Application of compound in treatment of liver diseases

Abstract

The invention discloses application of a compound in treatment of liver diseases. Experimental results show that the compound has relatively high liver tissue targeting property, very low toxicity to liver primary cells, high liver safety and obvious curative effects on liver diseases such as viral hepatitis (such as hepatitis B), liver cancer (including primary liver cancer and metastatic liver cancer) and the like; in addition, the compound also has better physicochemical properties, metabolic stability, bioavailability and safety, and has a very good drug development prospect.

Description

Technical Field

[0001] The present invention relates to the technical field of chemical medicine, and in particular to application of a compound in treating liver disease. Background Art

[0002] The liver is an organ in the body that mainly performs metabolic functions. It plays a role in deoxidation, storage of glycogen, and synthesis of secretory proteins. The liver also produces bile in the digestive system. The liver is the largest organ in the human body. It is located in the abdomen of the human body, below the right diaphragm, in front of the gallbladder and in front of the right kidney, and above the stomach. The liver is the largest digestive gland in the human digestive system. The average adult liver weighs 1.5 kilograms and is a reddish-brown V-shaped organ. The liver is the main organ for urea synthesis and an important organ for metabolism.

[0003] Liver disease is a disease with high morbidity and mortality. Liver diseases can be divided into viral and non-viral. Hepatitis virus is the main pathogen that causes liver disease. Currently discovered hepatitis viruses include hepatitis A, hepatitis B, hepatitis C, hepatitis D and hepatitis E. Non-viral liver disease is liver damage caused by drugs, narcotics, alcohol, etc. The development process of liver disease generally includes stages such as acute hepatitis, chronic hepatitis, liver fibrosis, cirrhosis (ascites), and liver cancer. In addition, the anatomical characteristics of the liver are dual blood supply from the hepatic artery and portal vein, so malignant tumors are prone to liver metastasis. The primary lesions of liver metastatic cancer can come from multiple organs throughout the body, mainly from digestive tract tumors, accounting for about 35%-50% of liver metastatic cancer.

[0004] At present, there are few approved therapeutic drugs for advanced hepatocellular carcinoma, mainly kinase inhibitor sorafenib and immune checkpoint blocker PD-1 / PD-L1 monoclonal antibody. Sorafenib is a first-line liver cancer treatment drug, but it is reported that its clinical effect is limited and it is easy to cause adverse reactions. According to the results of the Phase III clinical trial of sorafenib (SHARP trial), the median survival of sorafenib in patients with advanced unresectable HCC (N=602) was 10.7 months, while that of the placebo group was 7.9 months, and the effect of extending survival was not obvious. The progression-free survival of sorafenib was 167 days, while that of the placebo group was 84 days. According to the CheckMate 459 clinical trial, a Phase III clinical trial comparing Nivolumab and Sorafenib for the first-line treatment of advanced hepatocellular carcinoma (aHCC), the dosing regimen was Nivolumab 240 mg (intravenous drip, once every 2 weeks); Sorafenib 400 mg (oral, 2 times / d). The results were announced at the 2019 European Society for Medical Oncology (ESMO) Annual Meeting: the mOS of the Nivolumab group (371 cases) and the Sorafenib group (372 cases) were 16.4 and 14.7 months, respectively (HR = 0.85, 95% CI: 0.72-1.02, P = 0.0752), which did not reach the predetermined threshold of statistical significance, and the ORRs of the two groups were 15% and 7%, respectively. This Phase III clinical trial did not achieve the expected primary study endpoint (OS), but the efficacy of Nivolumab was indeed improved compared with Sorafenib. Currently, multiple immune checkpoint blocking antibodies have been approved for the treatment of liver cancer, but in order to prolong the survival period and biochemical quality of patients with liver cancer, it is urgent to develop new targeted immunotherapy drugs for the prevention and treatment of liver diseases. Summary of the invention

[0005] In order to overcome the deficiencies of the prior art, the present invention provides an application of a small molecule compound with immunomodulatory function in preventing and / or treating liver diseases.

[0006] In a first aspect of the present invention, there is provided a use of a compound or a pharmaceutically acceptable salt thereof in the preparation of a medicament for preventing and / or treating liver disease, wherein the compound has the following structure:

[0007]

[0008] Specifically, the liver disease is a disease occurring in the liver, such as infectious diseases, tumor diseases, vascular diseases, metabolic diseases, toxic diseases, autoimmune diseases, hereditary diseases, intrahepatic bile duct stones, etc.

[0009] In one embodiment of the present invention, the liver disease is hepatitis, such as viral hepatitis, alcoholic hepatitis, fatty hepatitis, drug-induced hepatitis, autoimmune hepatitis, etc., in particular viral hepatitis.

[0010] Specifically, viral hepatitis includes: hepatitis A, hepatitis B, hepatitis C, hepatitis D, hepatitis E, hepatitis G, especially hepatitis B.

[0011] In one embodiment of the present invention, the liver disease is a liver tumor, such as hepatic hemangioma, hepatic adenoma, hepatic lipoma, non-parasitic liver cyst, focal nodular hyperplasia of the liver, liver cancer, cholangiocarcinoma, hepatoblastoma, liver sarcoma, etc., in particular liver cancer.

[0012] Specifically, the liver cancer is primary liver cancer or metastatic liver cancer.

[0013] Specifically, the primary tumor of metastatic liver cancer can be colorectal cancer, colon cancer, gastric cancer, pancreatic cancer, stomach, intestinal leiomyosarcoma, lung cancer, breast cancer, kidney cancer, cervical cancer, ovarian cancer, prostate cancer and head and neck tumors; in one embodiment of the present invention, the metastatic liver cancer is colon cancer metastatic liver cancer.

[0014] In one embodiment of the present invention, the liver disease is liver damage, such as liver fibrosis and liver cirrhosis.

[0015] In one embodiment of the present invention, the liver disease is fatty liver.

[0016] In one embodiment of the present invention, the liver disease is hepatolithiasis.

[0017] Specifically, in the application, the compound or its pharmaceutically acceptable salt can be used alone or in combination with other types of active ingredients (second active ingredients) (the compound or its pharmaceutically acceptable salt and the second active ingredient can be in the same dosage form or in different dosage forms, and the two can be administered simultaneously, separately or sequentially).

[0018] Specifically, for the embodiment in which the liver disease is a liver tumor, the second active ingredient can be one or more of a radiotherapy agent, a chemotherapeutic agent, an immunotherapy agent, an anti-angiogenic agent, a cytokine, a hormone, a polynucleotide, an antibody, an immunologically active fragment, an immune checkpoint blocker, a cell therapy drug, a small nucleic acid drug, an mRNA vaccine, a tumor vaccine, and the like.

[0019] Specifically, the immune checkpoint can be, for example, PD-1, PD-L1, CTLA-4, BTLA, TIM-3, LAG-3, TIGIT, LAIR1, 2B4, CD160, etc., especially PD-1 and PD-L1.

[0020] Specifically, the immune checkpoint inhibitor can be an antibody, a small molecule compound or a combination thereof.

[0021] In one embodiment of the present invention, the second active ingredient is a PD-1 antibody, such as pembrolizumab, nivolumab, cemiplimab, Nofazinlimab (CS1003), Tislelizumab, toripalimab, Sintilimab, Camrelizumab, Penpulimab, Zimberelimab, and serplulimab.

[0022] In one embodiment of the present invention, the second active ingredient is a PD-L1 antibody, such as atezolizumab, duvalumab, durvaluamb, sugemalimab, and envofilimab.

[0023] Other PD-1 / PD-L1 monoclonal antibodies under development include, for example, Penpulimab (Kangfang Biopharma), HLX-10 (Fuhong Hanlin), Cemiplimab (Sanofi), SCT-I10A (Sinocell), AMG404 (Amgen), TY101 (Dayou Biopharma), Sasanlimab (Pfizer), Genolimzumab (Jiahe Biopharma), LZM009 (Livzon), HX008 (Lepu Medical), LVHN6051 (Lijin Biopharma), F520 (Lunan Pharmaceutical), Spartalizumab (Novartis), QL1604 (Qilu Pharmaceutical), 609A (Sunshine Guojian), SG001 (Shangjian Biopharma), STW204mAb (Sitanwei), Zimberelimab (WuXi Biologics), Retifanlimab (Zai Lab), etc.

[0024] In one embodiment of the present invention, the second active ingredient is a CTLA-4 antibody, such as Tremelimumab and ipilimumab.

[0025] Specifically, the chemotherapeutic agents include, but are not limited to, chlorambucil, melphalan, cyclophosphamide, ifosfamide, busulfan, carmustine, lomustine, streptozotocin, cisplatin, carboplatin, oxaliplatin, dacarbazine, temozolomide, procarbazine, methotrexate, fluorouracil, cytarabine, gemcitabine, capecitabine, mercaptopurine, fludarabine, vinblastine, vincristine, vinorelbine, paclitaxel, docetaxel, topotecan, irinotecan, etoposide, trabectedin, dactinomycin, doxorubicin, epirubicin, daunomycin, mitoxantrone, and blene afatinib, alisertib, amuvatinib, apatinib, axitinib, bortezomib, bosutinib, brivanib, cabozantinib, cediranib, crenolanib, crizotinib, dabrafenib, dacomitinib ib, danusertib, dasatinib, dovitinib, erlotinib, foretinib, ganetespib, gefitinib, ibrutinib, icotinib, imatinib, iniparib, lapatinib, lenvatinib, linifanib, linsitinib, masitinib, momelotinib, motesanib, neratinib, nilotinib, niraparib, oprozomib, olaparib, pazopanib, pictilisib, ponatinib, quizartinib, regorafenib, rigosertib, rucaparib, ruxolitinib, saracatinib, saridegib, sorafenib, sunitinib, tasocitinib, telatinib, tivantinib, tivozanib, tofacitinib, trametinib, vandetanib, veliparib, or a combination thereof.

[0026] In one embodiment of the invention, the chemotherapeutic agent is a multi-target receptor tyrosine kinase (RTK) inhibitor, such as imatinib, sorafenib, sunitinib, dasatinib, lapatinib, pazotinib, crizotinib, vandetinib, regorafenib, cabozantinib, axitinib, ponatinib, radotinib, afatinib, nintedanib, lenvatinib, neratinib, lenvatinib, in particular sorafenib and lenvatinib.

[0027] More specifically, the chemotherapeutic agent is selected from the group consisting of fluorouracil, doxorubicin, cisplatin, mitomycin, gemcitabine, capecitabine, irinotecan, sorafenib, sunitinib, erlotinib, lenvatinib, in particular sorafenib and lenvatinib.

[0028] Specifically, the antibodies include, but are not limited to: PRO542, which is an anti-HIV gp120 antibody fused to CD4 (Progenics / Genzyme Transgenics); MDX-010 (Medarex, New Jersey), which is a humanized anti-CTLA-4 antibody; SYNAGIS (MedImmune, Maryland), which is a humanized anti-respiratory syncytial virus (RSV) monoclonal antibody; HERCEPTIN (trastuzumab) (Genentech, California), which is a humanized anti-HER2 monoclonal antibody; Humanized anti-CD18 F(ab')2 (Genentech); CDP860, which is a humanized anti-CD18 F(ab')2 (Celltech, UK); Ostavir, which is a human anti-hepatitis B virus antibody (Protein Design Lab / Novartis); PROTOVIRTM, which is a humanized anti-CMV IgG1 antibody (Protein Design Lab / Novartis); MAK-195 (SEGARD), which is a murine anti-TNF-α F(ab')2 (Knoll Pharmaceuticals / BASF); llPharma / BASF); IC14, which is an anti-CD14 antibody (ICOS Pharmaceuticals (ICOS Pharm)); humanized anti-VEGF IgG1 antibody (Genentech); OVAREXM, which is a mouse anti-CA125 antibody (Altarex); PANOREXM, which is a mouse anti-17-IA cell surface antigen IgG2a antibody (GlaxoWellcome / Centocor); BEC2, which is a mouse anti-idiotype (GD3 epitope) IgG antibody (ImClone System); IMC-C2 25, which is a chimeric anti-EGFR IgG antibody (Immunoclonal Systems); VITAXIN™, which is a humanized anti-αVβ3 integrin antibody (Applied Molecular Evolution / MedImmune); Campath 1H / LDP-03, which is a humanized anti-CD52 IgG1 antibody (Leukosite); SmartM195, which is a humanized anti-CD33 IgG antibody (Protein Design Lab / Kanebo);RITUXAN™ (rituximab™), a chimeric anti-CD20 IgG1 antibody (IDEC Pharmaceuticals / Genentech, Roche / Zettyaku); LYMPHOCIDE™, a humanized anti-CD22 IgG antibody (Immunomedics); SmartID10, a humanized anti-HLA antibody (Protein Design Laboratories); ONCOLYM™ (Lym-1), a radiolabeled mouse anti-HLADR antibody (Techniclone); ABX-IL8, a human anti-IL8 antibody (Abgeni x)); anti-CD11a, a humanized IgG1 antibody (Genentech / Xoma); ICM3, a humanized anti-ICAM3 antibody (ICOS Pharmaceuticals); IDEC-114, a primatized anti-CD80 antibody (IDEC Pharmaceuticals / Mitsubishi); ZEVALIN™, a radiolabeled murine anti-CD20 antibody (IDEC / Schering AG); IDEC-131, a humanized anti-CD40L antibody (IDEC / Eisai); IDEC-151, a primatized anti-CD4 antibody (IDEC); IDEC-152, a primatized anti-CD4 antibody (IDEC); SMART anti-CD3, a humanized anti-CD3 IgG (Protein Design Laboratories); 5G1.1, a humanized anti-complement factor 5 (C5) antibody (Alexion Pharm); D2E7, a humanized anti-TNF-α antibody (CAT / BASF); CDP870, a humanized anti-TNF-α Fab fragment (Celtec); IDEC-151, a primatized anti-CD4 IgG1 antibody (IDEC Pharmaceuticals / SmithKline Beecham); MDX-CD4, a humanized anti- CD4 IgG antibody (Medarex / Eisai / Genmab); CDP571, a humanized anti-TNF-α IgG4 antibody (Celtech); LDP-02, a humanized anti-α4β7 antibody (Luxeter / Genentech); OrthoCloneOKT4A, a humanized anti-CD4 IgG antibody (OrthoBiotech); ANTOVATM, a humanized anti-CD40L IgG antibody (Biogen); ANTEGRENTM, a humanized anti-VLA-4 IgG antibody (Elan);MDX-33, a human anti-CD64 (FcγR) antibody (Medlex / Centeon); SCH55700, a humanized anti-IL-5 IgG4 antibody (Celtec / Schering); SB-240563 and SB-240683, humanized anti-IL-5 and anti-IL-4 antibodies, respectively (SmithKline Beecham); rhuMab-E25, a humanized anti-IgE IgG1 antibody (Genentech / Norvartis / Tanox Biosystems); ABX-CBL, a mouse anti-CD-147 IgM antibody (Abgenix); BTI-322, a rat anti-CD2 IgG antibody (Medlex / BioTransplant); Odoclone / OKT3 (Ortho clone / OKT3), a mouse anti-CD3 IgG2a antibody (OrthoBiotech); SIMULECTTM, a chimeric anti-CD25 IgG1 antibody (Novartis); LDP-01, a humanized anti-β2-integrin IgG antibody (Luxet); anti-LFA-1, a mouse anti-CD18 F(ab′)2 (Pasteur-Merieux / Immunotech); CAT-152, a human anti-TGF-β2 antibody (Cambridge AbTech); CorsevinM, a chimeric anti-factor VII antibody (Santok); MDX-1106, a PD-1 antibody (Bristol-Myers Squibb); MDX-1105, a PD-L1 antibody (Roche). ;

[0029] Specifically, the drug also contains one or more pharmaceutically acceptable excipients, such as one or more of disintegrants, binders, lubricants, suspending agents, stabilizers, fillers, absorption promoters, surfactants, flavoring agents, antioxidants, preservatives, isotonic sterile saline solutions (sodium dihydrogen phosphate, disodium hydrogen phosphate, sodium chloride, potassium chloride, calcium chloride, magnesium chloride, etc., or mixtures of the above salts), etc.

[0030] In one embodiment of the present invention, the medicament further comprises one or more pharmaceutically acceptable oral dosage form excipients.

[0031] Specifically, the drug can be administered by any suitable route, such as enteral administration or parenteral administration (eg, intravenous, intramuscular, subcutaneous, intraorgan, intranasal, intradermal, instillation, intracerebral, rectal, etc.).

[0032] Specifically, the drug can be in any suitable dosage form, such as a dosage form for gastrointestinal administration, such as, but not limited to, tablets, pills, powders, granules, capsules, lozenges, syrups, liquids, emulsions, suspensions, etc.; a dosage form for parenteral administration, such as an injectable dosage form: such as an injection (for example, for subcutaneous injection, intravenous injection, intramuscular injection, intraperitoneal injection), a dosage form for respiratory administration: such as a spray, an aerosol, a powder aerosol, etc., a dosage form for skin administration, such as an external solution, a lotion, an ointment, a plaster, a paste, a patch, etc., a dosage form for mucosal administration: such as eye drops, eye ointments, nasal drops, gargles, sublingual tablets, etc., a dosage form for cavity administration: such as suppositories, aerosols, effervescent tablets, drops, pills, etc., for use in the rectum, vagina, urethra, nasal cavity, ear canal, etc.

[0033] In one embodiment of the present invention, the medicament is in oral dosage form.

[0034] In one embodiment of the present invention, the compound or a pharmaceutically acceptable salt thereof is contained in an oral dosage form.

[0035] In one embodiment of the present invention, the medicament further comprises a second active ingredient, wherein the compound is contained in an oral dosage form and the second active ingredient is contained in an injectable dosage form.

[0036] In a second aspect of the present invention, a pharmaceutical composition is provided, comprising a compound or a pharmaceutically acceptable salt thereof and a second active ingredient (as described in the first aspect of the present invention), and, optionally, one or more pharmaceutically acceptable excipients, wherein the compound has the following structure:

[0037]

[0038] In one embodiment of the present invention, the second active ingredient is an immune checkpoint inhibitor, such as a PD-1 antibody, for example, pembrolizumab, nivolumab, cemiplimab, Nofazinlimab (CS1003), Tislelizumab, toripalimab, Sintilimab, Camrelizumab, Penpulimab, Zimberelimab, serplulimab; a PD-L1 antibody, for example, atezolizumab, duvalumab, Durvaluamb, Sugemalimab, Envaf olimab); CTLA-4 antibodies, such as tremelimumab and ipilimumab; other PD-1 / PD-L1 monoclonal antibodies under development, such as penpulimab (Kangfang Biopharma), HLX-10 (Fuhong Hanlin), cemiplimab (Sanofi), SCT-I10A (Sinocell), AMG404 (Amgen), TY101 (Dayou Biopharma), and sasanlimab (Pfizer) , Genolizumab (Jiahe Biopharma), LZM009 (Livzon), HX008 (Lepu Medical), LVHN6051 (Lijin Biopharma), F520 (Lunan Pharmaceutical), Spartalizumab (Novartis), QL1604 (Qilu Pharmaceutical), 609A (Sunshine Guojian), SG001 (Shangjian Biopharma), STW204mAb (Sitanwei), Zimberelimab (WuXi Biologics), Retifanlimab (Zai Lab), etc.

[0039] In one embodiment of the present invention, the pharmaceutical composition comprises the compound (especially Compound II) or a pharmaceutically acceptable salt thereof and a PD-1 antibody, and, optionally, one or more pharmaceutically acceptable excipients; specifically, the pharmaceutical composition comprises an oral dosage form and an injection dosage form.

[0040] In one embodiment of the present invention, the pharmaceutical composition comprises Compound I or a pharmaceutically acceptable salt thereof and Nofazinlimab (CS1003) and, optionally, one or more pharmaceutically acceptable excipients; specifically, the pharmaceutical composition comprises an oral dosage form and an injection dosage form.

[0041] In one embodiment of the present invention, the pharmaceutical composition comprises Compound II or a pharmaceutically acceptable salt thereof and Nofazinlimab (CS1003) and, optionally, one or more pharmaceutically acceptable excipients; specifically, the pharmaceutical composition comprises an oral dosage form and an injection dosage form.

[0042] In one embodiment of the invention, the second active ingredient is a chemotherapeutic agent, as described in the first aspect of the invention, such as fluorouracil, doxorubicin, cisplatin, mitomycin, gemcitabine, capecitabine, irinotecan, sorafenib, sunitinib, lenvatinib, erlotinib, in particular sorafenib and lenvatinib.

[0043] In one embodiment of the present invention, the pharmaceutical composition comprises the compound (especially compound II) or a pharmaceutically acceptable salt thereof and sorafenib, and, optionally, one or more pharmaceutically acceptable excipients; specifically, the pharmaceutical composition is an oral dosage form.

[0044] In a third aspect of the present invention, there is provided a use of a combination of a compound or a pharmaceutically acceptable salt thereof and a second active ingredient in the preparation of a medicament for preventing and / or treating liver disease.

[0045] Specifically, the compound and the second active ingredient are as described in the first aspect of the present invention.

[0046] Specifically, the liver disease is as described in the first aspect of the present invention. In one embodiment of the present invention, the liver disease is a liver tumor, such as hepatic hemangioma, hepatic adenoma, hepatic lipoma, liver non-parasitic cyst, liver focal nodular hyperplasia, liver cancer, cholangiocarcinoma, hepatoblastoma, liver sarcoma, etc., especially liver cancer, which can be primary liver cancer or metastatic liver cancer. Specifically, the primary tumor of metastatic liver cancer can be colorectal cancer, colon cancer, gastric cancer, pancreatic cancer, stomach, intestinal leiomyosarcoma, lung cancer, breast cancer, kidney cancer, cervical cancer, ovarian cancer, prostate cancer and head and neck tumors; in one embodiment of the present invention, the metastatic liver cancer is colon cancer metastatic liver cancer.

[0047] In one embodiment of the present invention, the combination is a combination of the compound (particularly Compound II) or a pharmaceutically acceptable salt thereof and a PD-1 antibody.

[0048] In one embodiment of the present invention, the combination is a combination of Compound I or a pharmaceutically acceptable salt thereof and Nofazinlimab (CS1003).

[0049] In one embodiment of the present invention, the combination is a combination of Compound II or a pharmaceutically acceptable salt thereof and Nofazinlimab (CS1003).

[0050] In one embodiment of the invention, the second active ingredient is a chemotherapeutic agent, as described in the first aspect of the invention, such as fluorouracil, doxorubicin, cisplatin, mitomycin, gemcitabine, capecitabine, irinotecan, sorafenib, sunitinib, lenvatinib, erlotinib, in particular sorafenib and lenvatinib.

[0051] In one embodiment of the present invention, the combination is a combination of the compound (particularly Compound II) or a pharmaceutically acceptable salt thereof and sorafenib.

[0052] In a fourth aspect of the present invention, a method for preventing and / or treating liver disease is provided, comprising the step of administering (a therapeutically effective amount) a compound or a pharmaceutically acceptable salt thereof to a subject in need thereof, wherein the compound has the following structure:

[0053]

[0054] Specifically, the liver disease has the definition as described in the first aspect of the present invention.

[0055] Specifically, the subject is a mammal, especially a human.

[0056] In one embodiment of the present invention, the method is a method for preventing and / or treating liver cancer, which comprises the step of administering (a therapeutically effective amount) a compound or a pharmaceutically acceptable salt thereof to a subject in need thereof, and optionally, it may also include other types of pharmaceutical preparations and / or treatment methods.

[0057] Specifically, the other types of pharmaceutical preparations may include the second active ingredient as described in the first aspect of the present invention.

[0058] In one embodiment of the present invention, the method further comprises the step of administering an immune checkpoint inhibitor (as described in the first aspect of the present invention); specifically, the method further comprises the step of administering a PD-1 antibody.

[0059] In one embodiment of the present invention, the method further comprises the step of administering a chemotherapeutic agent (as described in the first aspect of the present invention); specifically, the method further comprises administering sorafenib or lenvatinib.

[0060] Specifically, the other types of treatment methods include, but are not limited to, hormone therapy, immunotherapy, radiotherapy, surgical treatment, and adoptive T cell therapy (such as TCR-T therapy, CAR-T therapy).

[0061] The present invention provides an application of a compound in preventing and / or treating liver diseases. Experimental results show that the compound has high liver tissue targeting, very low toxicity to primary liver cells, high liver safety, and obvious therapeutic effects on liver diseases such as viral hepatitis (such as hepatitis B) and liver cancer (including primary liver cancer and metastatic liver cancer). It also has better physicochemical properties, metabolic stability, bioavailability, and safety, and has very good prospects for drug development. BRIEF DESCRIPTION OF THE DRAWINGS

[0062] Figure 1 Shown are the drug concentration change curves of Compound Ⅰ, Compound Ⅱ, and GS-9688 in the liver and plasma of ICR mice after oral administration.

[0063] Figure 2 Shown is a schematic diagram of the plating of compounds for primary liver cell toxicity assays.

[0064] Figure 3 Shown are the results of the primary liver cell toxicity test of the compounds.

[0065] Figure 4 The ELISA test results of each dose group of compound I are shown. Among them, for each time point, from left to right, the experimental groups are vehicle control (G1), compound I-3 mpk (G2), compound I-10 mpk (G3), and compound I-20 mpk (G4).

[0066] Figure 5 The ELISA test results of each dose group of compound II are shown. Among them, for each time point, from left to right, the experimental groups are solvent control (G1), compound II-3mpk (G5), compound II-10mpk (G6), and compound II-20mpk (G7).

[0067] Figure 6 The results of qPCR test for each dose group of compound I are shown. Among them, for each time point, from left to right, the experimental groups are vehicle control (G1), compound I-3 mpk (G2), compound I-10 mpk (G3), and compound I-20 mpk (G4).

[0068] Figure 7 The results of qPCR test for each dose group of compound II are shown. For each time point, from left to right, the experimental groups are vehicle control (G1), compound II-3 mpk (G5), compound II-10 mpk (G6), and compound II-20 mpk (G7).

[0069] Figure 8The biochemical test results of each dose group of compound I are shown. Among them, for each time point, from left to right, the experimental groups are solvent control (G1), compound I-3mpk (G2), compound I-10mpk (G3), and compound I-20mpk (G4).

[0070] Fig. 9 The biochemical test results of each dose group of compound II are shown. Among them, for each time point, from left to right, the experimental groups are solvent control (G1), compound II-3mpk (G5), compound II-10mpk (G6), and compound II-20mpk (G7).

[0071] Fig.10 Shown are HE staining images of each experimental group in Example 5.

[0072] Fig.11 The figure shows the cytokine secretion of PBMC of donor 1 after stimulation by compound II and GS-9688.

[0073] Fig.12 The figure shows the cytokine secretion of PBMC of donor 2 after stimulation by compound II and GS-9688.

[0074] Fig.13 The figure shows the cytokine secretion of PBMC of donor 3 after stimulation by compound II and GS-9688.

[0075] Fig.14 The figure shows the results of the evaluation of the antiviral activity of PBMC supernatant stimulated by compound II and GS-9688, interferon α (positive drug), and ETV in PHH. Among them, Figure a is the dosing process, Figures b and d are the experimental results, and AL are compound II (1000nM), compound II (333nM), compound II (111nM), compound II (37nM), GS-9688 (2500nM), GS-9688 (833nM), GS-9688 (278nM), GS-9688 (92.6nM), Peg-IFN-α2a (100IU / ml), ETV (0.5nM), PBMC culture supernatant control without agonist, and culture medium control.

[0076] Fig.15 Shown are the BLI values ​​of mice in each group in the experiment of Example 7 (H22-luc orthotopic model).

[0077] Fig.16 Shown are the imaging images of each group of mice in the experiment of Example 7 (H22-luc orthotopic model).

[0078] Fig.17Shown are the BLI values ​​of mice in each group in the experiment of Example 8 (Hep3B-luc orthotopic liver tumor model).

[0079] Fig.18 Shown are the imaging images of each group of mice in the experiment of Example 8 (Hep3B-luc orthotopic liver tumor model).

[0080] Fig.19 Shown are the changes in body weight and BLI values ​​of mice in each group in the experiment of Example 9 (MC38-luc liver metastasis model).

[0081] Fig. 20 The figure shows the BLI values ​​of individual mice in each group during the administration period in the experiment of Example 9 (MC38-luc liver metastasis model) (different lines in each figure represent the BLI values ​​of each mouse in the corresponding group). Among them, A: vehicle, QW×3 (n=6); B: compound II, 3mpk, QW×3 (n=6); C: PD-1, 10mpk, BIW×2 (n=6); D: compound II, 3mpk, QW×3+PD-1, 10mpk, BIW×2 (n=6).

[0082] Fig.21 The final tumor and liver weight and tumor volume of each group of mice in the experiment (MC38-luc liver metastasis model) of Example 9 are shown. Among them, A: vehicle, QW×3 (n=6); B: compound II, 3mpk, QW×3 (n=6); C: PD-1, 10mpk, BIW×2 (n=6); D: compound II, 3mpk, QW×3+PD-1, 10mpk, BIW×2 (n=6).

[0083] Fig. 22 Shown are the imaging images of each group of mice in the experiment of Example 9 (MC38-luc liver metastasis model).

[0084] Fig.23 The flow cytometry panels and statistical results of the lymph nodes of each group of mice in the experiment (MC38-luc liver metastasis model) of Example 9 are shown. A: vehicle (n=5); B: compound II, 3 mpk (n=6); C: PD-1, 10 mpk (n=5); D: compound II, 3 mpk + PD-1, 10 mpk (n=6).

[0085] Fig.24 The figure shows the flow cytometry panels and statistical results of the liver and tumors of each group of mice in the experiment (MC38-luc liver metastasis model) of Example 9. A: vehicle (n=5); B: compound II, 3 mpk (n=6); C: PD-1, 10 mpk (n=5); D: compound II, 3 mpk + PD-1, 10 mpk (n=6).

[0086] Fig.25 Shown are graphs of body weight for male animals.

[0087] Fig.26 Shown are graphs of female body weights.

[0088] Fig. 27 Shown is a rectal temperature chart for a male animal.

[0089] Fig.28 Shown is a rectal temperature chart for a female animal.

[0090] Fig.29 Shown are tissue weights from male animals.

[0091] Fig.30 Shown are tissue weights from female animals. DETAILED DESCRIPTION

[0092] Unless otherwise defined, all scientific and technical terms used in the present invention have the same meanings as commonly understood by one of ordinary skill in the art to which the present invention relates.

[0093] In the present invention, "liver disease" and "liver disease" can be used interchangeably. It is a general term for all diseases occurring in the liver, including infectious diseases, tumor diseases, vascular diseases, metabolic diseases, toxic diseases, autoimmune diseases, hereditary diseases, intrahepatic bile duct stones, etc.; infectious diseases include viral infections, bacterial infections, parasitic infections, etc., such as viral hepatitis, echinococcosis, etc.; tumors are divided into benign tumors and malignant tumors, such as liver cancer, hepatic hemangioma, hepatic lipoma, hepatic sarcoma, etc.

[0094] In the present invention, the term "hepatitis" is a general term for liver inflammation caused by various reasons (including bacteria, viruses, parasites, alcohol, drugs, chemicals, autoimmunity, etc.). According to the cause, hepatitis can be divided into: viral, bacterial, drug-induced, alcoholic, toxic, autoimmune, non-alcoholic fatty hepatitis, etc.; according to the length of the course of the disease, it can be divided into disease hepatitis and chronic hepatitis; according to the presence or absence of jaundice, acute hepatitis can be divided into acute icteric hepatitis and acute non-icteric hepatitis; according to the severity of the disease, chronic hepatitis can be divided into mild, moderate and severe, etc.

[0095] The term "viral hepatitis" refers to an infectious disease characterized by liver lesions caused by a variety of hepatitis viruses, mainly including hepatitis A, hepatitis B, hepatitis C, hepatitis D, hepatitis E, and hepatitis G.

[0096] The terms "liver tumor" and "liver tumor" are used interchangeably. They are a general term for tumor lesions occurring in the liver, which can be divided into benign tumors and malignant tumors. Benign liver tumors mainly include hepatic hemangiomas, hepatic adenomas, hepatic lipomas, non-parasitic liver cysts, focal nodular hyperplasia of the liver, etc. Malignant liver tumors mainly include primary liver cancer, secondary liver cancer, bile duct cancer (especially intrahepatic bile duct cancer), and other malignant tumors of the liver (mainly including hepatoblastoma and hepatic sarcoma). Primary liver cancer originates from the epithelial or mesenchymal tissue of the liver, including hepatocellular carcinoma, cholangiocarcinoma, and mixed liver cancer. Secondary or metastatic liver cancer refers to malignant tumors originating from multiple organs throughout the body that invade the liver. It is generally common in liver metastases of malignant tumors of organs such as the stomach, bile duct, pancreas, colorectum, ovary, uterus, lung, and breast.

[0097] The term "pharmaceutically acceptable salts" includes acid addition salts and base addition salts.

[0098] The term "patient" or "subject" and the like are used interchangeably herein and refer to any animal or cell thereof treated according to the methods described herein, whether in vitro or in situ. Specifically, the aforementioned animals include mammals, e.g., rats, mice, guinea pigs, rabbits, dogs, monkeys, humans, particularly humans.

[0099] The term "treating" refers to preventing, curing, reversing, attenuating, alleviating, minimizing, inhibiting, suppressing and / or halting one or more clinical symptoms of a disease after onset of the disease.

[0100] The term "prevent" refers to avoiding, minimizing or making the onset or development of a disease difficult by treating it before it occurs.

[0101]

[00136] Various publications, patents, and published patent specifications are cited herein, the disclosures of which are incorporated by reference in their entireties.

[0102] The technical solution of the present invention will be clearly and completely described below in conjunction with the embodiments of the present invention. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0103] Some abbreviations and their corresponding meanings in the embodiments of the present invention are as follows:

[0104] FBS Fetal Bovine Serum

[0105] PBS Phosphate Buffered Saline

[0106] P / S Penicillin-Streptomycin

[0107] QW Once a week

[0108] SD standard deviation

[0109] TGI tumor growth inhibition rate

[0110] IG (also described as IG, ig) intragastric administration

[0111] IV tail vein administration

[0112] Example 1: Preparation of Compound I

[0113]

[0114] 1. Synthesis of intermediate compound 3

[0115] Dissolve clopyralid (50 g, 260.4 mmol) in N,N-dimethylformamide (800 mL), add guanidine hydrochloride (25 g, 263.2 mmol), cuprous oxide (7.4 g, 52.1 mmol) and cesium carbonate (211.6 g, 651.1 mmol), and stir at 120°C for 18 hours. Cool to room temperature, filter, fully dissolve the filter cake in methanol (1 L), filter, and concentrate the filtrate under reduced pressure to obtain the crude title product as a gray-green solid 3 (50 g, crude product). The product is directly used for the next step without purification. MS m / z (ESI): 197.0 [M+1].

[0116] 2. Synthesis of intermediate compound 5

[0117] 3 (10 g, 51.0 mmol) was dissolved in N,N-dimethylformamide (80 mL), and N,N-diisopropylethylamine (19.7 g, 153.0 mmol), 1H-benzotriazol-1-yloxytripyrrolidino hexafluorophosphate (26.5 g, 51.0 mmol) and 2-methoxyethylamine (3.8 g, 51.0 mmol) were added and stirred at room temperature for 18 hours. The reaction solution was diluted with ethyl acetate (500 mL), washed with saturated brine (500 mL × 3), the organic phase was dried over anhydrous sodium sulfate, filtered, and concentrated under reduced pressure. The residue was purified by silica gel column chromatography (mobile phase: ethyl acetate (0.5% ammonia water)-petroleum ether gradient: 0-80%) to obtain the title product as a yellow solid 5 (1.1 g, 8.5%). MS m / z (ESI): 254.1 [M+1].

[0118] 3. Synthesis of intermediate compound 7

[0119] Methyl 4-bromomethylbenzoate (2.7 g, 11.8 mmol) was dissolved in tetrahydrofuran (80 mL), zinc powder (2.3 g, 35.4 mmol) was added under ice bath, nitrogen was replaced three times, and the mixture was stirred at 0°C for 0.5 hours. Then, a solution of bis(triphenylphosphine)nickel chloride (780 mg, 1.2 mmol) and 5 (1.5 g, 5.9 mmol) in tetrahydrofuran (80 mL) was added under 0°C nitrogen, and the mixture was stirred at room temperature for 18 hours under nitrogen. The reaction solution was quenched with water (200 mL), extracted with ethyl acetate (200 mL × 3), the organic phases were combined, dried over anhydrous sodium sulfate, filtered, and concentrated under reduced pressure. The residue was purified by silica gel column chromatography (mobile phase: methanol-dichloromethane gradient: 0-3%) to obtain the title product as a yellow solid 7 (1.1 g, 50.8%). MS m / z (ESI): 368.2 [M+1]

[0120] 4. Synthesis of intermediate compound 8

[0121] 7 (1.1 g, 3.0 mmol) was dissolved in tetrahydrofuran (40 mL), and a tetrahydrofuran solution of lithium aluminum hydroxide (1 M) (4.5 mL, 4.5 mmol) was slowly added under nitrogen at 0°C, and stirred for 2 hours under nitrogen at 0°C. The reaction solution was added dropwise to an iced aqueous solution of ammonium chloride (200 mL) to quench, and extracted with ethyl acetate (200 mL×3). The organic phases were combined, dried over anhydrous sodium sulfate, filtered, and concentrated under reduced pressure. The residue was purified by silica gel column chromatography (mobile phase: methanol-dichloromethane gradient: 0-4%) to obtain the title product as a yellow oil 8 (0.8 g, 78.7%). MS m / z (ESI): 340.1 [M+1].

[0122] 5. Synthesis of intermediate compound 9

[0123] 8 (0.6 g, 1.8 mmol) was dissolved in dichloromethane (20 mL), thionyl chloride (1.1 g, 9 mmol) was slowly added at 0°C, and stirred at 0°C for 1 hour. The reaction solution was directly concentrated under reduced pressure to obtain the crude title product 9 (0.6 g, crude product) as a brown solid, which was directly used for the next step without purification. MS m / z (ESI): 358.2 [M+1].

[0124] 6. Synthesis of Compound Ⅰ

[0125] 9 (0.6 g, 1.7 mmol) was dissolved in acetonitrile (10 mL), and a tetrahydrofuran solution of dimethylamine (2 M) (1 mL, 2.0 mmol), potassium carbonate (704 mg, 5.1 mmol) and sodium iodide (51 mg, 0.34 mmol) were added and stirred at 60°C for 4 hours. After cooling to room temperature, the reaction solution was quenched with water (100 mL), extracted with ethyl acetate (100 mL×3), the organic phases were combined, dried over anhydrous sodium sulfate, filtered, and concentrated under reduced pressure. The residue was purified by C18 silica gel column chromatography (mobile phase: acetonitrile-water (0.05% hydrochloric acid) gradient: 5%-60%) to give the title product as a white solid Ⅰ (260 mg, 41.8%). MS m / z (ESI): 367.2 [M+1]. 1 HNMR (400MHz, DMSO) δ12.97(s,1H),11.21(s,1H),9.34(t,J=6.0Hz,1H),8.48(s,1H),7.87(d,J=8.6Hz,1H),7.72(d,J=8.6Hz,1H),7.55(d,J=8. 0Hz,2H),7.43(d,J=8.1Hz,2H),4.84(s,2H),4.41–4.07(m,4H),3.77(q, J=5.8Hz,2H),3.62(t,J=5.8Hz,2H),3.30(s,3H),2.63(d,J=4.8Hz,6H).

[0126] Example 2: Preparation of Compound II

[0127]

[0128] 9 (430 mg, 1.2 mmol) (prepared in Example 1) was dissolved in acetonitrile (10 mL), and morpholine (170 mg, 2.0 mmol), potassium carbonate (500 mg, 3.6 mmol) and sodium iodide (36 mg, 0.24 mmol) were added and stirred at 60°C for 4 hours. After cooling to room temperature, the reaction solution was quenched with water (100 mL), extracted with ethyl acetate (100 mL×3), the organic phases were combined, dried over anhydrous sodium sulfate, filtered, concentrated under reduced pressure, and the residue was purified by C18 silica gel column chromatography (mobile phase: acetonitrile-water (0.05% trifluoroacetic acid) gradient: 5%-60%) to obtain the title product as a white solid II (200 mg, 40.8%). MS m / z (ESI): 409.2 [M+1]. 1H NMR (400MHz, CD3OD) δ7.73(ddd,J=8.5,3.2,1.5Hz,1H),7.64(dd,J=8.6,2.7Hz,1H),7.45(s,4H),4.30(d,J=3.7Hz,4H), 3.98(d,J=1.2Hz,2H),3.86(t,J=5.5Hz,2H),3.76–3.59(m,4H),3.42–3.35(m,3H),3.36–3.29(m,2H),3.24–3.08(m,2H).

[0129] Example 3: Liver tissue distribution study of the compound

[0130] We selected GS-9688 as the control drug for the liver tissue distribution study. GS-9688 is an oral selective TLR8 agonist currently in clinical Phase II trials.

[0131] Compound I, Compound II, and GS-9688 (control drug) were administered to ICR mice by single oral gavage (10 mg / kg), and liver and plasma were collected. The specific protocol is as follows:

[0132] Before administration, check the status of the drug preparation, ensure the uniformity of the preparation by vortexing, stirring or shaking, and calculate the theoretical dosage for each mouse according to the following formula. The actual dosage for each ICR mouse and the collection time of plasma and tissue samples should be recorded in detail in the corresponding form.

[0133]

[0134] Plasma sample collection: According to the set time points, about 100 μL of blood was collected from the eye sockets, and the collected whole blood was placed in an EDTA-K2 anticoagulant tube, inverted several times to mix thoroughly, stored on wet ice, and centrifuged (1500-1600g) for 10 min within 30 min to separate the plasma. The obtained plasma samples were stored in an environment of -40 to -20°C for biological sample analysis.

[0135] The specific operation of liver tissue collection is as follows: liver tissue is collected immediately after whole blood collection. The liver tissue is removed, cleaned with ice saline, and after absorbing the water, it is weighed and homogenized by adding 20% ​​methanol-water. The homogenization ratio is 1:5 (w / v). The collection time of each tissue and the weight of the homogenized tissue should be recorded in detail in the corresponding form.

[0136] Plasma and various tissue homogenates were stored in a refrigerator at -40 to -20°C for sample analysis. After the experiment, mice were euthanized by carbon dioxide asphyxiation or cervical dislocation. After the analysis, the samples were returned to the biological sample room, which transferred the samples to a -40 to -20°C environment for sealing according to SOP-SM-001.

[0137] Sample analysis: Agilent high performance liquid chromatography (HPLC, column: Waters XBridge C18 3.5μm 2.1×50mm; detector: Agilent DAD; mobile phase: phase A: H2O (0.1% Formic Acid), phase B: ACN (0.1% Formic Acid)) was used to analyze tissue samples and determine the concentrations of compound I, compound II, and GS-9688 (control drug) in the liver and plasma at various time points. The non-compartmental model in Phoenix WinNonlin 8.0 or higher was used to calculate the corresponding plasma and liver tissue pharmacokinetic parameters, and the area under the curve AUC0-t (AUC0-t, area under the concentration-time curve 24 hours after administration) was calculated to calculate the drug liver / plasma distribution ratio (R L / P, Ratio of liver / plasma).

[0138] The liver / plasma distribution ratios of each compound are shown in Tables 1-3, respectively. The liver and plasma concentrations of each compound at each time point are shown in Tables 1-3. Figure 1 shown.

[0139] Table 1: Tissue distribution parameters of compound I (10 mg / kg) in ICR mice

[0140]

[0141] AUC 0-t , area under the concentration-time curve 24 hours after administration

[0142] Table 2: Tissue distribution parameters of compound II (10 mg / kg) in ICR mice

[0143]

[0144] AUC 0-t , area under the concentration-time curve 24 hours after administration

[0145] Table 3: Tissue distribution parameters of GS-9688 (10 mg / kg) in ICR mice

[0146]

[0147] AUC 0-t, area under the concentration-time curve 24 hours after administration; BLOQ, below the minimum detection limit

[0148] The experimental results show that the liver / plasma drug distribution ratio of compound I is 46 times, the liver / plasma drug distribution ratio of compound II is 114 times, and the liver / plasma drug distribution ratio of GS-9688 is 3.5 times. The liver / plasma drug distribution ratios of compound I and compound II are much higher than those of GS-9688, especially the liver and plasma drug distribution ratio of compound II is as high as 114 times. This result shows that compound I and compound II have high liver tissue targeting and have great development prospects in the treatment of liver diseases.

[0149] Example 4: Primary liver cell toxicity test of compounds

[0150] 1. Experimental methods

[0151] 1.1 Cell plating

[0152] (1) Day-1, resuscitated primary human hepatocytes (PHH) were plated in a collagen-coated 96-well plate with a cell number of 40,000 cells / well and a sample volume of 90 ul / well.

[0153] (2) The cells were cultured in a 37°C, 5% CO2 incubator. After 4 hours, the medium was replaced with hepatocyte maintenance medium.

[0154] 1.2 Compound treatment

[0155] (1) Day 0, dilute the test compound and STS to appropriate concentrations, add 10 μl to each well, and plate as described above. Figure 2 As shown. The final concentrations of the test compounds were 50uM, 35uM, 25uM, 12.5uM, 6.25uM, 3.125uM, 1.56uM, 0.78uM, 0.39uM, 2-fold dilution, 9 doses; the concentrations of the control compound Staurosporine (STS) were 10uM, 3.3uM, 1.1uM, 0.37uM, 0.123uM, 0.041uM, 0.0137uM, 0.0045uM, 0.0015uM, 3-fold dilution, 9 doses. The DMSO concentration was 0.5%.

[0156] (2) Culture in a 37°C, 5% CO2 incubator for 3 days.

[0157] 1.3 Proliferation assay

[0158] 1.3.1 On Day 0-3, conduct Confluence testing:

[0159] (1) The cells in the 96-well plate were imaged every day using the IncuCyte instrument, and the images were analyzed using the instrument's own software to obtain the Confluence data of the cells in each well.

[0160] (2) GraphPad Prism 8 software was used to draw graphs.

[0161] 1.3.2 On Day 3, perform CTG testing:

[0162] (1) Add 100 μl CTG detection reagent to each well and vortex to mix (protect from light).

[0163] (2) Incubate at room temperature for 30 minutes (protect from light).

[0164] (3) Read the chemiluminescence value using Envision.

[0165] (4) GraphPad Prism 8 software was used to draw graphs.

[0166] 1.4 Data Analysis

[0167] IC50 was calculated using GraphPad Prism 8 software, and the IC50 (half-maximal inhibitory concentration) of the compound was obtained using the following nonlinear fitting formula:

[0168] Y = Bottom + (Top-Bottom) / (1 + 10^((LogIC50-X)*HillSlope)), Y: inhibition rate, X: log value of compound concentration;

[0169] Inhibition rate (%) = 100-(compound well reading value-low reading control well reading value) / (high reading control well reading value-low reading control well reading value)*100;

[0170] High reading control wells: cells plus DMSO, low reading control wells: no cell culture medium.

[0171] 2. Experimental results

[0172] The experimental results are as follows Figure 3 As shown, the positive control compound has a killing activity of 464.5 nanomolar on human primary liver cells, the test compound has a killing activity of 26.5 micromolar on human primary liver cells, and the test compound has a weak direct killing activity on primary liver cells and has no obvious cytotoxicity.

[0173] Example 5: Hepatic safety evaluation of compounds

[0174] C57BL / 6J wild-type female mice (6 weeks old) were randomly divided into groups. Whole blood and liver tissues were collected from mice at 1, 2, and 4 hours after administration of different doses to test multiple indicators and evaluate the effect of the drug on the liver.

[0175] 1. Experimental methods

[0176] 1.1 Drug administration

[0177] C57BL / 6J wild-type female mice (6 weeks old) were randomly divided into groups and administered drugs;

[0178] Liver tissue and blood were collected 1 hour, 2 hours, and 4 hours after the single administration.

[0179] The experimental animals and groups are shown in the following table.

[0180] Table 4 Experimental animals

[0181]

[0182] Table 5 Experimental groups

[0183] Experimental Group Experimental animals drug deal with Dosage N time G0 blank none none none 5 none G1 C57BL / 6J♀ solvent ig 100uL 5x3 1dose G2 C57BL / 6J♀ Compound I-3mpk ig 100uL 5x3 1dose G3 C57BL / 6J♀ Compound Ⅰ-10mpk ig 100uL 5x3 1dose G4 C57BL / 6J♀ Compound I-20mpk ig 100uL 5x3 1dose G5 C57BL / 6J♀ Compound II-3mpk ig 100uL 5x3 1dose G6 C57BL / 6J♀ Compound II-10mpk ig 100uL 5x3 1dose G7 C57BL / 6J♀ Compound II-20mpk ig 100uL 5x3 1dose

[0184] Preparation of compound stock solution: Solvent: 2% (v / v) DMCO + 5% PEG400 + 93% 0.01N HCL

[0185] Sample collection and processing are as follows:

[0186] (A) 1 / 4 liver tissue—quick freezing in liquid nitrogen—extraction of total RNA—reverse transcription—qPCR.

[0187] The mRNA levels of ISG15, ISG56, Mx1, and Oas1b in the liver tissue of the qPCR detection group were determined using the following primers:

[0188] Internal reference: mouse Gapdh

[0189] mISG15-qF:GGTGTCCGTGACTAACTCCAT

[0190] mISG15-qR:TGGAAAGGGTAAGACCGTCCT

[0191] mISG56-qF:CTGAGATGTCACTTCACATGGAA

[0192] mISG56-qR:GTGCATCCCCAATGGGTTCT

[0193] mMx1-qF:GACCATAGGGGTCTTGACCAA

[0194] mMx1-qR:AGACTTGCTCTTTCTGAAAAGCC

[0195] mOas1b-qF:GGGCCTCTAAAGGGGTCAAG

[0196] mOas1b-qR:TCAAACTTCACTCCACAACGTC.

[0197] (B) 1 / 4 liver tissue - grind and homogenize - for ELISA testing;

[0198] (1) Weigh the liver tissue, wash it with ice-cold saline and remove the connective tissue;

[0199] (2) Add 5-8 volumes of PBS (with protease inhibitors), homogenize the tissue thoroughly, centrifuge at 2000 rpm for 15 min, and keep the supernatant (-20°C);

[0200] (3) Use ELISA kit to detect IFN-α, IP-10, IL-6, and TNF-α.

[0201] (C) Remaining liver tissue—HE staining and pathological evaluation.

[0202] (D) 1 / 2 blood (whole blood) - liver function index test: AST (aspartate aminotransferase), ALT (alanine aminotransferase / alanine aminotransferase), ALP (alkaline phosphatase), ALB (albumin), GGT (γ-glutamyl transferase).

[0203] (E) 1 / 2 blood - prepare serum - save for ELISA.

[0204] 1.2 Data Analysis

[0205] Graphpad Prism 8 was used to analyze the experimental data.

[0206] The data were tested using 2-way ANOVA.

[0207] 2. Experimental results

[0208] 2.1 Cytokine detection results

[0209] The ELISA test results of each dose group of compound Ⅰ and Ⅱ were as follows Figure 4 and 5 The results show that the expression of cytokines in different dose groups of the same drug has different trends over time, as shown below:

[0210] In the compound I-3mpk group, the expression levels of IL-6, TNF-α, and IFN-α decreased from high to low from 1 h to 4 h, and the expression level of IP-10 increased, decreased, and then increased again from 1 h to 4 h;

[0211] In the compound Ⅰ-10mpk group, the expression levels of IL-6, TNF-α, and IFN-α increased from low to high from 1h to 4h, and the expression level of IP-10 was the highest at 2h and decreased at 4h;

[0212] The change trends of IL-6, TNF-α, IFN-α, and IP-10 in the compound Ⅰ-20mpk group were similar, and the expression levels were similar to those in the control group at 1 h, the highest at 2 h, and decreased at 4 h;

[0213] The expression trends of IL-6, TNF-α, IFN-α, and IP-10 in the compound II-3 / 10 / 20mpk / group were similar, all reaching the highest level at 2h and decreasing at 4h. The kinetic characteristics of cytokine secretion were obvious, which was consistent with the absorption and metabolism of the drug. Among them, compound II induced the secretion of IP-10 (CXCL-10) significantly. In the clinical study of TLR agonists, IP-10 is often used as one of the biomarkers for evaluating the efficacy of the drug in the clinic.

[0214] 2.2 Results of real-time fluorescence quantitative PCR detection of interferon-related genes

[0215] The qPCR test results of each dose group of compound Ⅰ and Ⅱ are as follows Figure 6 and 7 As shown. The results showed that the relative expression of ISG15, 1SG56, Mx1, and oas1b in compound group I increased over time, reaching the highest level at 4h. The relative expression of ISG15, 1SG56, Mx1, and oas1b in compound group II increased over time, reaching the highest level at 4h, and all were statistically significant. At a dose of 3mpk (effective dose), both compound I and compound II significantly induced an increase in the expression of interferon-related gene mRNA levels.

[0216] 2.3 Real-time fluorescence quantitative PCR detection results

[0217] The biochemical test results of each dose group of compound I and II are shown in Figures 8 and 9, respectively. The results showed that ALT increased in all groups of compound I, and the differences between the administration groups at 4 hours were significant and statistically significant (p<0.001), all exceeding the normal reference range. However, according to the clinical adverse reaction grading standard, ALT exceeding 3 times the normal value is a grade 1 AE, and the increase in ALT caused by a single administration of compound I did not reach grade 1 AE; AST exceeded the normal reference range in all administration groups, and the difference was not statistically significant; ALP and GGT were within the normal reference range in all dose groups; ALB levels in the compound I-10mpk group were significantly lower than those in the control group at 2 hours;

[0218] ALT levels increased in all groups with Compound II. At 2h, the differences among the dosing groups were significant and statistically significant (p<0.001), exceeding the normal reference value range. However, according to the clinical adverse reaction grading standard, ALT exceeding 3 times the normal value is a grade 1 AE, and the increase in ALT caused by a single dose of Compound II did not reach a grade 1 AE; AST exceeded the normal reference range in all dosing groups, and the difference was not statistically significant; ALP was within the normal reference range in all dose groups; ALB levels in the Compound II group were significantly lower than those in the control group at 2h and 4h; GGT levels in the Compound II group were significantly lower than those in the control group at , and showed a dose-dependent relationship. If γ-glutamyl transferase is greater than 2.0 to 2.5 times the baseline level, it is a grade 1 AE. Low γ-glutamyl transferase is generally a normal phenomenon clinically.

[0219] 2.4 Liver HE results

[0220] The livers of mice in the compound I and compound II groups were fixed and HE staining was performed 1, 2, and 4 hours after administration. The results showed that there was no significant difference between the dose groups and the blank group. The HE images are shown in Fig.10 As shown, the administration of compound I and compound II did not cause obvious pathological damage to liver tissue.

[0221] Example 6: Anti-HBV Activity Detection of Compounds

[0222] We used primary human hepatocytes (PHH), a classic in vitro infection model for studying HBV infection, to evaluate the anti-HBV activity of compound II and GS-9688 (control drug).

[0223] First, compound II and GS-9688 were used to stimulate peripheral blood mononuclear cells (hPBMCs) from three donors at four concentration points of the test compounds. After 24 hours of stimulation, the culture supernatant was collected and the cytokine concentrations of IFN-α, IFN-γ and IL-1240 were detected.

[0224] Cytokine secretion after compound stimulation of PBMCs from different donors Figure 11-13 As shown. In different donors, the activity and intensity of compound II in inducing IFN-α, IFN-γ and IL-1240 secretion were significantly stronger than GS-9688. In particular, compound II has a strong IFN-α stimulating activity, while GS-9688 can hardly activate IFN-α, which to some extent indicates that IFN-α is mainly produced by TLR7 activation.

[0225] The culture supernatant of one of the donors (donor 1) was selected to stimulate HBV virus-infected primary hepatocytes (PHH), and interferon α and nucleoside analogue entecavir (ETV) were selected as positive controls. The experimental operation is as follows ( Fig.14 a), the specific operations are as follows:

[0226] On day -1, thaw the frozen PHH and adjust the density to 6×10 5 cells / ml, PHH were plated into 48-well plates, 0.22 ml per well.

[0227] On day 0, PHH were infected with HBV type B, 600 GE / cells.

[0228] On day 1, fresh culture medium was replaced, and reference compounds ETV and Peg-IFN-α2a (Pegasys-Roche) were added to treat cells. The reference compounds ETV and Peg-IFN-α2a of PHH were each at one concentration and in triplicate.

[0229] On day 3, the test compound compound II and GS-9688 treated PBMC supernatant (donor1), reference compounds ETV and Peg-IFN-α2a were added to the cell culture medium. PBMC supernatant was diluted 1:4 at 4 test concentrations and added to the cells, and all tests were set up in triplicate. Fresh culture medium containing PBMC supernatant and reference compounds was replaced on days 5, 7, 9, and 11. On day 13, the cell supernatant was collected and cell viability was detected using CCK-8.

[0230] According to the kit instructions, qPCR was used to detect the content of HBV DNA in the supernatant, and ELISA was used to detect HBsAg and HBeAg in the supernatant.

[0231] The experimental results are as follows Fig.14 As shown, compound II significantly reduced the expression of surface antigen HBeAg ( Fig.14 b) and HBsAg( Fig.14 c) level, and HBV DNA ( Fig.14d) levels also decreased significantly. In addition, the anti-HBV viral activity of compound II is significantly stronger than that of the positive control drug GS-9688. The activity of compound II in reducing hepatitis B surface antigen is slightly stronger than that of PEG-modified interferon α (Peg-IFN-α2a) (100IU / mL), and the activity in inhibiting HBV DNA is comparable to that of PEG-modified interferon α (Peg-IFN-α2a) (100IU / mL). As a control, the nucleoside analogue ETV did not lead to a decrease in surface antigen, but significantly led to the inhibition of HBV DNA, which is comparable to the activity of compound II and GS-9688.

[0232] In summary, compound II has significant anti-HBV activity and is superior to the positive control drug GS-9688.

[0233] Example 7: Study on the efficacy of compounds in the H22-luc homologous mouse liver cancer model

[0234] 1. Experimental methods

[0235] 1.1 Cell culture

[0236] H22-luc cells were quickly thawed in a 37°C water bath, and complete medium containing 90% 1640 + 10% FBS + 1% P / S was added. The cells were placed in a 37°C 5% CO2 incubator, and the cells were passaged every 1-2 days depending on the cell density.

[0237] Adjust the cell concentration (H22-luc, 2.0E8 / mL), mix with Matrigel matrix gel at a ratio of 1:1, place on ice and wait for subsequent injection experiments, and mix by Vortex before use.

[0238] 1.2 Tumor cell inoculation

[0239] (1) The mice were weighed before surgery and injected intraperitoneally with the anesthetic drug Avertin at a rate of 0.15 mL / 10 g body weight. After anesthesia, the hair at the abdominal surgical site was shaved with a pet razor and the mice were fixed on an operating table made of foam board.

[0240] (2) Shave the hair and disinfect the abdominal skin preparation area with iodine and 75% ethanol in turn. Use ophthalmic scissors to make a longitudinal incision of about 1.5 to 2.0 cm in the direction of the largest lobe of the liver.

[0241] (3) Use your fingers to gently press the costal arches on both sides to squeeze out the largest lobe of the liver.

[0242] (4) After the cells are mixed by vortex, use a BD brand 1 ml syringe to draw up the cells. Insert the needle at a 30-degree angle to the liver surface, and keep the needle parallel to the tabletop after insertion. Push the needle forward about 3 mm and slowly inject 10 μL of H22-luc cell suspension. It can be observed that the color of most liver lobes in the injection area quickly becomes lighter (white spots) or turbid translucent vacuoles appear.

[0243] (5) After the injection, use a cotton swab to clean the injection site and slowly remove the needle until there is no bleeding, then remove the cotton swab.

[0244] (6) Gently push the liver back into the abdominal cavity and suture the muscle layer and cortex. After suturing, use 75% ethanol to wipe the sutured incision and surrounding skin.

[0245] (6) After surgery, each mouse was subcutaneously injected with 5 mg / mL levofloxacin hydrochloride.

[0246] The experimental animals and cell lines information are shown in the following table

[0247] Table 6 Experimental animals and cell lines

[0248] cell Vaccination location Cell Type Cell Generation H22-luc liver Mouse tumor cell lines 4th Generation animal Number / Gender Age supplier BALB / c mice 40 / female 7 weeks Beijing Weitonglihua Laboratory Animal Technology Co., Ltd.

[0249] 1.3 Drug treatment

[0250] The mice were randomly divided into groups and the dosing information was as follows.

[0251] Table 7 Experimental groups

[0252] Experimental Group Number of mice Dosage and route of administration A 5 Solvent, 100μL, IG, QW×3 B 5 Compound I-3mpk, 100μL, IG, QW×3 C 5 Compound II-3mpk, 100μL, IG, QW×3

[0253] Preparation of compound stock solution: solvent: 2% (v / v) DMSO + 5% PEG400 + 93% 0.01N HCl

[0254] 1.4 Data Analysis

[0255] The experimental data were analyzed by Graphpad Prism 8. The experimental data are expressed as mean ± SD.

[0256] The data were tested using 2-way ANOVA.

[0257] 2. Experimental results

[0258] The results of the tumor inhibition effects of Compound Ⅰ and Compound Ⅱ in the H22-luc in situ model are shown in Fig.15 and 16 As shown. After 21 days of administration, the average tumor BLI in the vehicle group reached 7.00×10 10Compound I and Compound II significantly inhibited tumor growth, with TGI of 87.0% and 83.4%, respectively, P<0.0001. One mouse in the Compound I group died of ascites on the 20th day after grouping. There was no significant change in body weight in each group during the administration period.

[0259] 3. Experimental conclusion

[0260] Compounds Ⅰ and Ⅱ had significant tumor-inhibiting effects in the H22-luc liver orthotopic tumor model.

[0261] Example 8: Study on the efficacy of the compound in the Hep3B-luc human hepatocyte orthotopic xenograft mouse model

[0262] 1. Experimental methods

[0263] 1.1 Cell culture

[0264] Hep3B-luc cells were rapidly thawed in a 37°C water bath, and complete medium containing 90% MEM + 10% FBS + 1% P / S was added. The cells were placed in a 37°C 5% CO2 incubator, and the cells were passaged every 1-2 days depending on the cell density.

[0265] Adjust the cell concentration (Hep3B-luc, 1.0E8 / mL), mix with Matrigel matrix gel at a ratio of 1:1, place on ice and wait for subsequent injection experiments, and mix by Vortex before use.

[0266] 1.2 Tumor cell inoculation

[0267] (1) The mice were weighed before surgery and injected intraperitoneally with the anesthetic drug Avertin at a rate of 0.15 mL / 10 g body weight. After anesthesia, the hair at the abdominal surgical site was shaved with a pet razor and the mice were fixed on an operating table made of foam board.

[0268] (2) Shave the hair and disinfect the abdominal skin preparation area with iodine and 75% ethanol in turn. Use ophthalmic scissors to make a longitudinal incision of about 1.5 to 2.0 cm in the direction of the largest lobe of the liver.

[0269] (3) Use your fingers to gently press the costal arches on both sides to squeeze out the largest lobe of the liver.

[0270] (4) After the cells are mixed by vortex, use a BD brand 1 ml syringe to draw up the cells. Insert the needle at a 30-degree angle to the liver surface, parallel to the tabletop, and advance about 3 mm in parallel. Slowly inject 10 μL of Hep3B-luc cell suspension. It can be observed that the color of most liver lobes in the injection area quickly becomes lighter (white spots) or turbid translucent vacuoles appear.

[0271] (5) After the injection, use a cotton swab to clean the injection site and slowly remove the needle until there is no bleeding, then remove the cotton swab.

[0272] (6) Gently push the liver back into the abdominal cavity and suture the muscle layer and cortex. After suturing, use 75% ethanol to wipe the sutured incision and surrounding skin.

[0273] (7) After surgery, each mouse was subcutaneously injected with 5 mg / mL levofloxacin hydrochloride.

[0274] The experimental animals and cell lines information are shown in the following table

[0275] Table 8 Experimental animals and cell lines

[0276]

[0277] 1.3 Drug treatment

[0278] The mice were randomly divided into groups and the dosing information was as follows.

[0279] Table 9 Experimental groups

[0280] Experimental Group Number of mice Dosage and route of administration A 5 Solvent, 100μL, IG, QW×3 B 5 Compound II - 1mpk, 100μL, IG, QW×3 C 5 Compound II-3mpk, 100μL, IG, QW×3

[0281] Preparation of compound stock solution: solvent: 2% (v / v) DMSO + 5% PEG400 + 93% 0.01N HCl

[0282] 1.4 Data Analysis

[0283] The experimental data were analyzed by Graphpad Prism 8. The experimental data are expressed as mean ± SD.

[0284] The data were tested using 2-way ANOVA.

[0285] 2. Experimental results

[0286] The results of the tumor inhibition effect of compound II in the Hep3B-luc liver orthotopic tumor model are as follows Fig.17 and 18 As shown, compound II 3 mg / kg significantly inhibited tumor growth (p<0.05), with a TGI value of 61.6%. There were no deaths or obvious clinical symptoms in each administration group. The maximum body weight reduction rate after administration of compound I 3 mg / kg was 8.0%, and the maximum body weight reduction rate after administration of compound II 3 mg / kg was 5.4%.

[0287] 3. Experimental conclusion

[0288] Compound II-3mpk has a significant tumor inhibitory effect in the Hep3B-luc liver orthotopic tumor model.

[0289] Example 9: Study on the efficacy of the compound and its combination with PD-1 in the MC38-luc homologous mouse liver cancer metastasis model

[0290] 1. Experimental methods

[0291] 1.1 Cell culture

[0292] MC38-luc cells were quickly thawed in a 37°C water bath, and complete medium containing 90% DMEM+10% FBS+1% P / S+puro was added. The cells were placed in a 37°C 5% CO2 incubator, and the cells were passaged every 1-2 days depending on the cell density.

[0293] Adjust the cell concentration (MC38-luc, 2.0E7 / mL), place on ice and wait for subsequent injection experiments, and mix by Vortex before use.

[0294] 1.2 Tumor cell inoculation

[0295] (1) The abdomen and left side (spleen side) of the mouse were shaved, anesthetized, and the skin on the spleen side was exposed.

[0296] a. Place the mouse head in anesthesia to prevent awakening during surgery;

[0297] b. Place the mouse on a pad of paper or gauze to help expose the spleen.

[0298] c. After positioning, you can shave again and wipe with alcohol;

[0299] (2) Cut the skin and underlying mucosa at the spleen position with a length of about 1 cm. Clamp the pancreas with scissors and pull out the spleen. Place the spleen / pancreas on moist gauze and moisten it with PBS.

[0300] a. Gently pull out the pancreas, and do not pull out the spleen directly, as the spleen is too fragile;

[0301] b. Keep moist with PBS;

[0302] (3) Use forceps to gently lift (clamp) the spleen, insert the syringe horizontally from one end of the spleen, insert the needle about 1 cm, and gently inject MC38 cells into the spleen;

[0303] a.1x 10 6 MC38-luc, 50uL;

[0304] b. Before sucking up cells, pump the syringe repeatedly to lubricate it;

[0305] c. Inject in the middle of the spleen and do not puncture the spleen. If there is fluid outflow or heavy bleeding during the injection, the test will fail;

[0306] (4) After the injection, press the needle end of the spleen with a cotton swab, then slowly withdraw the needle for 5 minutes to allow the cells to fully enter the blood;

[0307] a. Keep the spleen moist

[0308] (5) During the 5-minute waiting period, suture the blood vessels at both ends of the spleen;

[0309] a. There is a large blood vessel at the bottom of the spleen, at both the front and back ends, which can be found by gently opening the pancreas;

[0310] b. The suture is inserted from the middle of the spleen and pancreas and the front and back ends are tied respectively;

[0311] c. This step can prevent heavy bleeding and significantly improve the success rate;

[0312] (6) After 5 minutes (vascular ligation), gently pick up the spleen with forceps, remove (burn) the spleen along the spleen-pancreas junction with an "electric soldering iron", and put the pancreas back into the mouse;

[0313] a. Do not overheat the soldering iron and try to burn (touch) the spleen;

[0314] b. Burn the blood vessels from one end to the other end to completely remove the spleen

[0315] (7) Suturing: Use suture needle and thread to suture the internal mucosa first (3-4 stitches), and then suture the external skin (3-4 stitches);

[0316] a. Suture two layers;

[0317] b. After suturing, analgesics can be injected subcutaneously immediately.

[0318] The experimental animals and cell lines information are shown in the following table

[0319] Table 10 Experimental animals and cell lines

[0320]

[0321] 1.3 Drug treatment

[0322] The mice were randomly divided into groups and the dosing information was as follows.

[0323] Table 11 Experimental groups

[0324] Experimental Group Number of mice Dosage and route of administration A 6 Vehicle (PBS), 100μL, IG, QW×3 B 6 Compound II-3mpk, 100μL, IG, QW×3 C 6 PD-1-10mpk, 100μL, IP, BIW×2 D 6 Compound II-3mpk, 100μL, IG, QW×3+PD-1-10mpk, 100μL, IP, BIW×2

[0325] Preparation of compound stock solution: solvent: 2% (v / v) DMSO + 5% PEG400 + 93% 0.01N HCl

[0326] Preparation of PD-1 antibody stock solution: solvent: PBS, PD-1 antibody is CS1003 antibody developed by CStone Pharmaceuticals (sometimes referred to as "PD-1" in this example).

[0327] 1.4 Data Analysis

[0328] The experimental data were analyzed by Graphpad Prism 8. The experimental data are expressed as mean ± SD.

[0329] The data were tested using 2-way ANOVA.

[0330] 2. Experimental results

[0331] The weight changes and BLI values ​​of mice in each group during the efficacy period of compound II and PD-1 in the MC38-luc liver metastasis model are shown in Figure 2. Fig.19 The BLI values ​​of individual mice in each group during the drug administration period are shown in Fig. 20 As shown. After 17 days of administration, the average tumor BLI in the vehicle group reached 6.24×10 9 . The combined administration of compound II and PD-1 significantly inhibited the growth of MC38-luc tumors (p<0.001), and the TGI value was 83.4%. Compound II alone had an inhibitory effect on the growth of MC38-luc tumors (p<0.05), and the TGI value was 63.3%. The maximum body weight reduction rate after administration of compound II was 3.9%. The maximum body weight reduction rate after administration of compound II and PD-1 was 3.8%. The Synergy ratio of the combined administration group was 2.698, and the combination of the two had a synergistic anti-tumor effect. The final tumor and liver weights and tumor volumes are shown as follows Fig.21 The imaging images of mice in each group are shown in Fig. 22 Shown

[0332] The lymph node flow cytometry panel and statistical results are as follows: Fig.23 The flow cytometry panels and statistical results of liver and tumors are shown in Fig.24 As shown, compound II (alone or in combination with PD-1 antibody) significantly induced an increase in kuffer cells in liver tissue, which was superior to the vehicle group and PD-1 antibody group. The results of CD8+T cell detection in peripheral lymph nodes showed that there was no significant difference between compound II, PD-1 group and vehicle group, but memory T cells decreased.

[0333] 3. Experimental conclusion

[0334] Compound II can inhibit the growth of tumors in the MC38-luc homologous mouse liver metastasis model. The combined administration of Compound II and PD-1 can further significantly inhibit the growth of tumors in the MC38-luc homologous mouse liver metastasis model.

[0335] Example 10: Investigation of the physicochemical properties of the compounds

[0336] Test compounds: Compounds I and II, and control compound N01 (for its preparation, see Chinese patent CN108069963B).

[0337] The clogP (lipid-water partition coefficient) values ​​predicted by chemdraw software were 4.7 for N01, 3.0 for compound I and compound II, and the logP values ​​dropped significantly to more than 1.5, indicating that compound I and compound II have better hydrophilicity.

[0338] The solubility of the compounds in phosphate buffer at pH = 7.4 was further tested, and the results showed that the solubility of compounds I and II was about 10 times higher than that of N01 (D18).

[0339] The above results indicate that the compounds of the present invention have better physical and chemical properties and drugability.

[0340] Table 12 Lipid-water partition coefficient and solubility of compounds

[0341] Compound <![CDATA[clogP a ]]> Solubility (μM) (buffer, pH = 7.4) N01(D18) 4.7 125 Compound Ⅰ 3.0 1215 Compound II 3.0 1012

[0342] a Prediction by ChemDraw software

[0343] Example 11: In vitro metabolic stability study of compounds

[0344] Evaluate the metabolic stability of compounds in in vitro liver microsomes. The experimental operation method and steps are as follows:

[0345] 1 μM of the compound was incubated in 1 mg / mL liver microsomes at 37°C. The reaction system was 0.1 M potassium phosphate buffer (pH 7.4), containing 3 mmol / L MgCl2 and 1 mmol / L NADPH. At the beginning of the reaction, the small molecule and liver microsomes were pre-incubated at 37°C for 10 minutes, and then the cofactor NADPH was added to initiate the metabolic reaction, and the reaction was terminated with three volumes of ice methanol containing internal standard (200 nM labetalol) at 0, 5, 10, 20, 30 and 60 minutes. After incubation at room temperature for 10 minutes, the sample was centrifuged at 4000 rpm and 4°C for 20 minutes, and the supernatant was diluted 1:1 with chromatographic pure water for quantitative analysis. The quantification of the compound was performed by LC-MS / MS on an Agilent quadrupole time-of-flight instrument (Agilent 6510). The peak of the designated ion signal was detected after 6 minutes of separation on a C18 column (50×2.1mm; 2.6μm) in a mobile phase gradient containing 0.1% formic acid-water. For metabolite identification, the mobile phase gradient was 1:1, the retention time was extended to 20 minutes, and the metabolites were analyzed by MS / MS, and the obvious molecular ion peaks were analyzed. The detailed operation process is as follows:

[0346] 1) Add 10 μL / well of compound working solution to all 96-well reaction plates (T0, T5, T10, T20, T30, T60) except the blank.

[0347] 2) Add 80 μL / well of the microsome solution to all reaction wells (T0, T5, T10, T20, T30, T60, and blank).

[0348] 3) Pre-incubate at 37°C for 10 minutes.

[0349] 4) After pre-incubation, add 10 μL / well of NADPH to each reaction plate to start the reaction.

[0350] 5) At the set end time point, 300 μL / well of 4° C. methanol solution (containing internal standard: 200 nM labetalol) was added to each reaction plate to terminate the reaction.

[0351] 6) Seal each plate and shake for 10 minutes.

[0352] 7) After shaking, centrifuge at 4000 rpm and 4°C for 20 minutes.

[0353] 8) Take out 300 μl of supernatant, add 300 μl / well of HPLC-grade water, mix well, and then detect by LC-MS.

[0354] Data Analysis:

[0355] The first-order kinetic equation was used to calculate the metabolic half-life (T1 / 2) and metabolic clearance rate (CLint(mic)) (μL / min / mg).

[0356] First-order kinetic formula:

[0357] C t =C0 exp(-k e t), k e is a constant

[0358] When C t =1 / 2C0, T 1 / 2 =Ln2 / k e =0.693 / k e ;

[0359] C Lint (mic)=0.693 / T 1 / 2 ×1 / (Microsome concentration:mg / mL)

[0360] The results are shown in the following table.

[0361] Table 13 Evaluation of liver microsomal stability of compounds

[0362]

[0363] The test results showed that compound I had an extremely short half-life in mouse liver microsomes, but a significantly prolonged half-life in human liver microsomes. Compound II had a significantly prolonged half-life in both human and mouse liver microsomes. This indicated that the oxygen substitution of the butyl chain alleviated the metabolic rate, and it was speculated that the oxidation of the β-position of the N01 alkyl chain was a potential metabolic pathway. The above results indicate that compounds I and II may have better oral bioavailability and metabolic stability, especially in humans.

[0364] Example 12: Investigation of cardiac potassium channel (hERG) inhibitory activity of compounds

[0365] The rapidly activated potassium channel encoded by the human ether-a-go-go-related gene (hERG) is an important ion channel involved in the formation of phase 3 repolarization of the cardiac action potential. Drug blockade of the hERG channel can lead to prolonged cardiac repolarization, which is manifested as a prolonged QT interval on the electrocardiogram, known as long QT syndrome. Drug-induced delayed ventricular repolarization may in some cases induce a fatal arrhythmia, torsade de pointes. In this study, the whole-cell patch clamp technique (a standard method for hERG safety evaluation) was used to study the inhibitory effect of small molecules on the hERG potassium channel and to assess their risk of inducing ventricular repolarization toxicity.

[0366] The test results are shown in the following table. Compound N01 showed strong inhibitory activity against hERG. 50< 3μM), which is at the edge of the safety requirements for clinical medication. Compared with N01, the overall lipophilicity of compound I and compound II was significantly reduced, and the inhibitory activity against hERG was also significantly reduced. Compound II had moderate hERG inhibitory activity (IC 50 =4.3 μM), compound II is a weak inhibitor according to the general standard (IC 50 >10μM). The test results showed that compounds I and II, especially compound I, significantly improved cardiac safety. Considering that the dosage of compounds I and II was very low, according to the ICH cardiac safety evaluation index (C max / hERG IC 50 >30 is low risk), C of compound I and compound II max / hERG IC 50 >30, the risk of cardiotoxicity is low.

[0367] Table 14 Evaluation results of hERG inhibitory activity of compounds

[0368] Compound <![CDATA[hERG(IC 50 ,μM)]]> N01(D18) 2.1 Compound Ⅰ 17.2 Compound II 4.3 Cisapride 0.013

[0369] Example 13: Single-dose toxicity assessment of compounds

[0370] The purpose of this study was to evaluate the tolerance of C57BL / 6 mice to different doses of the test compounds Compound I and Compound II by oral gavage for 7 days, observe the clinical symptoms (toxic reactions) of the mice, and evaluate the maximum tolerated dose (MTD) of the mice.

[0371] 1. Experimental methods

[0372] 1.1 Experimental animals

[0373] C57BL / 6 mice, 8 weeks old, female / male, 27 mice, provider: Sibeifu (Beijing) Biotechnology Co., Ltd.

[0374] The experimental animals were kept in single cages in a laminar flow clean room with SPF level constant temperature and humidity. The temperature of the room was 22±3℃, the humidity was 40-70%, and the light was alternated between light and dark for 12 hours.

[0375] 1.2 Animal grouping and treatment

[0376] The animals were randomly divided into 8 groups according to their body weight. The specific groups are shown below.

[0377] Table 15 Animal grouping

[0378]

[0379] The preparation method of compound stock solutions is shown in the table below.

[0380] Table 16 Preparation of compound stock solutions

[0381]

[0382] 1.3 Detection indicators and methods

[0383] 1.3.1 Weight

[0384] The body weight of the animals was measured and recorded daily.

[0385] 1.3.2 Clinical observation

[0386] All groups were observed clinically before and 1-2 hours after administration, and additional observations were performed if necessary. Death and mortality were observed twice a day. Observations should include but are not limited to the following: animal hair, activity, mental state, vomiting, diarrhea, and abnormal secretions around the eyes. All animals should be observed on the day of necropsy and any abnormal findings should be recorded.

[0387] Animals will be euthanized if:

[0388] The animals have lost a significant amount of body weight (emaciation). The cumulative body weight loss compared to day 1 is equal to or greater than 20%.

[0389] Animals cannot get enough food or water.

[0390] Weakness, difficulty in movement, and low body temperature.

[0391] 1.3.3 Rectal temperature detection

[0392] The rectal temperature of all animals was measured and recorded at 0 hour before administration and 2, 4, 8, and 24 hours after administration.

[0393] 1.3.4 Gross anatomy and tissue weighing

[0394] The experiment was terminated on the 7th day after administration, and gross dissection was performed to observe whether there were any lesions in the abdominal and thoracic organs, and the spleen and liver tissues were collected and weighed.

[0395] 1.4 Statistics

[0396] The experimental results are expressed as "mean ± standard deviation". SPSS17.0 software package was used for statistical analysis of each group of data, and One-way ANOVA test was used to compare whether there was a statistical difference between the two groups. P < 0.05 was considered statistically significant.

[0397] 2. Experimental results

[0398] 2.1 Weight

[0399] The body weight of experimental animals is as follows Fig.25 and 26 As shown. In male animals, the weight of animals treated with Compound I and Compound II decreased after a single administration, and the weight began to recover from the 3rd to 7th day. The weight of animals in Groups 1, 2, 3, 4, 6, 7 and 8 was significantly reduced on the 2nd day compared with the vehicle group; in female animals, the weight of animals treated with Compound I and Compound II decreased after a single administration, and the weight began to recover from the 3rd to 7th day. The weight of animals in Groups 1, 2, 3, 4, 6, 7 and 8 was significantly reduced on the 3rd day compared with the vehicle group, and the weight of animals in Groups 2, 3, 4 and 8 was significantly reduced on the 4th day compared with the vehicle group.

[0400] 2.2 Rectal temperature

[0401] The rectal temperature results of experimental animals are as follows Fig. 27 and 28 As shown. After the animals were treated with compound I and compound II for 2 hours, the rectal temperature of the animals decreased, which was significantly different from that of the vehicle group; 4 hours, 8 hours, and 24 hours after treatment, the rectal temperature of the animals gradually returned to normal.

[0402] 2.3 Cage-side observation

[0403] During the experiment, male animal No. 46 treated with 10 mg / kg of compound I in group 1 was found to have a slight hunched back on day 2, and male animal No. 35 treated with 20 mg / kg of compound II in group 6 was found to have white secretions around the eyes on day 2. No abnormalities were observed in the cages of other animals.

[0404] 2.4 Gross anatomy

[0405] During dissection, it was found that the spleens of male animal No. 46 treated with Compound I, 10 mg / kg, from Group 1 and female animal No. 2 treated with Compound I, 40 mg / kg, from Group 4 were larger. No obvious gross anatomical abnormalities were observed in the other animals.

[0406] 2.5 Tissue weight

[0407] The weight of spleen and liver of animal tissues is as follows Fig.29 and 30 In female animals, spleen weights of animals treated with 30 mg / kg Compound I were significantly increased compared with those of the vehicle group.

[0408] 3. Experimental conclusion

[0409] In summary, under the current experimental conditions, the maximum tolerated dose of compound I and compound II for female and male animals was 40 mg / kg.

[0410] Under the same experimental conditions, the maximum tolerated dose of compound N01 was 20 mg / kg, and the proportion of side effects and weight loss of compound I and compound II were also lower. The experimental results show that compound I and compound II have better safety.

[0411] Table 17 Single-dose toxicity evaluation results of compounds

[0412]

[0413] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions, etc. made within the spirit and principle of the present invention should be included in the protection scope of the present invention.

[0414] The aforementioned embodiments and methods described in the present invention may be varied based on the ability, experience and preference of those skilled in the art.

[0415] In the present invention, merely listing the steps of the method in a certain order does not constitute any limitation on the order of the method steps.

Claims

1. Use of a compound or a pharmaceutically acceptable salt thereof in the preparation of a medicament for preventing and / or treating liver disease, wherein the compound has the following structure:

2. The use according to claim 1, characterized in that The liver disease is hepatitis, preferably selected from the group consisting of viral hepatitis, alcoholic hepatitis, fatty hepatitis, drug-induced hepatitis, and autoimmune hepatitis, and more preferably viral hepatitis.

3. The use according to claim 2, characterized in that The viral hepatitis is selected from the group consisting of hepatitis A, hepatitis B, hepatitis C, hepatitis D, hepatitis E, and hepatitis G, preferably hepatitis B.

4. The use according to claim 1, characterized in that The liver disease is a liver tumor, preferably selected from: hepatic hemangioma, hepatic adenoma, hepatic lipoma, non-parasitic liver cyst, focal nodular hyperplasia of the liver, liver cancer, cholangiocarcinoma, hepatoblastoma, liver sarcoma, preferably liver cancer.

5. The use according to claim 4, characterized in that The liver cancer is primary liver cancer or metastatic liver cancer; Preferably, the primary tumor of the metastatic liver cancer is selected from the group consisting of colorectal cancer, colon cancer, gastric cancer, pancreatic cancer, stomach, intestinal leiomyosarcoma, lung cancer, breast cancer, kidney cancer, cervical cancer, ovarian cancer, prostate cancer and head and neck tumors.

6. The use according to claim 1, characterized in that The liver disease is liver damage, preferably liver fibrosis or liver cirrhosis; or, the liver disease is fatty liver or intrahepatic bile duct stones.

7. The use according to claim 1, characterized in that The drug further comprises a second active ingredient, which is selected from: one or more of a radiotherapy agent, a chemotherapeutic agent, an immunotherapy agent, an anti-angiogenic agent, a cytokine, a hormone, a polynucleotide, an antibody, an immunologically active fragment, an immune checkpoint blocker, a cell therapy drug, a small nucleic acid drug, an mRNA vaccine, and a tumor vaccine; Preferably, the immune checkpoint is selected from: PD-1, PD-L1, CTLA-4, BTLA, TIM-3, LAG-3, TIGIT, LAIR1, 2B4, CD160, preferably PD-1 or PD-L1; Preferably, the chemotherapeutic agent is selected from the group consisting of fluorouracil, doxorubicin, cisplatin, mitomycin, gemcitabine, capecitabine, irinotecan, sorafenib, sunitinib, erlotinib, and lenvatinib.

8. The use according to claim 7, characterized in that The second active ingredient is a PD-1 antibody, such as pembrolizumab, nivolumab, cemiplimab, Nofazinlimab (CS1003), Tislelizumab, toripalimab, Sintilimab, Camrelizumab, Penpulimab, Zimberelimab, serplulimab; or, The second active ingredient is a PD-L1 antibody, such as atezolizumab, duvalumab, durvaluamb, sugemalimab, envofilimab; or, The second active ingredient is a CTLA-4 antibody, such as Tremelimumab and ipilimumab; or The second active ingredient is a multi-target receptor tyrosine kinase (RTK) inhibitor, such as sorafenib and lenvatinib.

9. The use according to any one of claims 1 to 8, characterized in that: The medicament further comprises one or more pharmaceutically acceptable excipients.

10. The use according to claim 9, characterized in that The dosage form of the drug is tablets, pills, powders, granules, capsules, lozenges, syrups, liquids, emulsions, suspensions, injections, sprays, aerosols, and powder sprays; Preferably, the drug is in oral dosage form.

Images