Candida antarctica lipase B mutant protein and application thereof

Abstract

The invention belongs to the technical field of directed evolution modification and biological catalysis application of enzymes, and relates to a Candida antarctica lipase B mutant protein and application thereof, the sequence of the mutant protein comprises one or more of the mutation of the 195 S and F, the mutation of the 195 S and Y and the mutation of the 283 A and Y from the N terminal to the C terminal of the amino acid sequence shown in SEQ ID NO.1 of the original CALB; on the basis of a wild type lipase gene sequence, through rational design and site-specific mutagenesis, mutants S195F, S195Y, A283Y, S195F-A283Y and S195Y-A283Y, of which the Tm value and the optimal reaction temperature are obviously improved and the catalytic activity is improved by 1-2 times, are finally obtained; when the mutant is used for catalyzing synthesis of docosahexaenoic acid (DHA) glyceride, higher catalytic efficiency is shown, and the yield of the DHA glyceride is effectively improved.

Description

Technical Field

[0001] This invention belongs to the field of directed evolutionary modification of enzymes and biocatalysis application technology, and relates to a mutant protein of Candida antarctica lipase B (CALB) and its application. Background Technology

[0002] Lipases possess the ability to efficiently catalyze reactions such as hydrolysis and transesterification, and are widely used in various industries including food and pharmaceuticals. Among these, microbial lipases have become the mainstream in industry. Industrial catalysis often requires high-temperature environments, which can accelerate reaction rates, increase reactant solubility, reduce the risk of microbial contamination, and save cooling costs. However, natural microbial lipases are easily inactivated at high temperatures, greatly limiting their industrial applications. Therefore, the development of highly heat-resistant and highly active lipases is crucial for industrial development.

[0003] Antarctic Candida lipase B (CALB, PDB ID: 1TCA) has a molecular weight of 33.5 kD and possesses a typical structure of an S105-Asp187-His224 catalytic triplet and a Thr40-Gln106 oxygen anion hole. Its catalytic performance depends on its unique three-dimensional conformation. Thanks to its specific substrate-binding pocket, it exhibits excellent activity in both ester synthesis and hydrolysis, and demonstrates superior regioselectivity and enantioselectivity. Due to its high stability and strong catalytic activity in non-aqueous systems, CALB is widely used in pharmaceutical intermediate synthesis, biodiesel production, and food processing. However, wild-type CALB (WT) suffers from poor thermal stability, and its enzyme activity level is insufficient to meet the growing demands of industrial catalysis. These dual bottlenecks limit its application in high-temperature industrial settings. Therefore, improving the optimal reaction temperature, heat resistance, and catalytic activity of CALB is crucial for expanding its industrial applications.

[0004] Docosahexaenoic acid (DHA) is a long-chain omega-3 polyunsaturated fatty acid (PUFA). At room temperature, it is a colorless, transparent liquid with a fishy odor. Because of its crucial role in brain and retinal development, it is known as "brain gold." As an essential fatty acid, DHA cannot be synthesized by the human body and must be obtained from external sources. Its molecular structure contains a long carbon chain and six double bonds. The multiple unsaturated double bonds make it chemically reactive and easily oxidized; therefore, DHA in nature almost always exists in the form of glycerol esters.

[0005] The main approaches to improving the catalytic properties of lipases include natural screening, protein engineering, immobilization techniques, chemical modification, and media engineering optimization. Among these, protein engineering, as a molecular modification method, primarily includes directed evolution and rational design. Existing methods can usually improve one or two properties of enzymes, but there are few reports on simultaneously improving multiple catalytic properties such as optimal reaction temperature, heat resistance, and catalytic activity.

[0006] Based on published literature and patents, methods to improve the thermal stability of CALB mainly include protein engineering, immobilization technology, chemical modification, and media engineering optimization. Protein engineering involves rationally designing and introducing suitable mutation sites, such as in patent (CN202010100869.9), which involves site-directed mutagenesis of amino acids 146, 278, and 151 to obtain mutants A146G-L278M and A146G-L278M-A151P. These mutants increased the thermal inactivation temperature by 3.3℃ and 4.2℃, respectively, increased the optimal reaction temperature by 5℃, and improved the catalytic efficiency by 4.1 times.

[0007] Patent (CN201110406922.9) obtained single / double mutants of D223G and L278M by site-directed saturation mutation of the CALB gene through semi-rational design. The double mutant has a half-life of 13 times that of the wild type at 48℃, an increase of 12℃ in half-inactivation temperature, and an increase of 6.5℃ in optimum temperature. The single mutant L278M has a catalytic efficiency increased by 40%, a half-life of 6.4 times that at 48℃, and an increase in optimum temperature of 2.5℃. Patent (CN201610428122.X) screened highly flexible residue mutations based on B-factor values, centered on CALB catalytic residues, and obtained mutant F344Ile / Met with a T50 increase of 7.7-7.9℃ and a catalytic efficiency of 0.94-1.23 times that of the wild type. The mutant VarB3 has an optimum temperature, T50, and Tm all increased by 13-15℃, a half-life extended by 40 times, and no change in catalytic efficiency.

[0008] The CALB mutant obtained through targeted mutagenesis (patent CN202311334304.7) exhibits a 3.2–4.9-fold increase in catalytic ester bond hydrolysis activity and a 2.21-fold increase in transesterification activity, along with significantly improved thermal stability at 80°C. Kim et al. predicted CALB thermal stability using B-factor analysis combined with the Rosetta Design algorithm and screened for the mutant R249L, which showed a 2.3°C increase in Tm value (KIM et al., 2010). Xie et al. obtained a double mutant through targeted mutagenesis near the active site, with a 14-fold increase in half-life at 48°C compared to the wild type and a 3.6°C increase in Tm value (XIE et al., 2014). Zhang et al. obtained mutants 23G5 and 195F1 using two rounds of error-prone PCR, with a 20-fold increase in half-life at 70°C compared to the wild type and enhanced hydrolytic activity (ZHANG et al., 2003).

[0009] Despite extensive research on CALB modification, the CALB mutants obtained through directed mutation still suffer from poor thermal stability and enzyme activity levels that are difficult to match the growing industrial catalytic demands. These dual bottlenecks restrict their application in high-temperature industrial settings, and these problems have become long-standing technical challenges that have remained unresolved. Summary of the Invention

[0010] The problem this invention aims to solve is that the existing Candida antarcticis lipase B (CALB) suffers from poor thermostability and its enzyme activity level is difficult to match the increasing industrial catalytic demands, thus restricting its application in high-temperature industrial scenarios. This invention provides a mutant protein of CALB, which, through enzyme engineering molecular modification, exhibits excellent thermostability and high enzyme activity, thereby broadening the industrial applications of CALB.

[0011] Therefore, the first aspect of the present invention provides a mutant protein of Candida antarcticis lipase B, the sequence of which includes one or more mutations at positions 195 (S and F), 195 (S and Y), and 283 (A and Y) of the amino acid sequence of the original CALB as shown in SEQ ID NO.1 from the N-terminus to the C-terminus.

[0012] In some embodiments of the present invention, the mutant protein is CALB mutant protein No. 1, the sequence of which contains a mutation of S and F at position 195 from the N-terminus to the C-terminus of the amino acid sequence of the original CALB as shown in SEQ ID NO. 1; preferably, the sequence of the CALB mutant protein No. 1 is shown in SEQ ID NO. 2.

[0013] In some embodiments of the present invention, the mutant protein is a CALB mutant protein No. 2, the sequence of which contains a mutation of S and Y at position 195 from the N-terminus to the C-terminus of the original CALB amino acid sequence as shown in SEQ ID NO. 1; preferably, the sequence of the CALB mutant protein No. 2 is shown in SEQ ID NO. 3.

[0014] In some embodiments of the present invention, the mutant protein is a CALB mutant protein No. 3, the sequence of which contains a mutation of A and Y at position 283 from the N-terminus to the C-terminus of the original CALB amino acid sequence as shown in SEQ ID NO. 1; preferably, the sequence of the CALB mutant protein No. 3 is shown in SEQ ID NO. 4.

[0015] In some embodiments of the present invention, the mutant protein is CALB mutant protein No. 4, the sequence of which contains mutations at positions 195 (S and F) and 283 (A and Y) of the amino acid sequence of the original CALB as shown in SEQ ID NO. 1 from the N-terminus to the C-terminus; preferably, the sequence of the CALB mutant protein No. 4 is shown in SEQ ID NO. 5.

[0016] In some embodiments of the present invention, the mutant protein is a CALB mutant protein No. 5, the sequence of which contains a mutation at position 195 (S and Y) and position 283 (A and Y) of the amino acid sequence of the original CALB as shown in SEQ ID NO. 1 from the N-terminus to the C-terminus; preferably, the sequence of the CALB mutant protein No. 5 is shown in SEQ ID NO. 6.

[0017] The second aspect of the present invention provides a nucleotide molecule encoding the mutant protein described in the first aspect of the present invention, wherein the sequence contains one or more of the following mutations located in the nucleotide sequence encoding the original CALB as shown in SEQ ID NO.1: C to T at position 584, C to A at position 584, G to T at position 847, C to A at position 848, and A to C at position 849.

[0018] In some embodiments of the present invention, the nucleotide molecule is a nucleotide molecule encoding the CALB mutant protein number 1, the sequence of which contains a C and T mutation at position 584 in the direction from the 5′ end to the 3′ end of the nucleotide sequence of the amino acid sequence of the original CALB as shown in SEQ ID NO.1; preferably, the nucleotide sequence of the nucleotide molecule encoding the CALB mutant protein is shown in SEQ ID NO.8.

[0019] In some embodiments of the present invention, the nucleotide molecule is a nucleotide molecule encoding the CALB mutant protein number 2, the sequence of which contains a mutation at position 584 C and A in the direction from the 5′ end to the 3′ end of the nucleotide sequence of the original CALB as shown in SEQ ID NO.1; preferably, the nucleotide sequence of the nucleotide molecule encoding the CALB mutant protein is shown in SEQ ID NO.9.

[0020] In some embodiments of the present invention, the nucleotide molecule is a nucleotide molecule encoding the CALB mutant protein number 3, the sequence of which contains mutations at positions 847 (G and T), 848 (C and A), and 849 (A and C) in the nucleotide sequence of ...

[0021] In some embodiments of the present invention, the nucleotide molecule is a nucleotide molecule encoding the CALB mutant protein number 4, the sequence of which contains mutations at positions 584 (C and T), 847 (G and T), 848 (C and A), and 849 (A and C) in the nucleotide sequence of ...

[0022] In some embodiments of the present invention, the nucleotide molecule is a nucleotide molecule encoding the CALB mutant protein number 5, the sequence of which contains mutations at positions 584 (C and A), 847 (G and T), 848 (C and A), and 849 (A and C) in the nucleotide sequence of ...

[0023] According to the present invention, the nucleotide molecule is a DNA molecule as follows:

[0024] (a1) A DNA molecule whose coding region includes the nucleotide sequences shown in SEQ ID NO.8, SEQ ID NO.9, SEQ ID NO.10, SEQ ID NO.11, and SEQ ID NO.12;

[0025] (a2) DNA molecules with nucleotide sequences as shown in SEQ ID NO.8, SEQ ID NO.9, SEQ ID NO.10, SEQ ID NO.11, and SEQ ID NO.12;

[0026] (a3) has 95% or more identity with the nucleotide sequence described in (a1) or (a2) and is a DNA molecule encoding the protein described in the second aspect of the invention;

[0027] (a4) hybridizes under stringent conditions with the nucleotide sequence described in (a1) or (a2) and encodes a DNA molecule that encodes the protein described in the first aspect of the invention.

[0028] A third aspect of the present invention provides an expression cassette containing the nucleotide molecules described in the fourth aspect of the present invention.

[0029] A fourth aspect of the present invention provides a recombinant vector containing the nucleotide molecules described in the fourth aspect of the present invention.

[0030] In some embodiments of the present invention, the recombinant vector is pGAPZ(Mα)A.

[0031] The fifth aspect of the present invention provides a recombinant microorganism containing the nucleotide molecules described in the fourth aspect of the present invention.

[0032] In some embodiments of the present invention, the host cell of the recombinant microorganism is Pichia pastoris.

[0033] The sixth aspect of the present invention provides a method for preparing a mutant protein as described in the second aspect of the present invention, which includes fermenting and culturing the recombinant microorganism described in the fifth aspect of the present invention to obtain a mutant protein of Candida antarctica lipase B.

[0034] In some embodiments of the present invention, fermenting the recombinant microorganisms includes transferring the seed culture of the recombinant microorganisms to YPD fermentation medium, adding glycerol for induction after 48 hours, and culturing in a shaker at 25-32°C and 180-220 rpm; preferably, the OD 600 of the seed culture of the recombinant microorganisms is 2-5.

[0035] The seventh aspect of the present invention provides the application of mutant proteins as described in the first aspect of the present invention, or mutant proteins prepared by nucleotide molecules as described in the second aspect of the present invention, or expression cassettes as described in the third aspect of the present invention, or recombinant vectors as described in the fourth aspect of the present invention, or recombinant microorganisms as described in the fifth aspect of the present invention, or preparation methods as described in the sixth aspect of the present invention, in the field of biochemical engineering.

[0036] Preferably, the biochemical field includes the food, pharmaceutical, bioenergy, or chemical fields.

[0037] More preferably, the applications include the synthesis of DHA glycerides and the improvement of the catalytic efficiency of CALB.

[0038] This invention provides a mutant protein of Candida antarcticis lipase B. Specifically, based on the wild-type lipase gene sequence, this invention, through rational design and site-directed mutagenesis, ultimately obtained CALB mutants S195F, S195Y, A283Y, S195F-A283Y, and S195Y-A283Y with higher thermostability and higher enzyme activity. Compared with wild-type Candida antarcticis lipase B, the optimum temperature of S195F is increased by 8-10℃, and the optimum temperature of S195Y, A283Y, S195F-A283Y, and S195Y-A283Y is increased by 5℃; the Tm values ​​are increased by 5.7℃, 6.1℃, 6.2℃, 6.8℃, and 6.0℃, respectively; the specific enzyme activities of the five mutants are 1.7, 1.27, 1.23, 1.17, and 0.83 times that of the wild type, respectively; with the enzyme activity of unincubated enzyme solution as 100... After incubation at 70℃ for 60 min, the enzyme activity retention rates of the five mutants were 82%, 82%, 57%, 100%, and 96%, respectively, significantly higher than that of the wild-type enzyme. The catalytic efficiency of the S195F mutant was 4.5 times that of the wild-type, while the catalytic efficiencies of the S195Y and A283Y mutants were 3.8 and 2.3 times that of the wild-type, respectively. The catalytic efficiencies of the S195F-A283Y and S195Y-A283Y mutants were 3.9 and 3.15 times that of the wild-type, respectively. When this mutant protein was used to catalyze the synthesis of docosahexaenoic acid (DHA) glycerol, it exhibited higher catalytic efficiency, effectively increasing the yield of DHA glycerol. Therefore, compared with the wild-type lipase, the Candida antarcticis lipase B mutant provided by this invention has significantly improved heat resistance and optimal reaction temperature, exhibits good thermal stability and enzyme activity, and has enhanced catalytic activity, which is beneficial for industrial applications. Attached Figure Description

[0039] The present invention will now be described in further detail with reference to the accompanying drawings:

[0040] Figure 1 This is a schematic diagram of the reaction catalyzed by Candida antarcticis lipase B to synthesize DHA glycerides.

[0041] Figure 2 The above are electrophoresis images from Example 1 of this invention, where A is an electrophoresis image of the target gene and empty plasmid; and B is an electrophoresis image for colony PCR verification.

[0042] Figure 3 The recombinant plasmid pGAPZ(Mα)A is shown.

[0043] Figure 4 This is a crystal structure diagram of Candida antarctica lipase B (CALB).

[0044] Figure 5 The bar chart shows the Tm determination of the mutant and wild-type enzyme proteins provided in Example 7 of this invention.

[0045] Figure 6 The activity of the Antarctic Candida lipase B mutant and wild-type enzyme protein esterification enzyme is shown.

[0046] Figure 7 The enzyme proteolytic activity of the Antarctic Candida lipase B mutant and the wild-type enzyme is shown.

[0047] Figure 8 The curves show the optimal reaction temperature for the Antarctic Candida lipase B mutant and wild-type enzyme proteins. Detailed Implementation

[0048] To facilitate understanding of the present invention, it will be described in detail below with reference to the accompanying drawings. However, before describing the present invention in detail, it should be understood that the present invention is not limited to the specific embodiments described. It should also be understood that the terminology used herein is for describing specific embodiments only and is not intended to be restrictive.

[0049] Unless otherwise defined, all terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains. While any methods and materials similar to or equivalent to those described herein may also be used in the practice or testing of this invention, preferred methods and materials are now described.

[0050] I. Terminology

[0051] In this invention, DHA refers to docosahexaenoic acid.

[0052] In this invention, the term "nucleotide mutant" refers to the smallest unit in the nucleotide sequence of a gene that can undergo mutation.

[0053] Similarly, the term "amino acid mutant" as used in this invention refers to the smallest unit in the amino acid sequence of a protein that can be mutated.

[0054] The ">" symbol used in this invention represents a base mutation when indicating a nucleotide mutation.

[0055] In this invention, the label “c.” represents the nucleotide sequence of the protein-coding gene.

[0056] The label “p.” used in this invention represents the amino acid sequence of a protein when indicating a protein mutant.

[0057] The term "catalytic efficiency" as used in this invention refers to the specific activity of catalytic synthesis of DHA glycerides.

[0058] The term "enzyme activity" used in this invention refers to the ability of an enzyme to catalyze a certain chemical reaction. In this invention, enzyme activity is expressed as specific activity, which refers to the enzyme activity per gram of enzyme protein, with the unit being U / g.

[0059] In this invention, the term "original CALB gene" refers to the original CALB gene having the original amino acid sequence of the nucleotide sequence encoding the mutant protein of Candida antarctica lipase B in this invention, wherein "original" and "original" are relative to "mutation" provided in this invention.

[0060] In this invention, the term "target gene" refers to the CALB gene used to express Candida antarcticis lipase.

[0061] In this invention, the terms "protein" and "protein protein" can be used interchangeably.

[0062] The terms "mutant protein" and "mutant" used in this invention can be used interchangeably.

[0063] Appendix to this invention specification Figure 2 The term "bp" in this document represents a gene length unit; the term "Marker" represents a DNA molecular weight standard; the term "pGAPZ(Mα)A-1 / pGAPZ(Mα)A-2" represents a vector plasmid; the term "CALB-1 / CALB-2" represents a target gene; and the term "T1-T10" represents a colony name.

[0064] Appendix to this invention specification Figure 3 The terms “AOX1 promoter / GAP promoter / TEF1 promoter / EM7 promoter” refer to promoters; “Mα” refers to signal peptides; “CALB” refers to target genes; “BleoR” refers to resistance genes; “ori” refers to replication initiation sites; and “AOX1 terminator / CYC1 terminator” refers to terminators.

[0065] II. Implementation Plan

[0066] The existing Candida antarcticis lipase B (CALB) suffers from poor thermal stability, and its enzyme activity level is difficult to match the increasing industrial catalytic demands. Although researchers have conducted extensive studies on CALB modification, the existing CALB mutants obtained through directed mutation still suffer from poor thermal stability and enzyme activity levels that are difficult to match the increasing industrial catalytic demands. These dual bottlenecks restrict its application in high-temperature industrial scenarios, and these problems have become long-standing technical challenges that urgently need to be solved but have remained unresolved.

[0067] To solve this technical problem, the inventors conducted extensive research on CALB and obtained a CALB mutant protein with excellent thermal stability and high enzyme activity through rational design, site-directed mutagenesis and directed evolution.

[0068] Site-directed mutagenesis is a technique that precisely alters one or more bases in a known nucleotide sequence, thereby changing one or more amino acid residues that make up a protein, in order to study the relationship between protein structure and function. Site-directed mutagenesis plays a significant role in genetic engineering, achieving highly beneficial results in improving enzyme activity and enhancing the catalytic characteristics of enzymes.

[0069] Specifically, the inventors obtained a CALB mutant protein with good thermal stability and high enzyme activity through the following steps:

[0070] (1) The original CALB gene described in this invention was obtained from the literature (JU, TMH, SP, et al. The sequence, crystal structure determination and refinement of two crystal forms of lipase B from Candida antarctica. [J]. Structure (London, England: 1993), 1994, 2(4): 293-308.) (based on the literature, it was synthesized by BGI). The original CALB gene was obtained, and its nucleotide sequence is shown in SEQ ID NO. 5. The original CALB amino acid sequence encoded by the nucleotide sequence of the original CALB gene is shown in SEQ ID NO. 1 (PDB accession number: 1TCA).

[0071] (2) Based on the biological information provided in step (1), and combined with rational design and site-directed mutagenesis, a CALB mutant protein with good thermal stability and high enzyme activity is constructed.

[0072] For more detailed instructions, please refer to Examples 1-11 below. Examples 1-11 illustrate the preparation process of the preferred CALB mutant protein, with mutant No. 1 as an example. It can be seen that this invention, based on the original *Candida antarcticis* lipase B gene, successfully constructed a mutant with 5-7°C higher thermal stability and 1-2 times higher enzyme activity than the original *Candida antarcticis* lipase B (CALB) through rational design and site-directed mutagenesis. This CALB mutant can efficiently catalyze the synthesis of DHA glycerol esters, with catalytic efficiency 2-5 times higher than the original *Candida antarcticis* lipase B. A schematic diagram of the enzyme catalytic reaction is shown below. Figure 1 As shown.

[0073] Based on the above, the inventors discovered that the following amino acid mutants affect the enzyme activity of CALB, including mutations at positions 195 (p.S195F), 195 (p.S195Y), and 283 (p.A283Y) of the amino acid sequence shown in SEQ ID NO.1 of the original CALB, from the N-terminus to the C-terminus.

[0074] Therefore, the CALB mutant protein provided by the first aspect of the present invention contains amino acid mutants as described above. This can be understood as follows: when its sequence contains one or more of the mutations at positions 195 (S and F), 195 (S and Y), and 283 (A and Y) of the amino acid sequence of the original CALB as shown in SEQ ID NO.1 from the N-terminus to the C-terminus, the CALB enzyme activity will show a significant change.

[0075] Specifically, the following mutant proteins of CALB have significantly improved enzyme activity relative to the original CALB, including catalytic efficiency for DHA glycerides.

[0076] The mutant protein is CALB mutant protein No. 1, whose sequence contains a mutation at position 195, S and F, from the N-terminus to the C-terminus of the original CALB amino acid sequence as shown in SEQ ID NO. 1; the sequence of CALB mutant protein No. 1 is shown in SEQ NO. 2.

[0077] The mutant protein is CALB mutant protein No. 2, whose sequence contains a mutation of S and Y at position 195 from the N-terminus to the C-terminus of the original CALB amino acid sequence as shown in SEQ ID NO. 1; the sequence of CALB mutant protein No. 2 is shown in SEQ NO. 3.

[0078] The mutant protein is CALB mutant protein No. 3, whose sequence contains a mutation at position 283 (A and Y) from the N-terminus to the C-terminus of the original CALB amino acid sequence as shown in SEQ ID NO. 1; the sequence of the CALB mutant protein No. 3 is shown in SEQ NO. 4.

[0079] The mutant protein is CALB mutant protein No. 4, whose sequence contains mutations at positions 195 (S and F) and 283 (A and Y) from the N-terminus to the C-terminus of the original CALB as shown in SEQ ID NO. 1; the sequence of the CALB mutant protein No. 4 is shown in SEQ NO. 5.

[0080] The mutant protein is CALB mutant protein No. 5, whose sequence contains mutations at positions 195 (S and Y) and 283 (A and Y) from the N-terminus to the C-terminus of the original CALB as shown in SEQ ID NO. 1; the sequence of the CALB mutant protein No. 5 is shown in SEQ NO. 6.

[0081] The inventors further discovered that the following nucleotide mutants affect CALB enzyme activity, including one or more of the following mutations located in the nucleotide sequence of SEQ ID NO.7, which encodes the original CALB amino acid sequence as shown in SEQ ID NO.1: C to T at position 584 (c.584C>T), C to A at position 584 (c.584C>A), G to T at position 847 (c.847G>T), C to A at position 848 (c.848C>A), and A to C at position 849 (c.849A>C).

[0082] As mentioned above, the original CALB gene was synthesized by BGI Genomics based on the literature (JU, TMH, SP, et al. The sequence, crystal structure determination and refinement of two crystal forms of lipase B from Candida antarctica. [J]. Structure (London, England: 1993), 1994, 2(4): 293-308.). The amino acid sequence shown in SEQ ID NO.1 (PDB accession number: 1TCA) is the original CALB protein sequence, and the nucleotide sequence shown in SEQ ID NO.7 encoding the original CALB protein sequence shown in SEQ ID NO.1 (PDB accession number: 1TCA) is the nucleotide sequence of the original CALB gene.

[0083] Therefore, the nucleotide molecule encoding the mutant protein described in the first aspect of the present invention, provided in the second aspect of the present invention, contains nucleotide mutants as described in the third aspect of the present invention in its sequence. This can be understood as follows: when its sequence contains one or more of the following mutations located in the nucleotide sequence of the amino acid sequence shown in SEQ ID NO.1 encoding the original CALB, namely, mutations at positions 584 (C and T), 584 (C and A), 847 (G and T), 848 (C and A), and 849 (A and C) in the direction from the 5′ end to the 3′ end, the enzyme activity of CALB will show a significant change.

[0084] Specifically, the mutant protein of the first aspect of the present invention, encoded by the following nucleotide molecules, has significantly enhanced enzyme activity relative to the original CALB encoded by the nucleotide sequence of the original CALB gene, including catalytic efficiency for catalyzing DHA glycerides.

[0085] The nucleotide molecule is a nucleotide molecule encoding the CALB mutant protein number 1, and its sequence contains a C and T mutation at position 584 in the direction from the 5′ end to the 3′ end of the nucleotide sequence as shown in SEQ ID NO.1, which encodes the original CALB amino acid sequence; preferably, the nucleotide sequence of the nucleotide molecule encoding the CALB mutant protein is shown in SEQ ID NO.8.

[0086] The nucleotide molecule is a nucleotide molecule encoding the CALB mutant protein number 2, and its sequence contains a mutation at position 584, C and A, in the direction from the 5′ end to the 3′ end of the nucleotide sequence as shown in SEQ ID NO.1, which encodes the original CALB amino acid sequence; preferably, the nucleotide sequence of the nucleotide molecule encoding the CALB mutant protein is shown in SEQ ID NO.9.

[0087] The nucleotide molecule is a nucleotide molecule encoding the CALB mutant protein number 3, and its sequence contains mutations at positions 847 (G and T), 848 (C and A), and 849 (A and C) in the nucleotide sequence of SEQ ID NO. 5, which is located in the direction from the 5′ end to the 3′ end of the amino acid sequence of the original CALB as shown in SEQ ID NO. 1; preferably, the nucleotide sequence of the nucleotide molecule encoding the CALB mutant protein is shown in SEQ ID NO. 10.

[0088] The nucleotide molecule is a nucleotide molecule encoding the CALB mutant protein number 4, and its sequence contains mutations at positions 584 (C and T), 847 (G and T), 848 (C and A), and 849 (A and C) in the nucleotide sequence of SEQ ID NO. 7, which is located in the direction from the 5′ end to the 3′ end of the amino acid sequence of the original CALB as shown in SEQ ID NO. 11; preferably, the nucleotide sequence of the nucleotide molecule encoding the CALB mutant protein is shown in SEQ ID NO. 11.

[0089] The nucleotide molecule is a nucleotide molecule encoding the CALB mutant protein number 5, and its sequence contains mutations at positions 584 (C and A), 847 (G and T), 848 (C and A), and 849 (A and C) in the nucleotide sequence of SEQ ID NO. 7, which is located in the direction from the 5′ end to the 3′ end of the amino acid sequence of the original CALB as shown in SEQ ID NO. 1; preferably, the nucleotide sequence of the nucleotide molecule encoding the CALB mutant protein is shown in SEQ ID NO. 12.

[0090] According to the present invention, the nucleic acid molecule is a DNA molecule as follows:

[0091] (a1) A DNA molecule whose coding region includes the nucleotide sequences shown in SEQ ID NO.8, SEQ ID NO.9, SEQ ID NO.10, SEQ ID NO.11, and SEQ ID NO.12;

[0092] (a2) DNA molecules with nucleotide sequences as shown in SEQ ID NO.8, SEQ ID NO.9, SEQ ID NO.10, SEQ ID NO.11, and SEQ ID NO.12;

[0093] (a3) has 95% or more identity with the nucleotide sequence described in (a1) or (a2) and is a DNA molecule encoding the protein described in the second aspect of the present invention;

[0094] (a4) hybridizes under stringent conditions with the nucleotide sequence described in (a1) or (a2) and encodes a DNA molecule that encodes the protein described in the second aspect of the invention.

[0095] In the third to fifth aspects of the present invention, an expression cassette, recombinant vector, or recombinant microorganism for preparing the mutant protein of CALB described in the first aspect of the present invention is provided, comprising:

[0096] (1) An expression cassette containing the nucleotide molecules described in the second aspect of the present invention;

[0097] (2) The recombinant plasmid pGAPZ(Mα)A containing the nucleotides described in the second aspect of the present invention;

[0098] (3) Recombinant cells containing the nucleotide molecules or the above-mentioned recombinant plasmids described in the second aspect of the present invention, namely, Pichia pastoris containing the nucleotide molecules or the above-mentioned recombinant plasmids described in the second aspect of the present invention.

[0099] Therefore, it can be seen that the present invention has successfully constructed a recombinant Pichia pastoris strain containing the nucleotide molecules described in the second aspect of the present invention or the above-mentioned recombinant plasmids based on CALB obtained by modifying Candida antarcticis lipase B.

[0100] The cDNA of the nucleotide molecule described in the second aspect of the present invention can be used to construct a recombinant expression plasmid, which can be homologously recombined into a host cell to express mutant proteins and obtain the mutant protein of CALB described in the first aspect of the present invention.

[0101] The vector of the recombinant expression plasmid described in this invention is pGAPZ(Mα)A, which is based on pGAPZαA plasmid (BGI Genomics), obtained by replacing the α signal peptide with the Mα signal peptide, and is preserved in our laboratory.

[0102] The host cell described in this invention is Pichia pastoris X33 (purchased from the National Microbial Culture Resource Center).

[0103] Preferably, the nucleotide sequence of the nucleotide molecule encoding the recombinant plasmid pGAPZ(Mα)A-CALB is shown in SEQ ID NO. 41.

[0104] The CALB mutant protein provided by this invention is an exoprotein formed after its encoding gene (cDNA) is introduced into the host cell via homologous recombination. It needs to be obtained by centrifugation to separate the bacterial cells.

[0105] In a sixth aspect of the present invention, a method for preparing the mutant protein of CALB described above is provided, comprising fermenting and culturing the recombinant microorganism described in the fifth aspect of the present invention to obtain the mutant protein of Candida antarcticis lipase B.

[0106] The inventors have discovered that the method for preparing the above-mentioned CALB mutant protein involves transferring the seed culture of the above-mentioned recombinant Pichia pastoris strain with an OD 600 of 2-5 to YPD fermentation medium, adding 50% glycerol at a concentration of 35-45 g / L for induction, and culturing in a shaker at 25-32°C and 180-220 rpm. The resulting CALB mutant protein has high yield and enzyme activity.

[0107] The seventh aspect of the present invention provides the application of mutant proteins of CALB as described in the first aspect of the present invention, or mutant proteins of CALB prepared by nucleotide molecules as described in the second aspect of the present invention, or expression cassettes as described in the third aspect of the present invention, or recombinant vectors as described in the fourth aspect of the present invention, or recombinant microorganisms as described in the fifth aspect of the present invention, or preparation methods as described in the sixth aspect of the present invention, in the fields of food, pharmaceuticals, bioenergy, or chemicals.

[0108] It is well known in the art that DHA is abundant in nerve tissue and has a significant effect on neurons and retinal membrane tissue, but it is difficult to store. Only by esterifying it can it be stored as a commercial product for a long time.

[0109] Therefore, the application of the CALB mutant protein provided by this invention in the pharmaceutical field includes the synthesis of DHA glycerides and the improvement of the catalytic efficiency of CALB. This can be understood as a method for synthesizing DHA glycerides using the CALB mutant protein provided by this invention, that is, a method for synthesizing DHA glycerides by reacting a CALB mutant with the function of catalytic synthesis of DHA glycerides.

[0110] In some specific embodiments of the present invention, the applications include optimizing the thermal stability of CALB, improving CALB enzyme activity, and increasing the yield of DHA glycerides synthesized by catalysis.

[0111] Those skilled in the art should understand that the CALB mutant protein provided by this invention is not limited to applications in the pharmaceutical field, but can also be widely used in the food, bioenergy, or chemical fields, etc.; for example, the CALB mutant protein provided by this invention can be used in bioenergy, such as for the production of biodiesel.

[0112] This invention provides site-directed mutagenesis of Candida antarcticum lipase B, culture of mutant protein, and synthesis of DHA glycerol esters, belonging to the fields of biosynthesis, genetic engineering, rational design and directed evolution of enzymes. The technical solution of this invention mainly includes three parts: (1) Based on the amino acid sequence of the original Candida antarcticum lipase B, a Candida antarcticum lipase B mutant is obtained by site-directed mutagenesis along the 5′ to 3′ direction, and the mutant enzyme is transformed into Pichia pastoris for heterologous expression through homologous recombination; (2) A method for preparing the above-mentioned lipase mutant protein is provided, using glycerol as the microbial carbon source, and lipase mutants are cultured and expressed on YPD medium using glycerol induction; (3) Using Candida antarcticum lipase B and its mutant as catalysts, DHA glycerol esters are synthesized by enzymatic catalysis, and the reaction efficiency of DHA glycerol esters reaches 97%. This invention obtains Candida antarcticis lipase B with significantly improved enzyme activity and catalytic efficiency compared to wild-type enzymes through rational design, site-directed mutagenesis, and directed evolution. This solves the problem that the existing Candida antarcticis lipase B has poor thermal stability and its enzyme activity level is difficult to match the increasing industrial catalytic demand, which are the dual bottlenecks that restrict its application in high-temperature industrial scenarios.

[0113] The detection method and instruments in this invention:

[0114] (1) PCR amplification was performed using a T30D gradient PCR instrument (LongGene, China).

[0115] (2) PCR products were detected and separated using a MINI-SUB CELL GT POWER PAC 1000 agarose gel electrophoresis system (Bio-Rad, USA).

[0116] (3) The nucleic acid concentration was determined using an N60Touch ultraviolet spectrophotometer (Implen GmbH).

[0117] (4) The solubility and denaturation temperature (Tm) of the protein was accurately determined using a high-throughput protein stability analyzer NT.48 (NanoTemper, Germany).

[0118] (5) The concentration of purified protein was determined using an 870 microplate reader (Thermo Fisher Scientific).

[0119] Experimental materials and reagents in this invention:

[0120] Plasmids and strains: Primers and genes were synthesized by BGI Genomics Co., Ltd.; the expression host strain was Pichia pastoris X33 (purchased from the National Microbial Resource Center); the vector for the recombinant expression plasmid was pGAPZ(Mα)A, which was obtained by replacing the α signal peptide with the Mα signal peptide based on the pGAPZαA plasmid (BGI Genomics), and was constructed and preserved by our laboratory.

[0121] Main reagents: Yeast genome extraction kit (Bio-Tek); plasmid extraction kit (Omega); gel extraction kit (Omega); PCR product purification kit (OMEGA BIO-TEK); DNA marker / protein marker (Novizan); Coomassie Brilliant Blue (G250) (Solepro); T4 ligase / T4 ligase buffer / T4 PNK / DpnI / BstXI restriction enzyme (New England Biolabs); Gibsonase (TransGold); zeocin (Invitrogen). Other routine reagents were domestically produced analytical grade.

[0122] Main culture media: YPD medium (10 g / L yeast extract, 20 g / L tryptone, 20 g / L glucose); YPD solid medium (10 g / L yeast extract, 20 g / L tryptone, 20 g / L glucose, 20 g / L agar); LB medium (5 g / L yeast extract, 10 g / L tryptone, 5 g / L NaCl); LB solid medium (5 g / L yeast extract, 10 g / L tryptone, 5 g / L NaCl, 20 g / L agar).

[0123] III. Examples

[0124] The present invention will be specifically described below through specific embodiments. Unless otherwise specified, the experimental methods described below are standard laboratory methods. Unless otherwise specified, the experimental materials described below are commercially available.

[0125] Example 1: Construction of recombinant plasmids

[0126] The empty vector pGAPZ(Mα)A required for constructing the plasmid in this invention is based on the pGAPZαA plasmid (BGI Genomics), obtained by replacing the α signal peptide with the Mα signal peptide, and was constructed and preserved by our laboratory; the target gene CALB was synthesized by BGI Genomics.

[0127] Using the designed primer pair 1 and primer pair 2 (see Table 1), the target gene CALB (950 bp) and the empty plasmid pGAPZ(Mα)A (3900 bp) were amplified according to the PCR reaction system (see Table 2) and the PCR reaction procedure (see Table 3). The electrophoresis results of the PCR products were verified as follows. Figure 2Analysis A showed that the target gene and plasmid amplification product bands corresponded correctly. The above fragments were ligated using Gibbsson ligation to obtain the recombinant plasmid pGAPZ(Mα)A-CALB, which was then chemically transformed into *E. coli* Trans10. Recombinant strains were selected and colony PCR was performed using the colony PCR reaction system (see Table 4) for verification (see Table 5). The results are shown in Table 5. Figure 2 B, all conformed to the validation length (1000bp). Sequencing of the constructed plasmids and analysis showed that the target gene fragment and plasmid vector were successfully ligated (see...). Figure 3 ).

[0128] Table 1 Primer sequences

[0129]

[0130] Table 2 PCR amplification reaction system

[0131]

[0132] Table 3 PCR amplification reaction procedure

[0133]

[0134]

[0135] Table 4 Colony PCR Reaction System

[0136]

[0137] Table 5 Colony PCR reaction procedure

[0138]

[0139] Example 2: Prediction of mutation sites in lipase mutants

[0140] The crystal structure of CALB was obtained from the PDB database (see...). Figure 4 The CALB model structure was obtained by modeling with a modeller, and then computer-aided protein design was performed. The identified mutation sites are shown in Table 6.

[0141] Table 6 Rationally Designed Mutation Library

[0142]

[0143]

[0144] The primer pairs used for site-directed mutagenesis are shown in Table 7:

[0145] Table 7 Primer sequences

[0146]

[0147] Example 3: Construction of recombinant plasmid of lipase mutant

[0148] The experimental process and methods are explained in detail using mutant No. 1 as an example.

[0149] Primer pair 1: S195F-F: caggitttcaactcgccactcgactcatcc

[0150] S195F-R:ggcgagttgaacacctgaggctgaacgatctcg

[0151] Using the recombinant plasmid pGAPZ(Mα)A-CALB (nucleotide sequence shown in SEQ ID NO.13) obtained above as a template, circular PCR was performed at the corresponding sites of the constructed plasmid using the high-fidelity enzyme Primestar Max (see Tables 8 and 9); the PCR product was recovered by 5 μL Gipsyl enzyme + 5 μL, and self-ligation was performed using Gipsyl ligase (see Table 10). Subsequently, the ligation product was transformed into E. coli Trans10 competent cells by chemical transformation and plated on LB selection plates containing 1 / 1000 bleomycin. The transformants were picked, plasmids were extracted, and sequenced to identify the plasmid gene containing the mutant pGAPZ(Mα)A-S195F.

[0152] Table 8 PCR amplification reaction system

[0153]

[0154] Table 9 PCR Amplification Reaction Procedure

[0155]

[0156] Table 10 Gibson Connection Program

[0157]

[0158] The remaining primers synthesized based on the mutation sites are shown in Table 7. The recombinant plasmids containing the mutant gene obtained according to the above operations are pGAPZ(Mα)A-S10M, pGAPZ(Mα)A-V101I, pGAPZ(Mα)A-V154L, pGAPZ(Mα)A-S184T, pGAPZ(Mα)A-Q193L, pGAPZ(Mα)A-Q193P, pGAPZ(Mα)A-S195F, pGAPZ(Mα)A-S195Y, pGAPZ(Mα)A-N259M, pGAPZ(Mα)A-D265Y, pGAPZ(Mα)A-A283Y, pGAPZ(Mα)A-S195F-A283Y, and pGAPZ(Mα)A-S195Y-A283Y.

[0159] Example 4: Transformation and Validation of Recombinant Plasmids of Lipase Mutants

[0160] The recombinant plasmids were linearized using the restriction endonuclease BstXI. The linearized fragments were added to Pichia pastoris X33 competent cells, mixed thoroughly, and then transferred to pre-chilled electroporation cuvettes. Electroporation was performed using an Eppendorf electroporator. After electroporation, sterile, antibiotic-free YPD culture medium was added to the cuvettes, transferred to sterile centrifuge tubes, and incubated at 30°C and 200 rpm for 2-3 hours. The recovery solution was then plated onto YPD selection plates containing 0.5% bleomycin and incubated for 3-4 days.

[0161] Transformants were picked and inoculated into YPD medium and cultured overnight. The yeast cells were collected, and the genome was extracted using a yeast genome extraction kit. Using the genome as a template, PCR verification was performed using universal primers P-fw and P-rv. Positive clones yielded a 1000 bp band.

[0162] The universal primers are as follows:

[0163] P-fw:ccaccattgcctctattgccgctaagg;

[0164] P-rv:gcatctctcaggcaaatggcattctgac.

[0165] Example 5: Obtaining enzyme solution by shake-flask fermentation culture

[0166] Transformants of the validated positive clonal mutants were inoculated into 4 mL of YPD medium and cultured at 30°C until the OD600 reached 2–5. The culture was then transferred to a fungal baffle shake flask containing 100 mL of sterile, antibiotic-free fermentation medium for fermentation expression at 30°C and 200 rpm for 1–2 days. Subsequently, 4% of 50% glycerol was added for induction, and the culture was cultured at 30°C and 200 rpm for 2–3 days. After fermentation, the culture was centrifuged at 4°C and 4500 rpm for 15 min. The fermentation broth was collected by centrifugation, and the bacterial cells were discarded, while the supernatant enzyme solution was collected.

[0167] Example 6: Concentration and purification of fermentation broth

[0168] The fermentation broth was placed in a 10kD ultrafiltration vessel for ultrafiltration concentration to 1–1.5 g / L. The concentrated enzyme solution was then washed and purified with 0.1M PBS buffer (pH 8.0) until the wash solution was colorless.

[0169] The enzyme solution was reacted with G250 Coomassie Brilliant Blue, and the absorbance at 595 nm was measured using a Thermo Fisher Scientific 870 microplate reader. The protein concentration was calculated using the standard curve equation (see Table 11).

[0170] Table 11 Concentrations of proteases in each mutant

[0171] mutant Concentration (g / L) Original CALB 1.012 S10M 1.125 V101I 1.416 V154L 1.305 S184T 1.389 Q193L 1.234 Q193P 1.450 S195F 1.0304 S195Y 1.499 N259M 1.098 D265Y 1.472 A283Y 1.119 S195F+A283Y 1.216 S195Y+A283Y 1.093

[0172] Example 7: Determination of Tm value for enzymatic properties

[0173] To simplify the screening process, the thermostability of the concentrated and purified mutant enzyme protein from Example 5 was first determined. The Tm values ​​of the thirteen mutants and the wild type were measured using a high-throughput protein stability analyzer NT.48 based on the thermal denaturation monitoring of fluorescent dyes. The results are as follows: Figure 5 As shown. Compared with the wild type, the Tm values ​​of the six mutants S195F, S195Y, A283Y, Q193P, S195F+A283Y and S195Y+A283Y increased by 5.7℃, 6.1℃, 6.2℃, 10.8℃, 6.8℃ and 6.0℃, respectively. Effective single-point mutations were selected for enzymatic characterization studies.

[0174] Example 8: Assay of esterase activity

[0175] The mutants obtained from the above screening were cultured and expressed. The resulting enzyme solution was pretreated, and the fermentation broth was placed in a 10kD ultrafiltration vessel for ultrafiltration concentration to 0.6–0.65 g / L. Subsequently, the concentrated enzyme solution was washed and purified with 0.1M PBS buffer (pH 8.0) until the washing solution was colorless. The obtained enzyme solution was incubated at 40℃, 50℃, 60℃, 70℃, and 80℃ for 60 min, respectively.

[0176] Esterification reaction system: 20 g oleic acid, 3.3 mL methanol, and 2 mL 0.6–0.65 g / L enzyme solution were added to a 100 mL sealable reaction flask and reacted at 40 °C and 200 rpm for 24 h. 1–2 mL of the resulting reaction mixture was transferred to a centrifuge tube and centrifuged at 12000 rpm to separate the oil and water phases.

[0177] Phenolphthalein indicator titration: Weigh 0.12±0.01g of the upper oil phase into a 100mL conical flask, add 20-30mL of ethanol, and use 0.05mol / L NaOH as the standard solution. Calculate the acid value AV0 of the mixture at time zero and the acid value AV of the mixture at the end of the reaction using the phenolphthalein indicator titration method.

[0178] AV = (V × C × M) NaOH V: Volume of NaOH solution used in titration; C: Concentration of NaOH solution used in titration; M NaOH : Relative molecular mass of NaOH; m: Mass of the sample taken before titration.

[0179] Calculate the specific esterification rate as (1-AV / AV0) / c×100%, where c is the crude enzyme solution concentration; specific activity results are as follows: Figure 6 .

[0180] With significantly improved thermostability, the specific enzyme activities of mutants S195F, S195Y, A283Y, Q193P, S195F+A283Y, and S195Y+A283Y were 1.7, 1.27, 1.23, 0.51, 1.17, and 0.83 times that of the wild type, respectively. Furthermore, with unincubated enzyme solution activity as 100%, after incubation at 70℃ for 60 min, the enzyme activity retention rates of the six mutants were 82%, 82%, 57%, 59%, 100%, and 96%, respectively, significantly higher than the wild type enzyme activity retention rate of 44%. The enzyme activities of mutants Q193P, S195Y+A283Y, and the other mutants showed little improvement, and some even decreased.

[0181] Example 9: Hydrolytic enzyme activity assay

[0182] Enzyme pretreatment: The fermentation broth was concentrated by ultrafiltration in a 10kD ultrafiltration vessel to a concentration of 0.6–0.65 g / L. The concentrated enzyme solution was then washed and purified with 0.1M PBS buffer (pH 8.0) until the wash solution was colorless. The resulting enzyme solution was incubated at 40℃, 50℃, 60℃, 70℃, and 80℃ for 60 min, respectively.

[0183] Dissolve 20g of polyvinyl alcohol (PVA) in 800mL of deionized water, mix thoroughly, boil until clear and transparent, and dilute to 1L. Filter through gauze and cool to obtain a 2% PVA solution. Mix olive oil and PVA solution in a 1:3 volume ratio and vortex until homogeneous as the reaction substrate. Heat the enzyme solution at 40-80℃ for 60min. Three replicates were set up for both the reaction group and the control group. For the control group, 1mL of the heat-treated enzyme solution was added first, followed by 20mL of ethanol to terminate the activity. For the reaction group, 1mL of the heat-treated enzyme solution was added, and the reaction was incubated in a 40℃ water bath for 10min, followed by 20mL of ethanol to terminate the reaction. The phenolphthalein indicator titration was performed with 0.05mol / L NaOH solution until a faint pink endpoint was reached. The data were recorded, and the enzyme activity X of the supernatant was calculated.

[0184] X = (V1 - V2) × C × 50 × n / 0.05 / 10, where V1 and V2 are the amounts of sodium hydroxide standard solution consumed in the titration of the sample (blank / reaction shake flask); C: concentration of sodium hydroxide standard solution; and n is the dilution factor of the fermentation supernatant.

[0185] One unit of enzyme activity (U) is defined as the amount of titratable fatty acid produced by 1 mL of liquid enzyme hydrolyzing the substrate in 1 min at 40°C and pH 7.5. It is expressed as (U / mL).

[0186] The final results of the specific activity determination are as follows: Figure 7 The hydrolytic enzyme activities of the mutants S195F, S195Y, Q193P, A283Y, S195F+A283Y, and S195Y+A283Y were 0.74, 0.49, 0.43, 1.1, 0.86, and 0.75 times that of the wild type, respectively. Using unincubated enzyme solution as 100% enzyme activity, after incubation at 70℃ for 60 min, the enzyme activity retention rates of the six mutants were 83.33%, 82.05%, 70.00%, 104.76%, 89.00%, and 102.02%, respectively, significantly higher than the wild type's enzyme activity retention rate of 23.72%. Although the increase in enzyme activity of the mutants was not significant, and even decreased somewhat, their hydrolytic enzyme activity retention rates were significantly better than those of the wild type.

[0187] Example 10: Optimal Reaction Temperature Analysis

[0188] Based on the results of Examples 9 and 10, the enzyme activities of the mutants S195F, S195Y, A283Y, S195F+A283Y, and S195Y+A283Y were measured at 35, 40, 45, 50, 55, 60, 65, 70, 75, and 80°C, respectively. The highest enzyme activity was taken as 100%, and the relative enzyme activity was calculated. The results are as follows: Figure 8 As shown. Compared with the wild type, the optimum temperature of S195F increased by 8-12℃, and the optimum temperature of S195Y, A283Y, S195F+A283Y and S195Y+A283Y all increased by 5℃.

[0189] Example 11: Synthesis of DHA glycerides

[0190] Catalytic efficiency analysis: The catalytic efficiency of wild-type and mutant enzyme proteins in the synthesis of DHA glycerol esters was determined. The catalytic efficiency of S195F was 4.5 times that of the wild type, while the catalytic efficiencies of S195Y and A283Y were 3.8 and 2.3 times that of the wild type, respectively. The catalytic efficiencies of the S195F-A283Y and S195Y-A283Y mutants were 3.9 and 3.15 times that of the wild type, respectively. The catalytic efficiencies of S195F, S195Y, A283Y, S195F-A283Y, and S195Y-A283Y mutant proteins were all superior to those of the wild type.

[0191] It should be noted that the embodiments described above are only for explaining the present invention and do not constitute any limitation on the present invention. The present invention has been described with reference to typical embodiments, but it should be understood that the words used therein are descriptive and explanatory terms, not limiting terms. Modifications can be made to the present invention within the scope of the claims, and revisions can be made to the present invention without departing from the scope and spirit of the present invention. Although the present invention described herein relates to specific methods, materials, and embodiments, it does not mean that the present invention is limited to the specific examples disclosed herein; on the contrary, the present invention can be extended to all other methods and applications with the same function.

Claims

1. A mutant protein of Candida antarcticis lipase B, the sequence of which includes one or more mutations at positions 195 (S and F), 195 (S and Y), and 283 (A and Y) of the amino acid sequence shown in SEQ ID NO.1 of the original CALB.

2. The mutant protein of Candida antarcticis lipase B according to claim 1, characterized in that, The mutant protein is CALB mutant protein No. 1, whose sequence contains a mutation of S and F at position 195 from the N-terminus to the C-terminus of the original CALB amino acid sequence as shown in SEQ ID NO. 1; preferably, the sequence of the CALB mutant protein No. 1 is shown in SEQ ID NO.

2. And / or, the mutant protein is CALB mutant protein No. 2, the sequence of which contains a mutation of S and Y at position 195 from the N-terminus to the C-terminus of the original CALB amino acid sequence as shown in SEQ ID NO. 1; preferably, the sequence of the CALB mutant protein No. 2 is shown in SEQ ID NO. 3; And / or, the mutant protein is a CALB mutant protein No. 3, the sequence of which contains a mutation of A and Y at position 283 from the N-terminus to the C-terminus of the original CALB amino acid sequence as shown in SEQ ID NO. 1; preferably, the sequence of the CALB mutant protein No. 3 is shown in SEQ ID NO. 4; And / or, the mutant protein is CALB mutant protein No. 4, the sequence of which contains mutations at positions 195 (S and F) and 283 (A and Y) of the amino acid sequence of the original CALB as shown in SEQ ID NO. 1 from the N-terminus to the C-terminus; preferably, the sequence of the CALB mutant protein No. 4 is shown in SEQ ID NO. 5; And / or, the mutant protein is a CALB mutant protein No. 5, the sequence of which contains a mutation at position 195 (S and Y) and position 283 (A and Y) of the amino acid sequence of the original CALB as shown in SEQ ID NO. 1 from the N-terminus to the C-terminus; preferably, the sequence of the CALB mutant protein No. 5 is shown in SEQ ID NO.

6.

3. A nucleotide molecule encoding the mutant protein of claim 1 or 2, wherein the sequence comprises one or more of the following mutations located in the nucleotide sequence of SEQ ID NO. 7, which encodes the amino acid sequence of the original CALB, from the 5′ end to the 3′ end: C to T at position 584, C to A at position 584, G to T at position 847, C to A at position 848, and A to C at position 849.

4. The nucleotide molecule according to claim 3, characterized in that, The nucleotide molecule is a nucleotide molecule encoding the CALB mutant protein number 1, and its sequence contains a C and T mutation at position 584 in the direction from the 5′ end to the 3′ end of the nucleotide sequence as shown in SEQ ID NO.1, which encodes the original CALB amino acid sequence; preferably, the nucleotide sequence of the nucleotide molecule encoding the CALB mutant protein is shown in SEQ ID NO.

8. And / or, the nucleotide molecule is a nucleotide molecule encoding the CALB mutant protein number 2, the sequence of which contains a mutation at position 584 C and A in the direction from the 5′ end to the 3′ end of the nucleotide sequence of the nucleotide sequence of the original CALB as shown in SEQ ID NO.1; preferably, the nucleotide sequence of the nucleotide molecule encoding the CALB mutant protein is shown in SEQ ID NO.9; And / or, the nucleotide molecule is a nucleotide molecule encoding the CALB mutant protein number 3, the sequence of which contains mutations at positions 847 (G and T), 848 (C and A), and 849 (A and C) in the nucleotide sequence of ... And / or, the nucleotide molecule is a nucleotide molecule encoding the CALB mutant protein number 4, the sequence of which contains mutations at positions 584 (C and T), 847 (G and T), 848 (C and A), and 849 (A and C) in the nucleotide sequence of ... And / or, the nucleotide molecule is a nucleotide molecule encoding the CALB mutant protein number 5, the sequence of which contains mutations at positions 584 (C and A), 847 (G and T), 848 (C and A), and 849 (A and C) in the nucleotide sequence of ...

5. The nucleotide molecule according to claim 4, characterized in that, The nucleotide molecule is a DNA molecule as follows: (a1) A DNA molecule whose coding region includes the nucleotide sequences shown in SEQ ID NO.8, SEQ ID NO.9, SEQ ID NO.10, SEQ ID NO.11, and SEQ ID NO.12; (a2) DNA molecules with nucleotide sequences as shown in SEQ ID NO.8, SEQ ID NO.9, SEQ ID NO.10, SEQ ID NO.11, and SEQ ID NO.12; (a3) has 95% or more identity with the nucleotide sequence described in (a1) or (a2) and is a DNA molecule encoding the protein described in claim 3; (a4) hybridizes under stringent conditions with the nucleotide sequence described in (a1) or (a2) and encodes a DNA molecule of the protein described in claim 3.

6. An expression cassette comprising a nucleotide molecule as described in any one of claims 3-5.

7. A recombinant vector containing a nucleotide molecule as described in any one of claims 3-5; preferably, the recombinant vector is pGAPZ(Mα)A.

8. A recombinant microorganism containing the nucleotide molecule according to any one of claims 3-5; preferably, the host cell of the recombinant microorganism is Pichia pastoris.

9. A method for preparing the mutant protein as described in claim 1 or 2, comprising fermenting and culturing the recombinant microorganism as described in claim 8 to obtain the mutant protein of Candida antarctica lipase B; Preferably, the fermentation culture of the recombinant microorganism includes transferring the seed culture of the recombinant microorganism to YPD fermentation medium, adding glycerol for induction after 48 h, and culturing in a shaker at 25-32°C and 180-220 rpm; more preferably, the OD 600 of the seed culture of the recombinant microorganism is 2-5.

10. The application of the mutant protein as described in claim 1 or 2, or the nucleotide molecule as described in any one of claims 3-5, or the expression cassette as described in claim 6, or the recombinant vector as described in claim 7, or the recombinant microorganism as described in claim 8, or the mutant protein prepared by the preparation method as described in claim 9, in the field of biochemical engineering; preferably, the biochemical engineering field includes the fields of food, pharmaceuticals, bioenergy, or chemicals; more preferably, the application includes the synthesis of DHA glycerides and the improvement of the catalytic efficiency of CALB.

Images