A method for improving tomato fruit shape

Abstract

The present invention belongs to the field of molecular biology technology, and specifically relates to a method for improving the shape of tomato fruits. The technical problem to be solved by the present invention is to provide a new option for creating tomatoes with round fruits. The technical scheme of the present invention is a method for improving the shape of tomato fruits, which is achieved by reducing the expression level of the WRKY‑S gene in tomatoes; the nucleotide sequence of the WRKY‑S gene is shown in SEQ ID No. 4, and finally, by selecting and breeding the offspring of the gene-edited plants, a homozygous, CAS9-free, round-fruited tomato material is obtained. The method for creating round-fruited tomatoes described in the present invention can also be applied to other tomato lines, and has good application prospects and production value in biological breeding.

Description

Technical Field

[0001] The invention belongs to the technical field of molecular biology, and in particular relates to a method for improving the shape of tomato fruits. Background Art

[0002] Tomato (Solanum lycopersicum), also known as tomato, is sweet and sour and has high edible and nutritional value. In the process of tomato production, tomato fruit shape is one of the important agronomic traits, which directly affects consumers' choices and determines the main market category and cooking purpose of a specific variety. For fresh tomatoes, consumers prefer tomatoes with a round fruit shape, while for processing tomatoes, long fruit shape is more suitable for mechanized harvesting. Therefore, targeted improvement of the fruit shape of cultivated tomato varieties through biotechnology will greatly improve economic benefits and have certain revolutionary and original innovative significance for tomato production.

[0003] The fruit of wild tomatoes is round, and domesticated cultivated tomatoes have a variety of shapes, including flat, round, elongated, pear-shaped, plum-shaped, and bell pepper-shaped. The shape of tomato fruit is controlled by quantitative trait loci. With the positioning of QTLs or the development of corresponding molecular markers, more and more QTL genes that control fruit shape have been discovered. SUN (SUN1642) is located on chromosome 7 and is a positive regulator of growth, which can promote tomato fruit elongation. SlSUN Homologous genes in cucumber CsSUN Also related to fruit elongation, SUN was confirmed to encode a protein belonging to the IQ67 domain (IQD) family, which is likely to affect cell morphology by regulating the direction and arrangement of cell microtubule-associated proteins, thereby affecting fruit shape. OVATE (oval) belongs to the OVATE protein family that regulates cytoskeletal structure. It is located on chromosome 2 of tomato and encodes a negative growth regulator that inhibits fruit elongation. SLOVATE Homologous genes in eggplant and pepper also showed negative regulatory effects on fruit length. fs8.1 (fruitshape8.1) is located on chromosome 8 of tomato. It mainly causes fruit elongation by increasing the number of cells in the base-apical axis of tomato fruit and increases the pressure resistance of tomato fruit. This feature makes it particularly suitable for mechanized production and harvesting of tomatoes. fs8.1 It was highly selected during tomato domestication and is present in almost all processing tomato lines on the market. In addition, there are some other tomato fruit shape genes, such as lc (locule number, number of ventricles) and fas (fasciated) controls the number of ventricles and the flattened fruit shape of tomatoes; fab (fasciated andbranched, flat and branched) and fin (fasciated inflorescence) will cause tomatoes to form more ventricles and larger fruit shapes; globe (Ball) controls the fruit shape related to the flat / round shape of tomatoes. Some other transcription factors, such as ENO (excessive number of floral organs), a member of the AP2 / ERF transcription factor superfamily, SlKNU (SlKNUCKLES), a C2H2 zinc finger protein family transcription factor, and tomato transcription factor BZR1.7 (BR signaling pathway1.7, brassinosteroid receptor gene 1.7), are also involved in the regulation of tomato fruit shape; plant hormones such as auxin, gibberellin, cytokinin, abscisic acid, and brassinosteroids also affect tomato fruit shape. Although the research on tomato fruit shape has been in-depth, we should continue to discover new fruit shape genes and transcription factors and study the relationship between them, so as to explain the regulatory mechanism of tomato fruit shape more richly and systematically, and at the same time explore how to improve tomato fruit shape without affecting other traits and obtain better other traits. In recent years, gene editing technology has made breakthrough progress, and methods such as CRISPR / Cas9, TALEN and ZFN have become the means of gene editing technology in the world. Gene editing technology is a genetic manipulation technology that can modify DNA sequences at the genome level. Gene editing technology will be widely used in all agricultural product production fields. It will break the limitation that the existing genetic modification technology is mainly used in corn, soybeans, cotton and rapeseed that are not directly consumed by humans. It has higher breeding efficiency and accuracy, and can significantly shorten the time for research and development and breeding of varieties, and prolong the time for the degradation of excellent varieties. More importantly, the food produced by gene editing technology can better meet the diverse needs of consumers for quality. Therefore, gene editing technology has a more comprehensive and long-term impact on food security. Summary of the invention

[0004] The technical problem to be solved by the present invention is to provide a new option for creating tomatoes with round fruits.

[0005] The technical solution of the present invention is a method for improving the shape of tomato fruits, which is achieved by reducing the expression level of the WRKY-S gene in tomatoes; the nucleotide sequence of the WRKY-S gene is shown in SEQ ID No.4.

[0006] Specifically, the improved tomato fruit shape is to create a tomato with a round fruit shape.

[0007] Furthermore, the method of reducing the expression level of the WRKY-S gene in tomatoes is to knock out the WRKY-S gene or interfere with the expression of the WRKY-S gene.

[0008] Particularly, the method for knocking out the WRKY-S gene is at least one of genome editing, homologous recombination or random insertion mutagenesis.

[0009] Specifically, the genome editing method includes at least one of a meganuclease method, a ZFN method, a TALEN method or a CRISPR-Cas method.

[0010] Wherein, the CRISPR-Cas method comprises the following steps:

[0011] a. Design sgRNA targeting the WRKY-S gene target site;

[0012] b. Construction of Cas editing expression vector expressing sgRNA;

[0013] c. Transform tomatoes with the Cas editing expression vector.

[0014] Furthermore, the CRISPR-Cas method is CRISPR-Cas9, CRISPR-Cas12a or CRISPR-Cas12b.

[0015] Wherein, in step a, the target site sequence is positions 89 to 108 and / or positions 216 to 235 of SEQ ID No. 4.

[0016] In particular, in step a, the sequences of sgRNA are shown as SEQ ID No.5 and SEQ ID No.6.

[0017] Specifically, in step c, the tomato is transformed using an Agrobacterium-mediated transformation method.

[0018] Preferably, in step b, the nucleotide sequence of the Cas editing expression vector expressing sgRNA is shown as SEQ ID No.7 and SEQ ID No.8.

[0019] Beneficial effects of the present invention: The present invention uses CRISPR / Cas9 genome editing technology to quickly create tomato materials with rounded fruit shapes. The method for creating tomato materials with rounded fruit shapes and the method for detecting tomatoes with rounded fruit shapes described in the present invention can be applied to other tomato lines. Compared with traditional hybrid breeding, the backbone parent is transformed from an ordinary irregular fruit-shaped tomato material to a rounded fruit-shaped tomato material within 1 to 2 years without adverse effects such as linkage drag, which has great breeding application prospects and economic value. BRIEF DESCRIPTION OF THE DRAWINGS

[0020] Figure 1 , phenotypic identification diagram of the gene-edited pure strain T2; A and B are the fruit shape phenotypes of the wild-type plant WT and the mutant wrky-s at different time points; C is the statistical analysis of the fruit shape index of the wild-type plant WT and the mutant wrky-s at the 1 cm fruit period; D is the statistical analysis of the fruit shape index of the wild-type plant WT and the mutant wrky-s at the yellow fruit period.

[0021] Figure 2 , PCR detection of transformed and regenerated plants; M is a marker; the digital numbers are the plant numbers of the T0 generation transformed and regenerated plants.

[0022] Figure 3 , diagram of mutation types in the T0 generation of gene-edited tomato plants.

[0023] Figure 4 , sequencing peak diagram of wrky-sc-1# homozygous mutant.

[0024] Figure 5 , sequencing peak diagram of wrky-sc-2# homozygous mutant.

[0025] Figure 6、Structure diagram of recombinant vector; ori: origin of replication; bom: base of migration region from pBR322; pVS1oriV: origin of replication of pVS1 plasmid; pVS1 RepA: pVS1 plasmid replication protein; pVS1 StaA: pVS1 plasmid stabilization protein; LB T-DNA repeat: T-DNA left border repeat sequence; RB T-DNA repeat: T-DNA right border repeat sequence; M13fwd: M13 forward sequencing primer; gRNA scaffold: gRNA backbone; 3xFLAG: triple tandem FLAG protein tag; SV40NLS: nuclear localization signal of SV40 (simian virus 40) large T antigen; nucleoplasmin NLS: binary nuclear localization signal from nucleoplasmin; P2A: 2A peptide from porcine Tay-Smith virus-1 polypeptide; CaMV 35s promoter: 35S promoter of cauliflower mosaic virus (CaMV); Cas9: Cas9 endonuclease; lac promoter: lactose promoter; lac operator: lactose operator; CAP binding site: CAP binding site; CaMV poly(A) signal: eukaryotic mRNA 3' tailing signal; Shine-Dalgarno sequence: the complete consensus sequence of the ribosome binding site upstream of the start codon of Escherichia coli; complementary to the 3' end region of 16S rRNA; Hygr: hygromycin resistance screening tag; NeoR / KanR: neomycin / KanR resistance screening tag; KanR: KanR resistance screening tag. DETAILED DESCRIPTION

[0026] In the previous exploratory research, the study of the identified tomato WRKY-S (WRKY-Shape, Solyc02g071130, Chr02: 40611281-40612885) transcription factor found that compared with the wild type, the mutant wrky-s showed a rounded fruit shape phenotype, confirming that WRKY positively regulates the formation of tomato fruit shape. Therefore, it is planned to use CRISPR / Cas9-mediated gene editing technology to knock out the WRKY-S gene, in order to create a new tomato germplasm with rounded fruit shape in the backbone inbred line, provide material accumulation for tomato breeding, and provide new strategies and directions for tomato agricultural production.

[0027] Example 1 CRISPR vector construction

[0028] Using CRISPR / Cas9 system to construct knockout vector WRKY-SGene (Chr02: 40611281-40612885). According to the mRNA sequence and the corresponding genomic sequence information, the specific target site sgRNA is designed according to the target sequence through the calculation software. Here, two CRISPR target sites are designed to improve the targeting efficiency. The target PCR amplification primer sequence is designed, and after the primers are synthesized, the fragment containing the target site (SEQ ID NO.1) is amplified by PCR. This PCR fragment is cloned into the final CRISPR vector. After the vector is constructed, it is transferred into Escherichia coli by electroporation. DH5α , select clones and shake bacteria, and then perform colony PCR to screen positive clones. The specific steps are as follows:

[0029] (1) Design of CRISPR target site and target site adapter primers

[0030] in accordance with WRKY-S The PCR primers for vector construction were designed based on the mRNA sequence and the corresponding genomic sequence information (SEQ ID No.2 WRKY-S-F2: ACCTTCTTTACAAAAGTGGGGTCTACATC; SEQ ID No.3 WRKY-S-R2: AGAGTGAAGTTGATCATCTTGAAGATGG A). PCR system: template DNA 1 μL, 10×Buffer 2 μL, dNTPMixture (2 mM) 0.4 μL, PrimerF (10 μM) 0.4 μL, PrimerR (10 μM) 0.4 μL, Taq (5U / μL) 0.1 μL, ddH2O supplemented to 20 μL. PCR program: 95℃ 3min; 95℃ 30 sec, 56℃ 30 sec, 72℃30 sec, 32 cycles; 72℃ 10 min; 25℃ 2min.

[0031] SEQ ID No.1 Based on WRKY-SThe fragments containing the target sites were designed based on the mRNA sequence and the corresponding genome sequence information; the 313th to 332nd and 440th to 459th positions are the target sites; the lowercase letters are the PAM sequences; .

[0032] (2) Target linker preparation

[0033] According to the mRNA sequence and the corresponding genome sequence information, specific target site sgRNA was designed according to the target sequence through computing software. Here, two CRISPR target sites (SEQ ID No. 4 positions 89-108 and 216-235) were designed to improve the targeting efficiency.

[0034] The sequences of sgRNA1 and sgRNA2 for the two CRISPR target sites are as follows:

[0035] sgRNA1 (SEQ ID No.5): 5'-TATTAAGCACGATTCTTCAA -3' (target sequence is SEQID No.4, 89-108);

[0036] sgRNA2 (SEQ ID No.6): 5'-TTTGGATTTTCAACACTTTC -3' (the target sequence is positions 216 to 235 of SEQID No.4).

[0037] Single enzyme digestion (all used are Takara fast digestion enzymes) system 50μL: KpnI 1μL; 10×buffer 5μL; plasmid DNA 2μg; ddH2O to 50μL. After mixing, place the reaction in a 37℃ water bath for 30 minutes. Prepare 1.5% agarose gel electrophoresis to recover and purify the target fragment. Adding an 18bp homology arm on both sides of the target gene will skip the KpnI restriction site recognition sequence during homologous recombination, thereby achieving the purpose of deleting the restriction site.

[0038] (3) Homologous recombination

[0039] The system (20μL system) is as follows: the volume of the inserted gene fragment = fragment size × 0.04 / concentration (1μL≈10 / 11.6) (Note: the amount of the inserted fragment amplification product should be between 10 and 200 ng. Since 193×0.04=7.72<10, the lowest amount should be selected directly); the volume of the linearized vector = vector size × 0.02 / concentration (6μL≈200 / 32.2) (Note: the amount of the linearized cloning vector should be between 50 and 200 ng. Since 16384×0.02=327.68>200, the highest amount should be selected directly); 5 × CE II Buffer 4μL; Exnase II 2 μL; ddH2O is added to 20μL. After mixing with the pipette tip, connect at 37℃ for 30min and immediately place on ice. Transform into competent E. coli cells.

[0040] (4) Positive clone verification

[0041] The target site fragment was recombined with the expression vector pv58-k (the structure of the recombinant vector is shown in Figure 6 , SEQ ID No.7 and SEQID No.8) and then electrotransformed into Escherichia coli DH5α. The specific steps are as follows: Place the reaction in an ice bath for 30 minutes, then gently take it out, heat shock at 42℃ for 60 seconds, and place it on ice for 2 minutes. Then add 600 µL LB liquid culture medium, and resuscitate and culture at 37℃ and 150 rpm for 1 hour before plating. Take an appropriate amount of bacterial liquid and spread it on an LB plate containing kanamycin and culture it overnight at 37℃. Select positive clones for sequencing, and sequence the CRISPR vector with primers WRKY-S-F2 / R2. The sequencing successfully carried out tomato genetic transformation. PCR system: 1 μL bacterial solution, 2 μL 10× Buffer, 0.4 μL dNTP Mixture (2 mM), 0.4 μL PrimerF (10 μM), 0.4 μL PrimerR (10 μM), 0.1 μL Taq (5U / μL), ddH2O to 20 μL. PCR program: 95℃ 3min; 95℃ 30 sec, 56℃ 30 sec, 72℃ 30 sec, 32 cycles; 72℃ 10 min; 25℃ 2min.

[0042] SEQ ID No.7 Nucleotide sequence from position 1 to position 6421 of the recombinant vector

[0043]

[0044]

[0045] Example 2 Tomato genetic transformation

[0046] Gene-edited plants were obtained using the leaf disc transformation method. Tomato seeds were sterilized and sown in 1 / 2 MS medium; they were cultured in a constant temperature box until two cotyledons were fully extended to obtain sterile seedlings; sterile cotyledons were taken, the two ends of the cotyledons were removed, and the rest was cut into several small cubes, inoculated on the differentiation medium for pre-culture for 2-3 days as explants; the pre-cultured explants were infected with Agrobacterium, and co-cultured on the differentiation medium until colonies grew around the explants, and the explants were transferred to the callus induction medium with antibacterial agents and antibiotics for screening. After 2-3 weeks, the transformed cells of the explants will differentiate into resistant adventitious buds; when the adventitious buds grow to more than 1 cm, they are cut off and inserted into the rooting medium for rooting and growth; after the plants take root, they are transplanted into the seedling medium. Cut the leaves of the regenerated plants, extract DNA using the CTAB method, and perform PCR detection using the specific primers of the selection marker gene.

[0047] PCR system: DNA sample 1.5 μL, Qingke T3Mix 27 μL, F Primer (10 μmol / L) 0.5 μL, RPrimer (10 μmol / L) 0.5 μL, ddH2O to 30 μL. PCR program: 98℃ 3min; 98℃ 10sec, 56℃ 10sec, 72℃ 10sec, 32 cycles; 72℃ 5 min; 25℃ 2min.

[0048] The transformed regenerated plants T0 generation were obtained through seed germination, cotyledon pre-culture, Agrobacterium-mediated genetic transformation, screening culture and differentiation, and resistance bud rooting. The transformed plants T0 generation were tested by PCR using primers WRKY-S-F2 / R2, such as Figure 2 As shown, PCR products of 14 T0 plants were selected for sequencing ( Figure 2 ). The sequencing peak graph file shows that the two strains have homozygous mutations, and the sequencing peak graph is a single peak ( Figure 4 and Figure 5 ).

[0049] The gene sequence of the homozygous mutant wrky-sc-1 was edited as follows based on SEQ ID No.4: the base T at position 104 was changed to base A, the base T at position 105 was deleted, and the five bases GATTT at positions 220 to 224 were deleted. The gene sequence of the homozygous mutant wrky-sc-2 was edited as follows based on SEQ ID No.4: a base T was inserted at position 105, and the three bases GAT at positions 220 to 222 were deleted.

[0050] The T0 transgenic plants were tested by PCR and positive mutants were screened (see Figure 3 ), and then these T0 generation positive mutants were self-pollinated for seed preservation. For the T1 generation plants obtained by self-pollination, PCR detection was performed again to confirm the tomato plants with WRKY-S gene mutations and no CAS9 transgenic insertion fragments, and the T1 generation was self-pollinated again to obtain the T2 generation.

[0051] The T2 generation of gene-edited homozygous strains without transgenic insertion fragments were screened for phenotypic identification of tomato round fruit shape; subsequently, the obtained tomato materials were further evaluated and identified for round fruit shape phenotypes in the greenhouse. Figure 1 A and Figure 1 B), the results showed that the fruit shape began to change in the early stage of fruit formation. From the green fruit stage to the yellow fruit stage and then to the red fruit stage, the fruit of the mutant wrky-s was more round and regular than that of the wild type WT. The fruit shape index of the mutant wrky-s was different from that of the wild type at both the 1 cm fruit stage and the yellow fruit stage ( Figure 1 C and Figure 1 D). Therefore, the results indicate that WRKY-S positively regulates fruit shape formation.

[0052] SEQ ID No. 4 WRKY-S (Chr02:40611281-40612885) wild-type sequence, positions 89 to 108 and 216 to 235 are target sequences;

[0053]

[0054] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention rather than to limit it. Although the present invention has been described with reference to the preferred embodiments of the present invention, it should be understood by those skilled in the art that various changes may be made in form and details without departing from the spirit and scope of the present invention as defined in the appended claims.

Claims

1. A method for improving the shape of tomato fruit, characterized in that: This is achieved by reducing the expression level of the WRKY-S gene in tomatoes; the nucleotide sequence of the WRKY-S gene is shown in SEQ ID No.

4.

2. The method according to claim 1, characterized in that: The improved tomato fruit shape is to create a tomato with a round fruit shape.

3. The method according to claim 1, characterized in that: The method of reducing the expression level of the WRKY-S gene in tomatoes is to knock out the WRKY-S gene or interfere with the expression of the WRKY-S gene.

4. The method according to claim 3, characterized in that: The method for knocking out the WRKY-S gene is at least one of genome editing, homologous recombination or random insertion mutagenesis.

5. The method according to claim 4, characterized in that: The genome editing method includes at least one of a meganuclease method, a ZFN method, a TALEN method or a CRISPR-Cas method.

6. The method according to claim 5, characterized in that: The CRISPR-Cas method comprises the following steps: a. Design sgRNA targeting WRKY-S gene; b. Construction of Cas editing expression vector expressing sgRNA; c. Transform tomatoes with the Cas editing expression vector.

7. The method according to claim 6, characterized in that: The CRISPR-Cas method is CRISPR-Cas9, CRISPR-Cas12a or CRISPR-Cas12b.

8. The method according to claim 6, characterized in that: In step a, the target site sequence is shown in positions 89 to 108 and / or positions 216 to 235 of SEQ ID No.

4.

9. The method according to claim 8, characterized in that: In step a, the sequences of sgRNA are shown as SEQ ID No.5 and SEQ ID No.

6.

10. The method according to claim 6, characterized in that: In step c, the tomato is transformed using an Agrobacterium-mediated transformation method.

Images