GGGGAACGCTGGAACTGCAATGCGACCATTGACAGCAGCCGTGACTGCTGCTGGT

[0035] GGAAATGCAACTTATGTGCTTGATGGAGTGCCACGAATGAGGGAGAGACCGATTG

[0036] GTTGCACTCTTCGCTGATGGTCCAACTGCTATCAGAGATGTGGCTTCCTGGAGAGT

[0037] GTTGCACTCTTCGCTGATGGTCCAACTGCTATCAGAGATGTGGCTTCCTGGAGAGT

[0038] GTTGCACTCTTCGCTGATGGTCCAACTGCTATCAGAGATGTGGCTTCCTGGAGAGT

[0039] GTTGCACTCTTCGCTGATGGTCCAACTGCTATCAGAGATGTGGCTTCCTGGAGAGT

[0040] GTTGCACTCTTCGCTGATGGTCCAACTGCTATCAGAGATGTGGCTTCCTGGAGAGT

[0041] GTTGCACTCTTCGCTGATGGTCCAACTGCTATCAGAGATGTGGCTTCCTGGAGAGT

[0042] GTTGCACTCTTCGCTGATGGTCCAACTGCTATCAGAGATGTGGCTTCCTGGAGAGT

[0043] GTTGCACTCTTCGCTGATGGTCCAACTGCTATCAGAGATGTGGCTTCCTGGAGAGT

[0044] GTTGCACTCTTCGCTGATGGTCCAACTGCTATCAGAGATGTGGCTTCCTGGAGAGT

[0045] GTTGCACTCTTCGCTGATGGTCCAACTGCTATCAGAGATGTGGCTTCCTGGAGAGT

[0046] GTTGCACTCTTCGCTGATGGTCCAACTGCTATCAGAGATGTGGCTTCCTGGAGAGT

[0047] GTTGCACTCTTCGCTGATGGTCCAACTGCTATCAGAGATGTGGCTTCCTGGAGAGT

[0048] AAAGGAAACCGAAAGGATGGTTGCAATTCGGACCGAGCTAACAAAGCTGGGAGC

[0049] ATCGGTTGAAGAAGGTCCTGACTACTGCATCATCACCCCACCGGAGAAGCTGAAC

[0050] ATCACGGCAATCGACACCTACGATGATCACAGGACTGCCATGGCCTTCTCCCTCGC

[0051] TGCCTGCGCCGACGTGCCCGTGACGATCAGGGACCCTGGTTGCACCCGCAAGACCTTCCCCAACTACTTCGACGTTCTAAGCACTTTCGTCAGGAACTGA.

[0052] The nucleotide sequence represented by SEQ ID NO. 3 is as follows:

[0053] ATGGCGTCCAACGCCGCGGCTGCGGCGGCGGTGTCCCTGGACCAGGCCGTGG

[0054] CGGCGTCGGCGGCGTTCTCGTCGCGGAAGCAGCTGCGGCTGCCCGCCGCGGCGCG

[0055] CGGGGGGATGCGGGTGCGGGTGCGGGCGCGGGGGCGGCGGGAGGCGGTGGTGGT

[0056] GGCGTCCGCGTCGTCGTCGTCGGTGGCAGCGCCGGCGGCGAAGGCGGAGGAGAT

[0057] CGTGCTCCAGCCCATCAGGGAGATCTCCGGGGCGGTTCAGCTGCCAGGGTCCAAG

[0058] TCGCTCTCCAACAGGATCCTCCTCCTCTCCGCCCTCTCCGAGGGCACAACAGTGGT

[0059] GGACAACTTGCTGAACAGTGAGGATGTTCACTACATGCTTGAGGCCCTGAAAGCC

[0060] CTCGGGCTCTCTGTGGAAGCAGATAAAGTTGCAAAAAGAGCTGTAGTCGTTGGCT

[0061] GTGGTGGCAAGTTTCCTGTTGAGAAGGATGcGAAAGAGGAAGTGCAACTCTTCTT

[0062] GGGGAACGCTGGAACTGCAATGCGACCATTGACAGCAGCCGTGACTGCTGCTGGT

[0063] GGAAATGCAACTTATGTGCTTGATGGAGTGCCACGAATGAGGGAGAGACCGATTG

[0064] GTGACTTGGTTGTCGGGTTGAAACAACTTGGTGCGGATGTCGACTGTTTCCTTGGC

[0065] ACTGAATGCCCACCTGTTCGTGTCAAGGGAATTGGAGGACTTCCTGGTGGCAAGG

[0066] TTAAGCTCTCTGGTTCCATCAGCAGTCAGTACTTGAGTGCCTTGCTGATGGCTGCT

[0067] CCTTTGGCCCTTGGGGATGTGGAGATCGAAATCATTGACAAACTAATCTCCATTCCT

[0068] TACGTTGAAATGACATTGAGATTGATGGAGCGTTTTGGTGTGAAGGCAGAGCATTC

[0069] TGATAGTTGGGACAGATTCTATATTAAGGGAGGGCAGAAGTACAAATCTCCTGGAA

[0070] ATGCCTATGTTGAAGGTGATGCCTCAAGCGCGAGCTATTTCTTGGCTGGTGCTGCA

[0071] ATCACTGGAGGCACTGTGACAGTTCAAGGTTGTGGTACGACCAGTTTGCAGGGTG

[0072] ATGTCAAATTTGCTGAGGTACTTGAGATGATGGGAGCAAAGGTTACATGGACTGAC

[0073] ACCAGTGTAACCGTAACTGGTCCACCACGTGAGCCTTATGGGAAGAAACACCTGA

[0074] AAGCTGTTGATGTCAACATGAACAAAATGCCTGATGTTGCCATGACCCTTGCCGTT

[0075] GTTGCACTCTTCGCTGATGGTCCAACTGCTATCAGAGATGTGGCTTCCTGGAGAGT

[0076] AAAGGAAACCGAAAGGATGGTTGCAATTCGGACCGAGCTAACAAAGCTGGGAGC

[0077] ATCGGTTGAAGAAGGTCCTGACTACTGCATCATCACCCCACCGGAGAAGCTGAAC

[0078] ATCACGGCAATCGACACCTACGATGATCACAGGACCGCCATGGCCTTCTCCCTCGC

[0079] TGCCTGCGCCGACGTGCCCGTGACGATCAGGGACCCTGGTTGCACCCGCAAGACCTTCCCCAACTACTTCGACGTTCTAAGCACTTTCGTCAGGAACTGA.

[0080] The nucleotide sequence represented by SEQ ID NO. 4 is as follows:

[0081] ATGGCGTCCAACGCCGCGGCTGCGGCGGCGGTGTCCCTGGACCAGGCCGTGG

[0082] CGGCGTCGGCGGCGTTCTCGTCGCGGAAGCAGCTGCGGCTGCCCGCCGCGGCGCG

[0083] CGGGGGGATGCGGGTGCGGGTGCGGGCGCGGGGGCGGCGGGAGGCGGTGGTGGT

[0084] GGCGTCCGCGTCGTCGTCGTCGGTGGCAGCGCCGGCGGCGAAGGCGGAGGAGAT

[0085] CGTGCTCCAGCCCATCAGGGAGATCTCCGGGGCGGTTCAGCTGCCAGGGTCCAAG

[0086] TCGCTCTCCAACAGGATCCTCCTCCTCTCCGCCCTCTCCGAGGGCACAACAGTGGT

[0087] GGACAACTTGCTGAACAGTGAGGATGTTCACTACATGCTTGAGGCCCTGAAAGCC

[0088] CTCGGGCTCTCTGTGGAAGCAGATAAAGTTGCAAAAAGAGCTGTAGTCGTTGGCT

[0089] GTGGTGGCAAGTTTCCTGTTGAGAAGGATGcGAAAGAGGAAGTGCAACTCTTCTT

[0090] GGGGAACGCTGGAACTGCAATGCGACCATTGACAGCAGCCGTGACTGCTGCTGGT

[0091] GGAAATGCAACTTATGTGCTTGATGGAGTGCCACGAATGAGGGAGAGACCGATTG

[0092] GTGACTTGGTTGTCGGGTTGAAACAACTTGGTGCGGATGTCGACTGTTTCCTTGGC

[0093] ACTGAATGCCCACCTGTTCGTGTCAAGGGAATTGGAGGACTTCCTGGTGGCAAGG

[0094] TTAAGCTCTCTGGTTCCATCAGCAGTCAGTACTTGAGTGCCTTGCTGATGGCTGCT

[0095] CCTTTGGCCCTTGGGGATGTGGAGATCGAAATCATTGACAAACTAATCTCCATTCCT

[0096] TACGTTGAAATGACATTGAGATTGATGGAGCGTTTTGGTGTGAAGGCAGAGCATTC

[0097] TGATAGTTGGGACAGATTCTATATTAAGGGAGGGCAGAAGTACAAATCTCCTGGAA

[0098] ATGCCTATGTTGAAGGTGATGCCTCAAGCGCGAGCTATTTCTTGGCTGGTGCTGCA

[0099] ATCACTGGAGGCACTGTGACAGTTCAAGGTTGTGGTACGACCAGTTTGCAGGGTG

[0100] ATGTCAAATTTGCTGAGGTACTTGAGATGATGGGAGCAAAGGTTACATGGACTGAC

[0101] ACCAGTGTAACCGTAACTGGTCCACCACGTGAGCCTTATGGGAAGAAACACCTGA

[0102] AAGCTGTTGATGTCAACATGAACAAAATGCCTGATGTTGCCATGACCCTTGCCGTT

[0103] GTTGCACTCTTCGCTGATGGTCCAACTGCTATCAGAGATGTGGCTTCCTGGAGAGT

[0104] AAAGGAAACCGAAAGGATGGTTGCAATTCGGACCGAGCTAACAAAGCTGGGAGC

[0105] ATCGGTTGAAGAAGGTCCTGACTACTGCATCATCACCCCACCGGAGAAGCTGAAC

[0106] ATCACGGCAATCGACACCTACGATGATCACAGGACAGCCATGGCCTTCTCCCTCGC

[0107] TGCCTGCGCCGACGTGCCCGTGACGATCAGGGACCCTGGTTGCACCCGCAAGACCTTCCCCAACTACTTCGACGTTCTAAGCACTTTCGTCAGGAACTGA.

[0108] The amino acid sequence of SEQ ID NO. 5 is shown below:

[0109] MASNAAAAAAVSLDQAVAASAAFSSRKQLRLPAAARGGMRVRVRARGRREAVVVASASSSSVAAPAAKAEEIVLQPIREISGAVQLPGSKSLSNRILLLSALSEGTTVVDNLLNSEDVHYMLEALKALGLSVEADKVAKRAVVVGCGGKFPVEKDAKEEVQLFLGNAGTAMRPLTAAVTAAGGNATYVLDGVPRMRERPIGDLVVGLKQLGADVDCFLGTECPPVRVKGIGGLPGGKVKLSGSISSQYLSALLMAAPLALGDVEIEIIDKLISIPYVEMTLRLMERFGVKAEHSDSWDRFYIKGGQKYKSPGNAYVEGDASSASYFLAGAAITGGTVTVQGCGTTSLQGDVKFAEVLEMMGAKVTWTDTSVTVTGPPREPYGKKHLKAVDVNMNKMPDVAMTLAVVALFADGPTAIRDVASWRVKETERMVAIRTELTKLGASVEEGPDYCIITPPEKLNITAIDTYDDHRTAMAFSLAACADVPVTIRDPGCTRKTFPNYFDVLSTFVRN.

[0110] The amino acid sequence of SEQ ID NO. 6 is shown below:

[0111] MASNAAAAAAVSLDQAVAASAAFSSRKQLRLPAAARGGMRVRVRARGRREAVVVASASSSSVAAPAAKAEEIVLQPIREISGAVQLPGSKSLSNRILLLSALSEGTTVVDNLLNSEDVHYMLEALKALGLSVEADKVAKRAVVVGCGGKFPVEKDAKEEVQLFLGNAGTAMRPLTAAVTAAGGNATYVLDGVPRMRERPIGDLVVGLKQLGADVDCFLGTECPPVRVKGIGGLPGGKVKLSGSISSQYLSALLMAAPLALGDVEIEIIDKLISIPYVEMTLRLMERFGVKAEHSDSWDRFYIKGGQKYKSPGNAYVEGDASSASYFLAGAAITGGTVTVQGCGTTSLQGDVKFAEVLEMMGAKVTWTDTSVTVTGPPREPYGKKHLKAVDVNMNKMPDVAMTLAVVALFADGPTAIRDVASWRVKETERMVAIRTELTKLGASVEEGPDYCIITPPEKLNITAIDTYDDHRMAMAFSLAACADVPVTIRDPGCTRKTFPNYFDVLSTFVRN.

[0112] Compared with the prior art, the present application has one or more of the following advantages:

[0113] 1. The plant containing the anti-herbicide rice mutant gene or anti-herbicide rice mutant protein provided by the present application has excellent resistance to glyphosate herbicide, and the anti-herbicide rice mutant gene can be widely applied to plant anti-herbicide breeding work. BRIEF DESCRIPTION OF DRAWINGS

[0114] Figure 1 Figure 1 is a photo of the resistant callus screened in Example 2 of the present application on a medium containing glyphosate herbicide;

[0115] Figure 2 Figure 2 is the site sequencing result of the anti-herbicide rice mutant gene in Example 2 of the present application;

[0116] Figure 3 Figure 3 is a schematic diagram of the growth results of four mutant rice and wild-type rice in Example 3 of the present application after spraying 1 times recommended concentration of glyphosate herbicide. DETAILED DESCRIPTION

[0117] In order to make the purpose, technical solutions and advantages of the present invention more clearly understood, the present invention is further described in detail below in conjunction with specific embodiments. It should be understood that the specific embodiments described herein are only used to explain the present invention and are not intended to limit the present invention.

[0118] Unless otherwise specified, the experimental methods used in the following examples are conventional methods.

[0119] Unless otherwise specified, the materials and reagents used in the following examples can be obtained from commercial sources.

[0120] Example 1

[0121] This embodiment provides a method for constructing a guide editing vector for a herbicide-resistant rice mutant gene, comprising the following steps:

[0122] Taking rice as an example, the nucleotide sequence cacctacgatgatcacaggat in the plant OsEPSPS gene was selected. gg , as the targeting site, the underlined part is the PAM sequence, and the SpCas9 protein-mediated guide editing system pHUC411-PE2 is used, which can introduce pre-designed target mutations into the genome. According to the analysis of the plant pegRNA design website PlantPegDesigner (http: / / www.plantgenomeediting.net / ), the SgRNA, RT and PBS sequences of the corresponding targets were obtained. According to the analysis of the pegRNA design and optimization tool pegLIT (https: / / peglit.liugroup.us / ), there is a corresponding 8bp linker between the PBS sequence and evopreQ1 of each target. Therefore, the pegRNA sequences of each herbicide-resistant rice mutant gene obtained are as follows:

[0123] PEGRNA1 that converts TG to CG:

[0124] CACCTACGATGATCACAGGAGTTTTCAGAGCTATGCTGGAAACAGCATAGCAAGTTGAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCAAGGCCATGGCCGTCCTGTGATCATCGCCCTAATTTTGACGCGGTTCTATCTAGTTACGCGTTAAACCAACTAGAAA.

[0125] PEGRNA2 that converts TG to CA:

[0126] CACCTACGATGATCACAGGAGTTTCAGAGCTATGCTGGAAACAGCATAGCAAGTTGAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCAAGGCCATGGCTGTCCTGTGATCATCGCCCTAATTTTGACGCGGTTCTATCTAGTTACGCGTTAAACCAACTAGAAA.

[0127] PegRNA4 to change TG to CT:

[0128] CACCTACGATGATCACAGGAGTTTCAGAGCTATGCTGGAAACAGCATAGCAAGTTGAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCAAGGCCATGGCGGTCCTGTGATCATCGCCCTAATTTTGACGCGGTTCTATCTAGTTACGCGTTAAACCAACTAGAAA.

[0129] PegRNA4 to change TG to CT:

[0130] CACCTACGATGATCACAGGAGTTTCAGAGCTATGCTGGAAACAGCATAGCAAGTTGAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCAAGGCCATGGCAGTCCTGTGATCATCGCCCTAATTTTGACGCGGTTCTATCTAGTTACGCGTTAAACCAACTAGAAA.

[0131] Synthesize forward oligonucleotide strand and reverse oligonucleotide strand complementary thereto of the pegRNA respectively, anneal to form double strands.

[0132] The pHUC411-PE2 vector was digested with BsaI endonuclease (purchased from NEB) at 37°C for 4 hours, and the enzyme digestion system was inactivated at 65°C for 10 minutes, as a backbone fragment of the recombinant vector. The backbone fragment of the recombinant vector and the sgRNA Scoffold were connected end to end by the Goldgate method (NEB), and were introduced into E. coli. Positive transformants were obtained by selecting bacterial plaques with kanamycin resistance and without spectinomycin resistance. After sequencing verification, the positive plasmid was extracted to construct a guide editing vector plasmid for CRISPR / Cas9 of the plant OsEPSPS gene, and was named pHUC411-PE2-OsEPSPS1, pHUC411-PE2-OsEPSPS2, pHUC411-PE2-OsEPSPS3, and pHUC411-PE2-OsEPSPS4, respectively. The plant expression vector was introduced into Agrobacterium tumefaciens EHA105 by the freeze-thaw method, and positive clones were obtained by colony PCR screening, to obtain Agrobacterium containing pHUC411-PE2-OsEPSPS1, pHUC411-PE2-OsEPSPS2, pHUC411-PE2-OsEPSPS3, and pHUC411-PE2-OsEPSPS4.

[0133] Example 2

[0134] The present embodiment provides a method for obtaining a positive transgenic plant, comprising the following steps:

[0135] (1) After removing the husk of mature seeds, the seeds were soaked in 70% alcohol for 1 min, the alcohol was poured out, and then the seeds were soaked in a 50% sodium hypochlorite solution containing 1 drop of Tween 20 (the original solution had a chlorine concentration of more than 4%) for 40 min (150 r / min), the sodium hypochlorite was poured out, and the seeds were washed with sterile water for 5 times until the solution was clear and had no sodium hypochlorite taste. The seeds were then soaked in sterile water overnight, and the pre-treated seeds were peeled along the aleurone layer with a scalpel, the embryo was peeled off, and the embryo was inoculated on a callus induction medium. After 11 days of dark culture at 30°C, the callus was separated from the endosperm and scion, and good-quality, vigorous primary callus tissue was obtained.

[0136] (2) The primary callus tissue was added to a selection medium (a glyphosate solution was added to the induction medium) containing 5 mM glyphosate, and selection was performed for 28-42 days, and the callus was observed at irregular intervals until resistant callus particles with normal growth appeared. See Figure 1 .

[0137] (3) The resistant screened callus particles are transferred to a differentiation medium with a slightly lower concentration, and regenerated and differentiated into seedlings. The specific differentiation medium is: N6 bulk, MS iron salt, B5 trace, B5 vitamin, 500 mg / L proline, 1 g / L casein enzymatic hydrolysate, 30 g / L sucrose, 1.5 mg / L naphthalene acetic acid, 1 mg / L 6-benzyl adenine, 2.5 g / L phytagel, 2 mM glyphosate. Finally, the sprouts or seedlings are transferred to the MS rooting medium, sampled and detected, and subjected to tissue sequencing analysis.

[0138] After genetic transformation of rice, a series of pHUC411-PE2-OsEPSPS rice were obtained, and the genomic DNA extracted from the plants was sent to Invitrogen Company for genome sequencing. Compared with the wild type Nipponbare OsEPSPS gene, it was found that the nucleotide sequence of the OsEPSPS gene was mutated at positions 1415 and 1416, respectively: the mutation of T to C at position 1415, the nucleotide sequence of the mutation is shown in SEQ ID NO. 1, the mutation of T to C at position 1415 and G to T at position 1416, the nucleotide sequence of the mutation is shown in SEQ ID NO. 2, the mutation of T to C at position 1415 and G to C at position 1416, the nucleotide sequence of the mutation is shown in SEQ ID NO. 3, the mutation of T to C at position 1415 and G to A at position 1416, the nucleotide sequence of the mutation is shown in SEQ ID NO. 4, see Figure 2 , which results in a mutation of methionine (M) to threonine (T) at position 472 of the amino acid sequence of the OsEPSPS protein, and the amino acid sequence of the mutation is shown in SEQ ID NO. 5.

[0139] Example 3

[0140] This example provides a resistance experiment of the mutation site of the rice of Example 2:

[0141] Mutants OsEPSPS1, OsEPSPS2, OsEPSPS3 and OsEPSPS4 are respectively introduced into the wild type Nipponbare rice with the genomic sequences of SEQ ID NO. 1, SEQ ID NO. 2, SEQ ID NO. 3 and SEQ ID NO. 4.

[0142] The four mutant rice and the wild type Nipponbare rice are planted respectively, and the homozygous seeds are harvested.

[0143] Preparation of herbicide diluent: glyphosate isopropylamine salt herbicide with 41% effective component of glyphosate was selected, 10 mM was the recommended concentration for field use, and was further used for 3-4 leaf stage seedlings after germination.

[0144] With the homozygous seeds of four mutant rice and wild type rice seeds as the material, after soaking at 28℃ for 1-2 days, they were placed on wet filter paper to germinate, 100 seedlings of 20 days old of four mutant rice and wild type rice with the same growth and size were randomly selected, 5-8 seedlings were planted in one pot, and the four mutant rice and wild type rice were divided into five areas, the area of four mutant rice was used as the experimental group, and the area of wild type rice was used as the control group, 50 seedlings were planted in each area.

[0145] The prepared herbicide diluent was uniformly sprayed on the leaf surface of wild type rice and four mutant rice, and the phenotype changes of rice plants were observed regularly, it can be found that after spraying herbicide for 7 days, wild type rice began to appear large area of wilting and death, while the leaves of four mutant rice can grow normally. Continue to observe, after 20 days of treatment, the mutant plants elongated to 25 cm, and the leaves grew completely normally. The results are shown in Figure 3 .

[0146] Therefore, it is shown that the mutation occurs at the 1415th and 1416th nucleotides of the nucleotide sequence of OsEPSPS gene, which can make the rice resistant to glyphosate herbicide.

[0147] Further, the survived plants were transferred to the field for growth, and the seeds were harvested at the mature stage.

[0148] Although the principles of the present application have been described in detail with reference to the preferred embodiments thereof, it is to be understood that the above-described embodiments are merely illustrative of the present application and are not intended to limit the scope of the present application. The details in the embodiments do not constitute a limitation on the scope of the present application, and any obvious changes, simple replacements and the like based on the technical solutions of the present application, which do not depart from the spirit and scope of the present application, are all within the scope of protection of the present application.

Claims

1. A herbicide-resistant rice mutant gene, characterized in that: The herbicide-resistant rice mutant gene is a wild-type rice OsEPSPS gene with a mutation at position 1415 in the nucleotide sequence, from T to C. The nucleotide sequence is shown in SEQ ID NO.1, and the herbicide-resistant gene is glyphosate.

2. The herbicide-resistant rice mutant gene according to claim 1, characterized in that: The herbicide-resistant rice mutant gene is a wild-type rice OsEPSPS gene with mutations at positions 1415 and 1416 in the nucleotide sequence, with position 1415 mutated from T to C and position 1416 mutated from G to T. The nucleotide sequence is shown in SEQ ID NO.

2.

3. The herbicide-resistant rice mutant gene according to claim 1, characterized in that: The herbicide-resistant rice mutant gene is a wild-type rice OsEPSPS gene with mutations at positions 1415 and 1416 in the nucleotide sequence, with position 1415 mutated from T to C and position 1416 mutated from G to C. The nucleotide sequence is shown in SEQ ID NO.

3.

4. The herbicide-resistant rice mutant gene according to claim 1, characterized in that: The herbicide-resistant rice mutant gene is a wild-type rice OsEPSPS gene with mutations at positions 1415 and 1416 in the nucleotide sequence, with position 1415 mutated from T to C and position 1416 mutated from G to A. The nucleotide sequence is shown in SEQ ID NO.

4.

5. A herbicide-resistant rice mutant protein, characterized in that: The herbicide-resistant rice mutant protein is a wild-type rice OsEPSPS protein with a mutation at position 472 in the amino acid sequence, from methionine to threonine; The amino acid sequence of the rice mutant protein is shown in SEQ ID NO.5, the amino acid sequence of the wild-type rice OsEPSPS protein is shown in SEQ ID NO.6, and the herbicide is glyphosate.

6. A kit or recombinant vector comprising the herbicide-resistant rice mutant gene according to any one of claims 1 to 4 or the herbicide-resistant rice mutant protein according to claim 5, wherein the herbicide is glyphosate.

7. A method for obtaining herbicide-resistant rice, characterized in that: Making rice contain the herbicide-resistant rice mutant gene according to any one of claims 1 to 4; or causing rice to express the herbicide-resistant rice mutant protein according to claim 5; The herbicide is glyphosate.

Images