An inositol oxygenase mutant and its application in the preparation of gluconic acid
By specifically substituting and mutating the amino acid sequence of inositol oxygenase, a highly efficient inositol oxygenase mutant was constructed. Co-expressed with aldehyde dehydrogenase, the problem of low enzyme activity was solved, and the yield of gluconic acid was significantly increased.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2023-08-23
- Publication Date
- 2026-03-10
AI Technical Summary
The low activity of inositol oxygenase MIOX severely limits the production of gluconic acid, making it a critical rate-limiting step in the gluconic acid synthesis pathway.
By rationally designing the amino acid sequence of inositol oxygenase, replacing or mutating specific amino acid residues, a highly efficient inositol oxygenase mutant can be constructed and co-expressed with aldehyde dehydrogenase to improve enzyme activity.
The enhanced enzyme activity of the inositol oxygenase mutant significantly increased the fermentation yield of gluconic acid, laying the foundation for large-scale production.
Smart Images

Figure BDA0004409296000000031 
Figure BDA0004409296000000041 
Figure BDA0004409296000000111
Abstract
Description
TECHNICAL FIELD
[0001] The present application belongs to the field of biotechnology, and relates to a myo-inositol oxygenase mutant and application thereof in preparation of glucaric acid. BACKGROUND
[0002] D-glucaric acid was called as one of the most valuable bio-refinery products by the US Department of Energy in 2004, and is widely used in food, medicine, chemical industry and other fields. In the field of medicine, D-glucaric acid can effectively inhibit the activity of beta-glucuronidase, prevent and inhibit the formation of cancer and gallstones, and can participate in the regulation of the hormone environment in the body, has the effects of reducing cholesterol, treating diabetes and the like. In the field of chemical industry, D-glucaric acid has excellent degradability, and is used as a raw material for synthesizing industrial products such as detergents, nylon and plastics, which can solve the problem of environmental pollution caused by the use of biodegradable materials and reduce the use of fossil fuels.
[0003] At present, the chemical oxidation method is mainly used to produce glucaric acid in industry, and the catalyst used in this method is expensive, and the product yield is low, which is not suitable for large-scale production. Compared with the chemical oxidation method, the microbial fermentation method is more suitable for large-scale production because of its green and environmentally friendly production process, greatly reduced cost and easy control of reaction.
[0004] The model organism Escherichia coli has a clear genetic background, clear metabolic pathways and easy culture operation, and is more conducive to large-scale industrial application. Researchers have constructed a glucaric acid synthesis pathway by heterologous expression of myo-inositol oxygenase (MIOX) and aldehyde dehydrogenase (Udh) in Escherichia coli, and realized the biosynthesis of glucaric acid in Escherichia coli. However, the enzyme activity of MIOX is low, and therefore the reaction catalyzed by MIOX is considered to be an important rate-limiting step in the glucaric acid synthesis pathway. Therefore, improving the enzyme activity of MIOX is a key problem to be solved to improve the yield of glucaric acid. SUMMARY
[0005] At present, in the synthesis pathway of glucaric acid, myo-inositol oxygenase MIOX is the main rate-limiting enzyme, and its enzyme activity is low, which seriously limits the yield of glucaric acid. In order to solve the problem of low enzyme activity of myo-inositol oxygenase, it is hoped that the coding gene miox of myo-inositol oxygenase is rationally designed by bioinformatics method, the structure of myo-inositol oxygenase is modified, and the enzyme activity of myo-inositol oxygenase is improved, so as to improve the yield of glucaric acid.
[0006] The purpose of the present application is to provide a myo-inositol oxygenase mutant and application thereof in preparation of glucaric acid.
[0007] In a first aspect, the present application provides a protein, which is as follows A1) or A2) or A3):
[0008] A1) substituting one or more amino acid residues at positions 151, 253, 119, 295, 63, 92, 71 of the amino acid sequence of wild-type myo-inositol oxygenase to obtain a myo-inositol oxygenase mutant having the same function;
[0009] A2) substituting and / or deleting and / or adding one or more amino acid residues in addition to the substituted amino acid residues at positions 151, 253, 119, 295, 63, 92 or 71 of the myo-inositol oxygenase mutant of A1) to obtain a protein having the same function;
[0010] A3) connecting a tag to the N-terminus or / and C-terminus of the protein of A1) or A2) to obtain a fusion protein.
[0011] In the above-described protein, the substitution is mutating the amino acid residues;
[0012] Further, the way of mutating each amino acid residue is as follows:
[0013] the lysine K at position 151 is mutated to alanine A;
[0014] the proline P at position 295 is mutated to glutamine Q;
[0015] the lysine K at position 253 is mutated to leucine L;
[0016] the glutamine Q at position 119 is mutated to glutamic acid E;
[0017] the glycine G at position 63 is mutated to valine V;
[0018] the arginine R at position 92 is mutated to serine K;
[0019] the asparagine N at position 71 is mutated to arginine R.
[0020] In the above-described protein, the myo-inositol oxygenase activity of the myo-inositol oxygenase mutant is higher than that of wild-type myo-inositol oxygenase.
[0021] In an embodiment of the present application, the myo-inositol oxygenase activity of the myo-inositol oxygenase mutant is higher than that of wild-type myo-inositol oxygenase, which is specifically manifested in that the glucose diacid fermentation yield of the myo-inositol oxygenase mutant combined with aldehyde dehydrogenase is improved compared with wild-type myo-inositol oxygenase.
[0022] In an embodiment of the present application, the amino acid sequence of the wild-type myo-inositol oxygenase is SEQ ID NO. 11.
[0023] In a second aspect, the present application provides a nucleic acid molecule encoding the protein of the first aspect.
[0024] In a third aspect, the present application provides an expression cassette, a recombinant vector or a recombinant microorganism comprising the nucleic acid molecule of the second aspect.
[0025] The recombinant microorganism described above is a recombinant microorganism obtained by introducing the nucleic acid molecule of the second aspect and an aldehyde dehydrogenase-encoding nucleic acid into a chassis microorganism.
[0026] In an embodiment of the present application, the chassis microorganism is Escherichia coli.
[0027] In a fourth aspect, the present application provides the use of the protein of the first aspect in any one of B1) to B5) below:
[0028] Alternatively, the present application provides the use of the nucleic acid molecule of the second aspect in any one of B2) to B5) below:
[0029] Alternatively, the present application provides the use of the expression cassette, the recombinant vector or the recombinant microorganism of the third aspect comprising the nucleic acid molecule of the second aspect in any one of B2) to B5) below:
[0030] B1) for preparing myo-inositol oxygenase;
[0031] B2) for preparing a product for producing glucaric acid;
[0032] B3) for producing glucaric acid;
[0033] B4) for increasing the production of glucaric acid;
[0034] B5) for increasing the conversion rate of myo-inositol.
[0035] In the above, the product for producing glucaric acid is an enzyme system or a precursor substance for producing glucaric acid, the enzyme system further comprising aldehyde dehydrogenase; and the precursor substance is glucuronic acid.
[0036] The above use is that myo-inositol oxygenase and aldehyde dehydrogenase cooperate to catalyze myo-inositol to produce glucaric acid.
[0037] In a fifth aspect, the present application provides the use of the protein of the first aspect and aldehyde dehydrogenase in any one of B2) to B5) below:
[0038] B2) for preparing a product for producing glucaric acid;
[0039] B3) for producing glucaric acid;
[0040] B4) for increasing the production of glucaric acid;
[0041] B5) for increasing the conversion rate of myo-inositol.
[0042] In the above text, the product used to produce glucuronic acid is an enzyme system or precursor for producing glucuronic acid, wherein the enzyme system also includes aldehyde dehydrogenase; and the precursor is glucuronic acid.
[0043] Sixthly, the present invention provides a product for producing gluconic acid, which is any one of the following:
[0044] C1) includes the protein and aldehyde dehydrogenase described in the first aspect;
[0045] C2) Recombinant microorganisms expressing the proteins and aldehyde dehydrogenase described in the first aspect;
[0046] C3) Glucuronic acid prepared using the protein described in the first aspect or recombinant microorganisms containing the nucleic acid molecules described in the second aspect.
[0047] In a seventh aspect, the present invention provides a method for producing gluconic acid, comprising the following steps:
[0048] The recombinant microorganisms described in the third aspect are fermented and cultured, and the fermentation products are collected to obtain gluconic acid;
[0049] The fermentation system contains inositol;
[0050] The recombinant microorganism expresses the protein and aldehyde dehydrogenase described in the first aspect.
[0051] In the above, the aldehyde dehydrogenase described in the embodiments of the present invention is the udh protein encoded by sequence 2.
[0052] Experiments of this invention demonstrate that, based on rational design, obtaining an inositol oxygenase mutant and expressing it in *E. coli* increased the fermentation yield of gluconic acid by 1.5 times. This invention yields an inositol oxygenase mutant with enhanced enzyme activity, which, when used in gluconic acid fermentation production, significantly increases gluconic acid yield, laying the foundation for large-scale gluconic acid production. Detailed Implementation
[0053] Unless otherwise specified, the experimental methods used in the following examples are conventional methods.
[0054] Unless otherwise specified, all materials and reagents used in the following examples are commercially available.
[0055] The strains and plasmids constructed in the following examples are detailed in Table 1, and the primers used are detailed in Table 2.
[0056] Table 1 lists the strains and plasmids used in this invention.
[0057]
[0058]
[0059] The following examples involve biological materials:
[0060] 2×pfx high-fidelity enzyme is a product of Kangwei Century Biotechnology Co., Ltd., product number: CW2965S.
[0061] 2×rapid Taq enzyme is a product of Novizan, catalog number P222-01.
[0062] DH5α competent cells are a product of Nanjing Novizan Biotechnology Co., Ltd., catalog number C502-03.
[0063] DpnI digestive enzyme is a Thermo Fisher Scientific product, product number E101.
[0064] MultiS One Step Cloning Kit, purchased from Vazyme, item number Vazyme.C113-01.
[0065] TB medium: 12g peptone, 24g yeast powder, 4mL glycerol, dissolved in water and brought to a final volume of 900mL, then sterilized at 121℃ for 20min;
[0066] Phosphate buffer: KH2PO4 2.31g, K2HPO4 12.54g, completely dissolved in water, brought to a final volume of 100mL, and sterilized at 121℃ for 20min;
[0067] Fermentation medium: 100 mL of phosphate buffer was added to 900 mL of TB medium.
[0068] The following examples illustrate the HPLC detection method for gluconic acid:
[0069] The sample was diluted 10 times with sterile water, centrifuged at 12000 r / min for 10 min, and the supernatant was filtered through a 0.22 μm filter membrane and analyzed by HPLC.
[0070] The HPLC chromatographic conditions were as follows: high performance liquid chromatograph (equipped with a differential detector); organic acid column: Aminex HPX-87H Column 300x7.8mm; mobile phase: 18mmol / L concentrated sulfuric acid; elution conditions: constant rate 0.5ml / min; column temperature: 35℃; detector temperature: 35℃.
[0071] Qualitative detection and standard curve preparation were performed using the standard D-gluconic acid (Aladdin, CAS No.: 87-73-0), with a retention time of 8.6 min.
[0072] The standard curve function for glucono-dicarboxylic acid is as follows: y = 234892.9952x, R 2 =1, where x is the peak area and y is the gluconic acid content (g / L).
[0073] Example 1: Obtaining inositol oxygenase and its mutants
[0074] I. Inositol oxygenase and its mutants
[0075] Inositol oxygenase and its mutants are as follows:
[0076] The amino acid sequence of inositol oxygenase miox1 is sequence 11 in the sequence listing, and its encoding gene miox1 is the miox1 gene derived from Arabidopsis thaliana, with the nucleotide sequence being sequence 1.
[0077] The amino acid sequence of the inositol oxygenase mutant miox1 (K151A) is obtained by mutating lysine K at position 151 of sequence 11 to alanine A, while keeping other amino acid residues unchanged. The nucleotide sequence of the gene encoding the inositol oxygenase mutant miox1 (K151A) is sequence 3.
[0078] The amino acid sequence of the inositol oxygenase mutant miox1 (K253L) is obtained by mutating lysine K at position 253 of sequence 11 to leucine L, while keeping other amino acid residues unchanged. The nucleotide sequence of the gene encoding the inositol oxygenase mutant miox1 (K253L) is sequence 4.
[0079] The amino acid sequence of the inositol oxygenase mutant miox1 (Q119E) is obtained by mutating glutamine Q to glutamate E at position 119 of sequence 11, while keeping other amino acid residues unchanged. The nucleotide sequence of the gene encoding the inositol oxygenase mutant miox1 (Q119E) is sequence 5.
[0080] The amino acid sequence of the inositol oxygenase mutant miox1 (P295Q) is obtained by mutating proline P at position 295 of sequence 11 to glutamine Q, while keeping other amino acid residues unchanged. The nucleotide sequence of the gene encoding the inositol oxygenase mutant miox1 (P295Q) is sequence 6.
[0081] The amino acid sequence of the inositol oxygenase mutant miox1 (G63V) is obtained by mutating glycine G at position 63 of sequence 11 to valine V, while keeping other amino acid residues unchanged. The nucleotide sequence of the gene encoding the inositol oxygenase mutant miox1 (G295V) is sequence 7.
[0082] The amino acid sequence of the inositol oxygenase mutant miox1(S58H) is obtained by mutating serine S at position 58 of sequence 11 to histidine H, while keeping other amino acid residues unchanged. The nucleotide sequence of the gene encoding the inositol oxygenase mutant miox1(S58H) is sequence 8.
[0083] The amino acid sequence of the inositol oxygenase mutant miox1 (R92K) is obtained by mutating arginine R at position 92 of sequence 11 to serine K, while keeping other amino acid residues unchanged. The nucleotide sequence of the gene encoding the inositol oxygenase mutant miox1 (R58K) is sequence 9.
[0084] The amino acid sequence of the inositol oxygenase mutant miox1 (N71R) is obtained by mutating asparagine N at position 71 of sequence 11 to arginine R, while keeping other amino acid residues unchanged. The nucleotide sequence of the gene encoding the inositol oxygenase mutant miox1 (N71R) is sequence 10.
[0085] II. Construction of Mutant Expression Vectors
[0086] Inositol is converted to glucuronic acid by inositol oxygenase, and glucuronic acid is then converted to gluconic acid by aldehyde dehydrogenase (encoded by the gene udh). Wild-type inositol oxygenase has low activity. To investigate the effect of different inositol oxygenase mutants on gluconic acid production, the genes encoding inositol oxygenase or its mutants were co-expressed with the gene encoding aldehyde dehydrogenase; the details are as follows:
[0087] 1. Construction of the pACYC184-miox1-udh expression vector
[0088] The nucleotide sequence of the udh protein encoding gene derived from Pseudomonas syringae is sequence 2.
[0089] 184-CF (upstream primer): atggaagccggcggcacctc
[0090] 184-CR (downstream primer): gggaattcctggggatccac
[0091] miox1-F (upstream primer): gtggatccccaggaattcccatgactattctcatagatcg
[0092] miox1-R (downstream primer): atgtatatctccttctcaccattttagcttggacggaaaa
[0093] udh-F (upstream primer): tggtgagaaggagatatacatatggcgtccgcgcataccac
[0094] udh-R (downstream primer): gaggtgccgccggcttccatttactggtcaccgaacggac
[0095] Using pACYC184 plasmid as a template and 184-CF / 184-CR as primers, the pACYC184 linear plasmid vector was amplified by PCR.
[0096] Using the inositol oxygenase MIOX1 encoding gene shown in Sequence 1 as a template, and miox1-F / miox1-R as primers, the miox1 gene fragment was amplified by PCR.
[0097] Using the Udh protein-coding gene shown in sequence 2 as a template and udh-F / udh-R as primers, the udh gene fragment was amplified by PCR.
[0098] The PCR reaction system used was as follows: ddH2O 19uL, upstream primer 2.5uL, downstream primer 2.5uL, template 1uL, and Kangwei 2×pfx high-fidelity enzyme 25uL;
[0099] The PCR reaction program is as follows: Step 1: 98℃, 3 min; Step 2: 98℃, 10 s; 55℃, 10 s; 72℃, 1 min; repeat this step 30 times; Step 3: 72℃, 5 min; Step 4: store at 4℃.
[0100] use The ligation reaction was performed using the MultiS One Step Cloning Kit. The ligation system consisted of 2 μL of the pACYC184 linear plasmid vector, 1 μL each of the miox1 and udh gene fragments, 2 μL of ligase, 2 μL of 5×Buffer, and ddH2O added to a final volume of 20 μL. The reaction conditions were: 37°C, incubated in a metal bath for 30 min to obtain the ligation solution. The ligation solution was then transformed into DH5α competent cells and cultured overnight. Colony PCR verification was performed, followed by sequencing to obtain transformants (containing the pACYC184-miox1-udh expression plasmid).
[0101] The plasmid was extracted to obtain the pACYC184-miox1-udh expression plasmid.
[0102] The pACYC184-miox1-udh expression plasmid contains the miox1 protein-coding gene shown in sequence 1 and the udh protein-coding gene shown in sequence 2.
[0103] 2. Construction of the pACYC184-miox1(K151A)-udh expression vector
[0104] Miox1(K151A)-F:atcttggagctgttcttcttcactcttcatttggtgagctc
[0105] Miox1(K151A)-R:agaagaacagctccaagatcgtggataagaccggtcagat
[0106] The pACYC184-miox1-udh plasmid was used as a vector, and the Miox1(K151A)-F / Miox1(K151A)-R primers were used as primers to amplify the pACYC184-miox1(K151A)-udh fragment by PCR.
[0107] The PCR reaction system used above was as follows: ddH2O 19uL, primers Miox1(K151A)-F / Miox1(K151A)-R 2.5uL each, pACYC184-miox1-udh plasmid template 1uL, and Kangwei 2×pfx high-fidelity enzyme 25uL;
[0108] The PCR reaction procedure was as follows: Step 1: 98℃, 3 min; Step 2: 98℃, 10 s; 55℃, 10 s; 72℃, 1 min; repeat this step 30 times; Step 3: 72℃, 5 min; Step 4: store at 4℃. Then add 1 uL of DpnI nuclease to digest the plasmid template, and react at 37℃ for 1 h. Transfer 10 uL of the above mixture into DH5α competent cells, culture overnight, perform colony PCR verification, and sequence to obtain a successfully mutated transformant (containing the pACYC184-miox1(K151A)-udh expression plasmid).
[0109] The plasmid was extracted to obtain the pACYC184-miox1(K151A)-udh expression plasmid.
[0110] The pACYC184-miox1(K151A)-udh expression plasmid contains the gene encoding the mutant miox1(K151A) shown in sequence 3 and the gene encoding the udh protein shown in sequence 2.
[0111] 3. Construction of the pACYC184-miox1(K253L)-udh expression vector
[0112] Miox1(K253L)-F:tcacctctcagaagcatacaagcatttgatgaacaatgaag
[0113] Miox1(K253L)-R:tgtatgcttctgagaggtgaagagcgtagaacgaatggtatc
[0114] Using pACYC184-miox1-udh plasmid as the vector and Miox1(K253L)-F / Miox1(K253L)-R as primers, the pACYC184-miox1(K253L)-udh fragment was amplified by PCR. The PCR reaction system consisted of: 19 μL ddH2O, 2.5 μL of primers Miox1(K253L)-F / Miox1(K253L)-R, 1 μL of pACYC184-miox1-udh plasmid template, and 25 μL of Kangwei 2×pfx high-fidelity enzyme. The PCR reaction program was as follows: Step 1: 98℃, 3 min; Step 2: 98℃, 10 s; 55℃, 10 s; 72℃, 1 min; repeat this step 30 times; Step 3: 72℃, 5 min; Step 4: store at 4℃. Then, 1 μL of DpnI nuclease was added to digest the plasmid template, and the reaction was carried out at 37°C for 1 h. 10 μL of the above mixture was liquefied and transformed into DH5α competent cells, cultured overnight, and colony PCR was performed for verification. Sequencing was performed to obtain a successfully mutated transformant (containing the pACYC184-miox1(K253L)-udh expression plasmid).
[0115] The plasmid was extracted to obtain the pACYC184-miox1(K253L)-udh expression plasmid.
[0116] The pACYC184-miox1(K253L)-udh expression plasmid contains the gene encoding the mutant miox1(K253L) shown in sequence 4 and the gene encoding the udh protein shown in sequence 2.
[0117] 4. pACYC184-miox1(Q119E)-udh
[0118] Miox1(Q119E)-F:acgaacctgagatcgagcatctgcttcagacagctgaag
[0119] Miox1(Q119E)-R:tgctcgatctcaggttcgtccaaatcaggatcactctcgtc
[0120] Using pACYC184-miox1-udh plasmid as the vector and Miox1(Q119E)-F / Miox1(Q119E)-R as primers, the pACYC184-miox1(Q119E)-udh fragment was amplified by PCR. The PCR reaction system consisted of: 19 μL ddH2O, 2.5 μL of primers Miox1(Q119E)-F / Miox1(Q119E)-R, 1 μL of pACYC184-miox1-udh plasmid template, and 25 μL of Kangwei 2×pfx high-fidelity enzyme. The PCR reaction program was as follows: Step 1: 98℃, 3 min; Step 2: 98℃, 10 s; 55℃, 10 s; 72℃, 1 min; repeat this step 30 times; Step 3: 72℃, 5 min; Step 4: store at 4℃. Then, 1 μL of DpnI nuclease was added to digest the plasmid template, and the reaction was carried out at 37°C for 1 h. 10 μL of the above mixture was liquefied and transformed into DH5α competent cells, cultured overnight, and colony PCR was performed for verification. Sequencing was performed to obtain a successfully mutated transformant (containing the pACYC184-miox1(Q119E)-udh expression plasmid).
[0121] The plasmid was extracted to obtain the expression plasmid pACYC184-miox1(Q119E)-udh.
[0122] The pACYC184-miox1(Q119E)-udh expression plasmid contains the gene encoding the mutant miox1(Q119E) shown in sequence 5 and the gene encoding the udh protein shown in sequence 2.
[0123] 5. pACYC184-miox1(P295Q)-udh
[0124] Miox1(P295Q)-F:aagtgaaacagtattatctctcccttaccaacaagtattt
[0125] Miox1(P295Q)-R:agataatactgtttcacttcctcaacgtttacgcggactttg
[0126] Using pACYC184-miox1-udh plasmid as the vector and Miox1(P295Q)-F / Miox1(P295Q)-R as primers, the pACYC184-miox1(P295Q)-udh fragment was amplified by PCR. The PCR reaction system consisted of: 19 μL ddH2O, 2.5 μL of primers Miox1(P295Q)-F / Miox1(P295Q)-R, 1 μL of pACYC184-miox1-udh plasmid template, and 25 μL of Kangwei 2×pfx high-fidelity enzyme. The PCR reaction program was as follows: Step 1: 98℃, 3 min; Step 2: 98℃, 10 s; 55℃, 10 s; 72℃, 1 min; repeat this step 30 times; Step 3: 72℃, 5 min; Step 4: store at 4℃. Then, 1 μL of DpnI nuclease was added to digest the plasmid template, and the reaction was carried out at 37°C for 1 h. 10 μL of the above mixture was liquefied and transformed into DH5α competent cells, cultured overnight, and colony PCR was performed for verification. Sequencing was performed to obtain a successfully mutated transformant (containing the pACYC184-miox1(P295Q)-udh expression plasmid).
[0127] The plasmid was extracted to obtain the pACYC184-miox1(P295Q)-udh expression plasmid.
[0128] The pACYC184-miox1(P295Q)-udh expression plasmid contains the gene encoding the mutant miox1(P295Q) shown in sequence 6 and the gene encoding the udh protein shown in sequence 2.
[0129] 6. pACYC184-miox1(G63V)-udh
[0130] Miox1(G63V)-F:aggagaagagtcgttgaggaattttacagagtcaatcacattg
[0131] Miox1(G63V)-R:tcctcaacgactcttctcctttcactctcagcatcataat
[0132] Using the pACYC184-miox1-udh plasmid as a vector and Miox1(G63V)-F / Miox1(G63V)-R as primers, the pACYC184-miox1(G63V)-udh fragment was amplified by PCR. The PCR reaction system consisted of: 19 μL ddH2O, 2.5 μL of primers Miox1(G63V)-F / Miox1(G63V)-R, 1 μL of pACYC184-miox1-udh plasmid template, and 25 μL of Kangwei 2×pfx high-fidelity enzyme. The PCR reaction program was as follows: Step 1: 98℃, 3 min; Step 2: 98℃, 10 s; 55℃, 10 s; 72℃, 1 min; repeat this step 30 times; Step 3: 72℃, 5 min; Step 4: store at 4℃. Then, 1 μL of DpnI nuclease was added to digest the plasmid template, and the reaction was carried out at 37°C for 1 h. 10 μL of the above mixture was liquefied and transformed into DH5α competent cells, cultured overnight, and colony PCR was performed for verification. Sequencing was then performed to obtain a successfully mutated transformant (containing the pACYC184-miox1(G63V)-udh expression plasmid).
[0133] The plasmid was extracted to obtain the pACYC184-miox1(G63V)-udh expression plasmid.
[0134] The pACYC184-miox1(G63V)-udh expression plasmid contains the gene encoding the mutant miox1(G63V) shown in sequence 7 and the gene encoding the udh protein shown in sequence 2.
[0135] 7. pACYC184-miox1(S58H)-udh
[0136] Miox1(S58H)-F:agcatgaaaggagaagaggtgttgaggaattttacagagtcaatc
[0137] Miox1(S58H)-R:acctcttctcctttcatgctcagcatcataatccctgaag
[0138] Using pACYC184-miox1-udh plasmid as the vector and Miox1(S58H)-F / Miox1(S58H)-R as primers, the pACYC184-miox1(S58H)-udh fragment was amplified by PCR. The PCR reaction system consisted of: 19 μL ddH2O, 2.5 μL of primers Miox1(S58H)-F / Miox1(S58H)-R, 1 μL of pACYC184-miox1-udh plasmid template, and 25 μL of Kangwei 2×pfx high-fidelity enzyme. The PCR reaction program was as follows: Step 1: 98℃, 3 min; Step 2: 98℃, 10 s; 55℃, 10 s; 72℃, 1 min; repeat this step 30 times; Step 3: 72℃, 5 min; Step 4: store at 4℃. Then, 1 μL of DpnI nuclease was added to digest the plasmid template, and the reaction was carried out at 37°C for 1 h. 10 μL of the above mixture was liquefied and transformed into DH5α competent cells, cultured overnight, and colony PCR was performed for verification. Sequencing was then performed to obtain a successfully mutated transformant (containing the pACYC184-miox1(S58H)-udh expression plasmid).
[0139] The plasmid was extracted to obtain the pACYC184-miox1(S58H)-udh expression plasmid.
[0140] The pACYC184-miox1(S58H)-udh expression plasmid contains the gene encoding the mutant miox1(S58H) shown in sequence 8 and the gene encoding the udh protein shown in sequence 2.
[0141] 8. pACYC184-miox1(R92K)-udh
[0142] Miox1(R92K)-F:taaaacggagatgagcatttgggaatgttgcgagcttctg
[0143] Miox1(R92K)-R:atgctcatctccgttttatttagcttctcgtattcttctctc
[0144] Using pACYC184-miox1-udh plasmid as the vector and Miox1(R92K)-F / Miox1(R92K)-R as primers, the pACYC184-miox1(R92K)-udh fragment was amplified by PCR. The PCR reaction system consisted of: 19 μL ddH2O, 2.5 μL of primers Miox1(R92K)-F / Miox1(R92K)-R, 1 μL of pACYC184-miox1-udh plasmid template, and 25 μL of Kangwei 2×pfx high-fidelity enzyme. The PCR reaction program was as follows: Step 1: 98℃, 3 min; Step 2: 98℃, 10 s; 55℃, 10 s; 72℃, 1 min; repeat this step 30 times; Step 3: 72℃, 5 min; Step 4: store at 4℃. Then, 1 μL of DpnI nuclease was added to digest the plasmid template, and the reaction was carried out at 37°C for 1 h. 10 μL of the above mixture was liquefied and transformed into DH5α competent cells, cultured overnight, and colony PCR was performed for verification. Sequencing was then performed to obtain a successfully mutated transformant (containing the pACYC184-miox1(R92K)-udh expression plasmid).
[0145] The plasmid was extracted to obtain the pACYC184-miox1(R92K)-udh expression plasmid.
[0146] The pACYC184-miox1(R92K)-udh expression plasmid contains the gene encoding the mutant miox1(R92K) shown in sequence 9 and the gene encoding the udh protein shown in sequence 2.
[0147] 9. pACYC184-miox1(N71R)-udh
[0148] Miox1(N71R)-F:aattttacagagtcaggcacattggccaaaccgttgatttc
[0149] Miox1(N71R)-R:tgcctgactctgtaaaattcctcaacacctcttctcctttc
[0150] Using pACYC184-miox1-udh plasmid as the vector and Miox1(N71R)-F / Miox1(N71R)-R as primers, the pACYC184-miox1(N71R)-udh fragment was amplified by PCR. The PCR reaction system consisted of: 19 μL ddH2O, 2.5 μL of primers Miox1(N71R)-F / Miox1(N71R)-R, 1 μL of pACYC184-miox1-udh plasmid template, and 25 μL of Kangwei 2×pfx high-fidelity enzyme. The PCR reaction program was as follows: Step 1: 98℃, 3 min; Step 2: 98℃, 10 s; 55℃, 10 s; 72℃, 1 min; repeat this step 30 times; Step 3: 72℃, 5 min; Step 4: store at 4℃. Then, 1 μL of DpnI nuclease was added to digest the plasmid template, and the reaction was carried out at 37°C for 1 h. 10 μL of the above mixture was liquefied and transformed into DH5α competent cells, cultured overnight, and colony PCR was performed for verification. Sequencing was then performed to obtain a successfully mutated transformant (containing the pACYC184-miox1(N71R)-udh expression plasmid).
[0151] The plasmid was extracted to obtain the expression plasmid pACYC184-miox1(N71R)-udh.
[0152] The pACYC184-miox1(N71R)-udh expression plasmid contains the gene encoding the mutant miox1(N71R) shown in sequence 10 and the gene encoding the udh protein shown in sequence 2.
[0153] III. Construction of recombinant bacteria expressing mutant proteins
[0154] The expression plasmids pACYC184-miox1-udh, pACYC184-miox1(K151A)-udh, pACYC184-miox1(K253L)-udh, pACYC184-miox1(Q119E)-udh, pACYC184-miox1(P295Q)-udh, pACYC184-miox1(G63V)-udh, pACYC184-miox1(S58H)-udh, pACYC184-miox1(R92K)-udh, and pACYC184-miox1(N71R)-udh prepared in the above two steps were transformed into strain BL21 to construct recombinant bacteria: BL21 / pACYC184-miox1-udh (named Z0), BL21 / pAC YC184-miox1(K151A)-udh (named Z1), BL21 / pACYC184-miox1(K253L)-udh (named Z2), BL21 / pACYC184-miox1(Q119E)-udh (named Z3), BL21 / pACYC184-miox1(P295Q)-udh (named Z4), BL21 / pACYC184-miox1(G63V)-udh (named Z5), BL21 / pACYC184-miox1(S58H)-udh (named Z6), BL21 / pACYC184-miox1(R92K)-udh (named Z7), BL21 / pACYC184-miox1(N71R)-udh (named Z8).
[0155] The transformation steps are as follows: Thaw the chemocompetent BL21 cells used for cloning on ice. Transform each of the above expression plasmids into 100 μL of BL21 competent cells, place on ice for 30 min, heat shock at 42°C for 90 s, quickly place on ice for 2 min, add 1 mL of pre-chilled LB medium, and incubate at 37°C, 200 rpm for 1 h. Next, centrifuge the culture medium at 8000 rpm for 1 min, discard the supernatant, and resuspend the cells in approximately 100 μL. Then, spread the cell suspension onto LB agar plates containing 25 μg / mL chloramphenicol resistance, and incubate at 37°C for 12 h until single colonies grow.
[0156] Single colony PCR was performed using primers 184-YF and 184-YR. A 3333bp fragment was obtained as the positive recombinant strain Z0-Z8.
[0157] 184-YF:CAAGAGATTACGCGCAGACC
[0158] 184-YR:ACGACAGGAGCACGATCATGC
[0159] Example 2: Preparation of gluconic acid by shake-flask fermentation
[0160] The recombinant bacteria Z1-Z8 prepared in Example 1 and the recombinant bacteria Z0 as a control were inoculated into LB liquid test tubes and cultured overnight at 37°C and 200 r / min to obtain culture medium.
[0161] The above culture medium was transferred to shake flasks containing 50 mL of fermentation medium at a 1% inoculum rate and incubated at 37°C and 200 rpm until OD reached. 600 =0.6-0.8, after adding 0.5mM IPTG and 0.5g / L inositol respectively, incubate at 30℃ and 200r / min for 24h, and then collect the fermentation broth.
[0162] Take 1 mL of fermentation broth as a sample and detect the content of gluconic acid in the fermentation broth by HPLC.
[0163] The conversion rate is gluconic acid yield / inositol dosage.
[0164] The results are shown in Table 2. It can be seen that the gluconic acid content of control Z0 is 80 mg / L, while the gluconic acid content of Z1, Z2 and Z4 is significantly increased. Among them, Z1 has the highest content of 198 mg / L, which is 1.5 times higher.
[0165] Therefore, Miox1(K151A) has the highest enzyme activity and can significantly increase the yield of gluconic acid.
[0166] Table 2 shows the gluconic acid production of each mutant.
[0167]
[0168]
Claims
1. A protein, which is as follows: Al) or A2): Al) a mutant of myo-inosose oxygenase, which is obtained by mutating a lysine K at position 151 of the amino acid sequence of wild-type myo-inosose oxygenase into an alanine A; A2) a fusion protein, which is obtained by linking a tag to the N-terminus or / and C-terminus of the protein of Al); wherein the amino acid sequence of the wild-type myo-inosose oxygenase is SEQ ID NO.
11.
2. A nucleic acid molecule encoding the protein of claim 1.
3. An expression cassette, a recombinant vector or a recombinant microorganism comprising the nucleic acid molecule of claim 2.
4. The recombinant microorganism of claim 3, wherein: the recombinant microorganism is obtained by introducing the nucleic acid molecule of claim 2 and a nucleic acid encoding an aldehyde dehydrogenase into a host microorganism; and the aldehyde dehydrogenase is a protein encoded by SEQ ID NO.
2.
5. Use of the protein of claim 1 in any of the following B1) to B5): B1) preparation of myo-inosose oxygenase; B2) preparation of a product for producing glucaric acid; B3) production of glucaric acid; B4) increasing the yield of glucaric acid; and B5) increasing the conversion rate of myo-inositol.
6. Use of the protein of claim 1 and an aldehyde dehydrogenase in any of the following B2) to B5): B2) preparation of a product for producing glucaric acid; B3) production of glucaric acid; B4) increasing the yield of glucaric acid; and B5) increasing the conversion rate of myo-inositol; wherein the aldehyde dehydrogenase is a protein encoded by SEQ ID NO.
2.
7. A product for producing glucaric acid, which is any of the following: Cl) comprising the protein of claim 1 and an aldehyde dehydrogenase; and C2) a recombinant microorganism expressing the protein of claim 1 and an aldehyde dehydrogenase; wherein the aldehyde dehydrogenase is a protein encoded by SEQ ID NO.
2.
8. A method for producing glucaric acid, comprising the steps of: fermenting a recombinant microorganism of claim 3 or 4, and collecting the fermentation product to obtain glucaric acid; wherein the fermentation system contains myo-inositol; the recombinant microorganism expresses the protein of claim 1 and an aldehyde dehydrogenase; and the aldehyde dehydrogenase is a protein encoded by SEQ ID NO.
2.
Citation Information
Patent Citations
Method for producing glucaric acid
CN104080918A
Myo-inositol oxygenases
WO2002074926A2