Integrated PCSK9 adenine base editing system and its applications
Through the integrated PCSK9 adenine base editing system, the off-target effect and low editing efficiency in traditional technologies are solved, efficient gene editing and immune cell enhancement are achieved, and clinical application potential is achieved.
Patent Information
- Application Number
- CN202411669848.3
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-11-20
- Publication Date
- 2025-08-19
- Estimated Expiration
- 2044-11-20
AI Technical Summary
In the prior art, traditional Crispr/gRNA technology has off-target effects and uncertainties in gene editing, the editing efficiency of the dual plasmid system is low, and PCSK9 monoclonal antibodies have allergic reactions and in vivo accumulation problems, affecting the effect of immunotherapy.
The integrated PCSK9 adenine base editing system is adopted, including a single plasmid and a delivery vector, which simultaneously expresses Cas protein and target gRNA, binds to a liver-specific promoter, and uses the self-synthetic nanovector TPGS-TK-PEI for efficient delivery to achieve specific expression of hepatocytes.
It alleviates off-target effects and uncertainties of gene editing, improves editing efficiency, reduces adverse reactions, enhances the immune efficacy of immune cells, and has clinical application potential.
Smart Images

Figure CN119506351B_ABST
Abstract
Description
Technical Field
[0001] The present invention belongs to the field of biomedicine technology, and specifically relates to an integrated PCSK9 adenine base editing system and its application. Background Art
[0002] Liver cancer is a common malignant tumor, with the second-highest mortality rate among all malignant tumors. my country is a major country with a high incidence of liver disease, accounting for over 50% of liver cancer deaths worldwide. This dire situation places a heavy burden on society and healthcare. Clinical treatment for liver cancer primarily relies on surgery, radiotherapy, and immunotherapy. Currently, mainstream medical care considers immunotherapy to be a key approach to improving patient survival. However, in practice, many patients exhibit poor response to immunotherapy drugs and rapid drug resistance, resulting in suboptimal prognosis.
[0003] Proprotein Convertase Subtilisin / Kexin Type 9 (PCSK9) is a serine protease primarily secreted by hepatocytes. Recent studies have reported that PCSK9 is a novel tumor immunosuppressive molecule that can reduce the efficacy of immune checkpoint therapy. Combining PCSK9 with a monoclonal antibody has been reported to significantly enhance the anti-tumor activity of PD-1 antibodies. However, PCSK9 monoclonal antibodies can have a strong allergic reaction and cause adverse reactions. Furthermore, antibody-bound PCSK9 protein cannot be rapidly eliminated from the body, leading to its accumulation in the body and reducing its effectiveness in improving immunotherapy. In recent years, gene editing therapy has achieved success in numerous clinical trials in the field of oncology, and researchers are committed to finding new solutions at the gene editing level. However, traditional Crispr / gRNA technology requires the cleavage of double-stranded DNA, which greatly increases the risk of off-target effects and uncertainty in gene editing. In addition, the dual-plasmid base editing system consists of two plasmids that separately express Cas protein and gRNA. The dual-plasmid adenine base editing system can edit target genes in vivo and in vitro, but because the two plasmids have different efficiencies in entering the same target cell, the efficiency of the dual-plasmid editing system is greatly limited.
[0004] For example, the patent with publication number CN114686456A and invention title “Base editing system based on bimolecular deaminase complementation and its application” discloses a system mainly composed of base editing fusion proteins A, B and guide RNA with dual complementarity of nCas9 and nuclear base deaminase, which reduces the problem of off-target of traditional editors. However, the technical solution of this patent is composed of three components: dual complementary base editing fusion proteins A, B and guide RNA. The three components need to reach the target cell at the same time to produce an editing effect. However, in actual treatment of humans and animals, the efficiency of multiple components entering a cell at the same time and producing an effect is extremely low. At the same time, safe and efficient carriers are also needed for the in vitro and in vivo delivery of plasmid editors to truly achieve good effects in cells. Therefore, it is necessary to propose new methods and strategies. Summary of the Invention
[0005] In view of this, the purpose of the present invention is to provide an integrated PCSK9 adenine base editing system and its construction method and application, to partially solve or alleviate the above-mentioned deficiencies in the prior art. The present invention specifically adopts the following technical solutions.
[0006] On the one hand, the present invention provides an integrated PCSK9 adenine base editing system.
[0007] An all-in-one PCSK9 adenine base editing system, including the following structures:
[0008] (1) Single plasmid;
[0009] (2) PCSK9 adenine base editor, wherein the PCSK9 adenine base editor comprises a U6 promoter structure, a TBG promoter structure, an AmpR promoter structure and a plasmid backbone region;
[0010] Wherein, the U6 promoter structure comprises a gRNA targeting PCSK9; the gRNA targeting PCSK9 comprises a sequence selected from any one of SEQ ID NO.3 and SEQ ID NO.12-28;
[0011] Wherein, the TBG promoter structure comprises a liver-specific TBG promoter sequence and a CRIPSR / Cas9 ABE protein;
[0012] The single plasmid and the PCSK9 adenine base editor form a single plasmid integrated adenine base editor;
[0013] (3) delivery vehicle;
[0014] The single-plasmid integrated adenine base editor is encapsulated by the delivery vector to form the integrated PCSK9 adenine base editing system.
[0015] Preferably, the gRNA targeting PCSK9 includes a sequence selected from any one of SEQ ID NO.3, SEQ ID NO.12, SEQ ID NO.13, SEQ ID NO.14, SEQ ID NO.15, SEQ ID NO.16, SEQ ID NO.17, SEQ ID NO.18, SEQ ID NO.19, SEQ ID NO.20, SEQ ID NO.21, SEQ ID NO.22, SEQ ID NO.23, SEQ ID NO.24, SEQ ID NO.25, SEQ ID NO.26, SEQ ID NO.27 or SEQ ID NO.28.
[0016] Optionally, the present invention can also provide an integrated PCSK9 adenine base editing system.
[0017] An all-in-one PCSK9 adenine base editing system, including the following structures:
[0018] (1) Single plasmid;
[0019] (2) PCSK9 adenine base editor, wherein the PCSK9 adenine base editor comprises a U6 promoter structure, a TBG promoter structure, an AmpR promoter structure and a plasmid backbone region;
[0020] Wherein, the U6 promoter structure comprises a gRNA targeting PCSK9; the gRNA targeting PCSK9 is a gRNA of mouse PCSK9, including a sequence selected from any one of SEQ ID NOs. 12-19;
[0021] Wherein, the TBG promoter structure comprises a liver-specific TBG promoter sequence and a CRIPSR / Cas9 ABE protein;
[0022] The single plasmid and the PCSK9 adenine base editor form a single plasmid integrated adenine base editor;
[0023] (3) delivery vehicle;
[0024] The single-plasmid integrated adenine base editor is encapsulated by the delivery vector to form the integrated PCSK9 adenine base editing system.
[0025] Optionally, the present invention can also provide an integrated PCSK9 adenine base editing system.
[0026] An all-in-one PCSK9 adenine base editing system, including the following structures:
[0027] (1) Single plasmid;
[0028] (2) PCSK9 adenine base editor, wherein the PCSK9 adenine base editor comprises a U6 promoter structure, a TBG promoter structure, an AmpR promoter structure and a plasmid backbone region;
[0029] Wherein, the U6 promoter structure comprises a gRNA targeting PCSK9; the gRNA targeting PCSK9 is a human PCSK9 gRNA, comprising a sequence selected from any one of SEQ ID NOs. 20-28;
[0030] Wherein, the TBG promoter structure comprises a liver-specific TBG promoter sequence and a CRIPSR / Cas9 ABE protein;
[0031] The single plasmid and the PCSK9 adenine base editor form a single plasmid integrated adenine base editor;
[0032] (3) delivery vehicle;
[0033] The single-plasmid integrated adenine base editor is encapsulated by the delivery vector to form the integrated PCSK9 adenine base editing system.
[0034] Furthermore, the liver-specific TBG promoter sequence is shown as SEQ ID NO.5.
[0035] Furthermore, the delivery vector includes a nanocarrier, and the nanocarrier and the single-plasmid integrated adenine base editor form a stable complex through electrostatic interaction.
[0036] Furthermore, the nanocarrier is obtained by covalently linking a ROS-sensitive (reactive oxygen species-sensitive) ketal thiol linkage in the middle (between the hydrophobic and hydrophilic ends) with vitamin E succinate polyethylene glycol 1000 as the hydrophobic end and polyethyleneimine as the hydrophilic end.
[0037] A thioketal linkage is also known as a ketethiol bond or a ketal bond. It consists of two sulfur atoms, a carbonyl group, and a carbon atom.
[0038] Furthermore, the nanocarrier and the single-plasmid integrated adenine base editor are compounded at a mass ratio of 2-10:1.
[0039] Preferably, the mass ratio of the nanocarrier to the single-plasmid integrated adenine base editor includes 2:1, 3:1, 4:1, 5:1, 6:1, 7:1, 8:1, 9:1 or 10:1.
[0040] Furthermore, the delivery carrier also includes a liposome carrier and any other commercially available delivery carrier.
[0041] On the other hand, the present invention provides an application of the above-mentioned integrated PCSK9 adenine base editing system.
[0042] Application of the above-mentioned integrated PCSK9 adenine base editing system in the preparation of liver cancer targeted preparations.
[0043] The application of the above-mentioned integrated PCSK9 adenine base editing system in the preparation of immune cell immune efficacy enhancers.
[0044] Preferably, the immune cells include T cells and NK cells.
[0045] Furthermore, the integrated PCSK9 adenine base editing system is used to culture the immune cells in vitro to silence the PCSK9 gene in the immune cells.
[0046] A combination drug combination for targeted liver cancer treatment, comprising the above-mentioned integrated PCSK9 adenine base editing system and immune cells.
[0047] Furthermore, the combination drug composition also includes other pharmaceutically feasible carriers and / or adjuvants.
[0048] The present invention can also provide a method for preparing the above-mentioned integrated PCSK9 adenine base editing system, which specifically includes:
[0049] S01: Construction of a single-plasmid integrated adenine base editor;
[0050] S02: synthetic delivery vector TPGS-TK-PEI;
[0051] S03: Dissolve the synthesized TPGS-TK-PEI in water and obtain self-organizing nanoparticles using water bath ultrasound; mix the self-organizing nanoparticles with the single-plasmid integrated adenine base editor in a mass ratio of 2-10:1, and let it stand at room temperature to obtain the integrated PCSK9 adenine base editing system.
[0052] Furthermore, the mass ratio of the self-organizing nanoparticles to the single-plasmid integrated adenine base editor includes 2:1, 3:1, 4:1, 5:1, 6:1, 7:1, 8:1, 9:1 or 10:1.
[0053] Furthermore, the synthesis steps of the delivery vector TPGS-TK-PEI include:
[0054] S01: Propane-2,2-diylbis(thio)diacetic acid (abbreviated as TK) and amino polyethylene glycol 1000 vitamin E succinate (abbreviated as TPGS-NH2) are subjected to a condensation acylation reaction under the catalysis of a catalyst to obtain ROS-sensitive vitamin E succinate polyethylene glycol 1000 (abbreviated as TPGS-TK);
[0055] S02: The TPGS-TK and polyethyleneimine polymer (abbreviated as PEI) are subjected to a condensation acylation reaction under the catalysis of a catalyst to obtain a ROS-sensitive amphiphilic polymer (abbreviated as TPGS-TK-PEI).
[0056] It should be noted that the strategy of using the single plasmid system of the present invention as a template, transcribing in vitro into mRNA, and delivering and editing PCSK9, and providing alternative sequences similar or identical to those of the present invention, is an easily conceivable avoidance strategy and is also within the scope of protection of the present invention.
[0057] Beneficial technical effects:
[0058] (1) In view of the fact that the existing editor is a multi-plasmid system with low transfection and editing efficiency, the present invention innovatively proposes a single-plasmid integrated base editing system. Specifically, the present invention first provides an integrated base editor, which simultaneously expresses Cas protein and target gRNA in one plasmid; in addition, the integrated base editor is single-stranded and has a built-in liver-specific promoter, so the integrated base editor can be specifically expressed in liver cells, while overcoming the need for traditional Crispr / gRNA technology to cut double-stranded DNA, greatly alleviating the off-target effect and uncertainty of gene editing; in addition, it can also overcome the problem of different efficiencies of two plasmids entering the same target cell and low editing efficiency in the traditional dual-plasmid system.
[0059] (2) Furthermore, the present invention synthesized a nanocarrier, TPGS-TK-PEI, which has been verified to achieve efficient transfection in vitro and in vivo, and can also effectively silence the target gene. Compared with commercial carriers, the nanocarrier synthesized by the present invention is less expensive and has the potential for large-scale promotion.
[0060] (3) Finally, the integrated base editing system synthesized by the present invention has been proven to be effective in both in vitro and in vivo animal experiments, and therefore has the potential to be put into clinical application. BRIEF DESCRIPTION OF THE DRAWINGS
[0061] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the following is a brief introduction to the drawings required for the embodiments or the description of the prior art. In all drawings, similar elements or parts are generally identified by similar reference numerals. In the drawings, the various elements or parts are not necessarily drawn according to the actual scale. Obviously, the drawings described below are some embodiments of the present invention. For those of ordinary skill in the art, other drawings can also be obtained based on these drawings without inventive work.
[0062] Figure 1 This is a schematic diagram of the construction process of a single-plasmid integrated adenine base editor in one embodiment of the present invention;
[0063] Figure 2 The structural formula of the delivery vector TPGS-TK-PEI synthesized in one embodiment of the present invention is shown below;
[0064] Figure 3 This is the horizontal gel electrophoresis result of the TPGS-TK-PEI plasmid adsorption and encapsulation of the PCSK9 adenine base editor plasmid in one of the embodiments of the present invention;
[0065] Figure 4 This is a scanning electron micrograph of the integrated PCSK9 adenine base editing system ABE-TBG-PCSK9 NPs synthesized in one embodiment of the present invention (scale bar 200 nm);
[0066] Figure 5 The transfection results of the integrated PCSK9 adenine base editing system synthesized by the present invention and the control base editing system;
[0067] Figure 6 This is a graph showing the editing efficiency of the integrated PCSK9 adenine base editing system synthesized by the present invention and the control base editing system;
[0068] Figure 7 The integrated PCSK9 adenine base editing system synthesized by the present invention silences PCSK9 in liver cancer cells in vitro and then inoculates transplanted tumors to inhibit tumor growth in vivo;
[0069] Figure 8 The results of inhibiting the growth of liver cancer transplanted tumors after silencing PCSK9 by injecting the integrated PCSK9 adenine base editing system synthesized by the present invention into animals;
[0070] Figure 9 The integrated PCSK9 adenine base editing system synthesized by the present invention promotes CD8 + The result of T cell killing. DETAILED DESCRIPTION
[0071] To make the purpose, technical solutions, and advantages of the embodiments of the present invention more clear, the technical solutions in the embodiments of the present invention will be clearly and completely described below in conjunction with the accompanying drawings in the embodiments of the present invention. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without making creative efforts are within the scope of protection of the present invention.
[0072] As used herein, "and / or" includes any and all combinations of one or more of the associated listed items.
[0073] Herein, "plurality" means two or more than two, ie, it includes two, three, four, five, etc.
[0074] As used in this specification, the term "about" typically means + / - 5% of the stated value, more typically + / - 4% of the stated value, more typically + / - 3% of the stated value, more typically + / - 2% of the stated value, even more typically + / - 1% of the stated value, and even more typically + / - 0.5% of the stated value.
[0075] In this specification, certain embodiments may be disclosed in a format that is within a range. It should be understood that this description of "within a range" is merely for convenience and brevity and should not be interpreted as a rigid limitation on the disclosed range. Therefore, the description of a range should be considered to have specifically disclosed all possible subranges and individual numerical values within this range. For example, the description of a range of 1-6 should be considered to have specifically disclosed subranges such as from 1 to 3, from 1 to 4, from 1 to 5, from 2 to 4, from 2 to 6, from 3 to 6, etc., as well as individual numbers within this range, such as 1, 2, 3, 4, 5, and 6. Regardless of the breadth of the range, the above rules apply.
[0076] Some drawings are detailed:
[0077] Figure 5 In the figure, (A) Detection of cell transfection efficiency of the dual-plasmid system ABE8.2m-EGFP and LRC-PCSK9; (B) Detection of cell transfection efficiency of the single-plasmid system ABE-TBG-PCSK9; (C) Transfection efficiency statistics.
[0078] Figure 6 (A) shows the editing efficiency statistics of the single-plasmid system and the dual-plasmid system. (B) shows the silencing efficiency of the PCSK9 protein by the integrated PCSK9 adenine base editing system.
[0079] It is understandable that Figure 5 and Figure 6All of the above are base editing systems, including delivery vectors. However, NPs are not shown in the figures.
[0080] Figure 7 In the figure, (A) PCSK9 was silenced in mouse liver cancer H22 and Hepa1-6 cell lines in vitro using a liver-specific integrated PCSK9 adenine base editing system to construct a Balb / C transplant tumor model. The tumor volume was measured every other day and statistical analysis was performed. (B, C) Death was recorded and survival analysis was performed. When the time endpoint was reached, the transplanted tumor was dissected and weighed. (D) Flow cytometry analysis revealed changes in immune cells in the transplanted tumor. (E) Fluorescence staining was used to detect CD8 + Changes in T cell and cytokine expression.
[0081] Figure 8 (A) Balb / C transplant tumor model was constructed using mouse liver cancer H22 cells. When the tumor volume reached about 100 mm 3 At the end of the time period, the liver-specific integrated PCSK9 adenine base editing system was injected into the tail vein. (B, C) Tumor volume was measured every other day for statistical analysis. (D, E) Death was recorded for survival analysis. At the end of the time period, the transplanted tumor was dissected and weighed. (F) Flow cytometry analysis revealed changes in immune cells in the transplanted tumor. (G) Fluorescence staining was used to detect CD8 + Changes in T cell and cytokine expression.
[0082] Figure 9 (A) CD8 was observed by fluorescence microscopy. + Co-culture results of T cells with ABE-TBG-PCSK9-edited H22 liver cancer cells. (B) Cytotoxicity assay at different cell ratios.
[0083] Definition of noun:
[0084] The "integration" mentioned in the present invention refers to that a plasmid expression system of the present invention simultaneously expresses CRISPR / Cas9 protein and gRNA sequence targeting target DNA.
[0085] Example 1
[0086] This embodiment provides an example of an integrated PCSK9 adenine base editing system and its construction method.
[0087] The adenine base editing system provided in this embodiment includes the following:
[0088] (1) Single plasmid;
[0089] (2) PCSK9 adenine base editor;
[0090] (3) Delivery vehicle.
[0091] Among them, the PCSK9 adenine base editor includes U6 promoter structure, TBG promoter structure, AmpR promoter structure and plasmid backbone region.
[0092] It can be understood that a single plasmid plus a PCSK9 adenine base editor obtains a single-plasmid integrated adenine base editor (abbreviated as ABE-TBG-PCSK9); and then a delivery vector encapsulates the single-plasmid integrated adenine base editor to obtain an integrated PCSK9 adenine base editing system (abbreviated as ABE-TBG-PCSK9 NPs).
[0093] The U6 promoter structure includes the U6 promoter, gRNA targeting PCSK9, and a gRNA scaffold. Its function is to express the scaffold containing the gRNA targeting PCSK9, which then binds to the CRIPSR / Cas9 protein.
[0094] The TBG promoter structure contains the liver-specific TBG promoter, CRIPSR / Cas9 ABE protein, P2A fragment, and EGFP green fluorescent protein. Its function is to activate the CRIPSR / Cas9 ABE protein and EGFP protein through the promoter.
[0095] AmpR promoter structure: Contains the AmpR promoter and ORI structure. Its function is to screen bacterial strains expressing plasmids in amplification competence.
[0096] The U6 promoter structure, the TBG promoter structure, and the AmpR promoter structure were connected together.
[0097] In a specific embodiment, the synthesized single-plasmid integrated adenine base editor is 9014 bp in length and is referred to as ABE-TBG-PCSK9. Figure 1 .
[0098] Table 1 below shows the sequence information of the integrated PCSK9 adenine base editor in this example.
[0099] Table 1
[0100]
[0101]
[0102]
[0103]
[0104]
[0105]
[0106] Example 2
[0107] This example provides a specific preparation method for the integrated PCSK9 adenine base editing system synthesized in Example 1.
[0108] Unless otherwise specified, the experimental methods used in this example are all conventional methods. The materials, reagents, etc. used in the following examples, unless otherwise specified, can all be obtained from commercial channels.
[0109] 1. Example of the construction method of a single-plasmid integrated adenine base editor.
[0110] (1) Construction of plasmid “ABE8.2m-CMV-sgRNA”.
[0111] 1.1 Linearization of CRISPR / Cas9-EGFP fragment: Using the "ABE8.20m-EGFP" plasmid constructed independently in the laboratory as a template, the plasmid was linearized using the single-enzyme MfeI non-restriction endonuclease.
[0112] 1.2 Amplification of the U6 promoter-gRNA-gRNA scaffold fragment: Using the "LRC" plasmid as a template, primers were designed to amplify the U6 promoter-gRNA-gRNA scaffold fragment. Sticky ends complementary to the CRISPR / Cas9-EGFP fragment were added before and after the designed primers. The primers involved are as follows.
[0113] Table 2
[0114] SEQ ID Primers Sequence (5'-3') No. 29 Forward primer gcaaggcttgaccgacaattGGATCCgagggcctatttcccatgatt No. 30 Reverse primer agcagattcttcatgcaattCgaattcaaaaaagcaccgact
[0115] 1.3 Ligate the CRISPR / Cas9-EGFP linearized vector to the U6 promoter-gRNA-gRNA scaffold fragment.
[0116] Table 3
[0117]
[0118] 1.4 Transformation of DH5α Competent Bacteria (Takara #9057) with Plasmid Ligation: Thaw DH5α competent bacteria on ice. Pipette 5 μL of the ligated DNA from step 1.3 into 25 μL of competent bacteria and gently pipette several times. After 30 minutes on ice, heat shock the tube in a 42°C water bath for 60 seconds. Then quickly transfer the tube to an ice bath for 1-2 minutes. Add 200 μL of SOC medium or LB medium (without antibiotics) to the competent tube and shake at 37°C at 200 rpm for 1 hour to revive the bacteria. Centrifuge at 8000 rpm for 2 minutes. Spread the remaining 50 μL of the bacterial solution onto an LB plate (with antibiotics) and incubate inverted at 37°C overnight. Then, pick two to three colonies and add them to 1 mL of LB medium with antibiotics. Incubate the culture overnight at 37°C at 250 rpm with shaking. Submit for sequencing to verify successful ligation.
[0119] (2) Construction of plasmid “ABE-TBG-sgRNA”.
[0120] 2.1 Linearization of ABE-TBG-sgRNA fragment: Using the "ABE8.2m-CMV-sgRNA" plasmid as a template, the plasmid was linearized using the single restriction enzyme EcoRI and NotI non-restriction endonucleases.
[0121] 2.2 Synthesis of liver-specific promoter TBG promoter fragment: Using the "AAV-SaKKH TBG ABE8e-gRNAscaffold" plasmid as a reference, the TBG promoter was designed with sticky ends complementary to the linearized vector "ABE8.2m-CMV-sgRNA".
[0122] 2.3CRISPR / Cas9-EGFP linearized vector was linked to the U6 promoter-gRNA-gRNAscaffold fragment.
[0123] Table 4
[0124]
[0125] 2.4 Transform the ligated plasmid into DH5α competent cells (Takara #9057) using the same method as 1.4.
[0126] (3) Construction of plasmid “ABE-TBG-PCSK9”.
[0127] 3.1 Linearization of ABE-TBG-PCSK9 fragment: Using the "ABE8.2m-TBG-sgRNA" plasmid as a template, the plasmid was linearized using the double restriction site BsmBI non-restriction endonuclease.
[0128] 3.2 PCSK9 gRNA Synthesis: (i) PCSK9 gRNA was designed based on the GT site at the end of the first exon of PCSK9, with the sequence of SEQ ID NO. 31: 5′-GCCCATACCTTGGAGCAACGG-3′. (ii) PCSK9 gRNA was annealed.
[0129] Table 5
[0130] Reagents Dosage Sense F-gRNA oligo (diluted to 100 μM in ddH2O) 1 μL Antisense R-gRNA oligo (diluted to 100 μM in ddH2O) 1 μL T4 PNK (5' phosphatase) (NEB#M0201S) 0.5μL 10×T4 DNA Polynucleotide Kinase buffer(NEB#B0201S) 1 μL ddH2O 6.5 μL Total 10 μL
[0131] PCR reaction program: 37°C for 30 minutes, 95°C for 5 minutes, cooling at 1°C / min, 25°C, indefinite cycle. Alternatively, the sample can be placed directly in boiling water for 5 minutes, then cooled to room temperature. Store at -20°C. Dilute 4-fold with 30 μL of HO and store at 4°C until needed.
[0132] 3.3ABE-TBG-PCSK9 linearized vector is linked to PCSK9 gRNA.
[0133] Table 6
[0134]
[0135] 3.4 Transform the ligated plasmid into DH5α competent cells (Takara #9057) using the same method as 1.4.
[0136] 2. Example of construction of a delivery vector encapsulating a single-plasmid integrated adenine base editor.
[0137] It is understandable that other commercially available delivery vehicles can also be used to encapsulate single-plasmid integrated adenine base editors, such as liposome carriers.
[0138] This example proposes a nanocarrier encapsulating a single-plasmid integrated adenine base editor. The material constituting the nanocarrier includes a ROS-responsive vitamin E succinate polyethylene glycol 1000-polyethyleneimine polymer represented by the following formula: TPGS-TK-PEI, structural formula see Figure 2 The nanocarrier is constructed with vitamin E succinate polyethylene glycol 1000 as a hydrophobic end and polyethyleneimine as a hydrophilic end, with a ROS-sensitive thioketal linkage covalently linked in the middle. ABE-TBG-PCSK9 and TPGS-TK-PEI interact electrostatically to form the integrated PCSK9 adenine base editing system ABE-TBG-PCSK9 NPs. The TPGS-TK-PEI synthesis method is as follows:
[0139] (1) Synthesis of ROS-sensitive vitamin E succinate polyethylene glycol 1000 (TPGS-TK).
[0140] Propane-2,2-diylbis(thio)diacetic acid (abbreviated as TK) and amino polyethylene glycol 1000 vitamin E succinate (abbreviated as TPGS-NH2) undergo condensation acylation reaction under catalyst catalysis to obtain ROS-sensitive vitamin E succinate polyethylene glycol 1000 (abbreviated as TPGS-TK). Specifically: propane-2,2-diylbis(sulfide)diacetic acid (TK) and the catalyst system N-(3-dimethylaminopropyl)-N′-ethylcarbodiimide hydrochloride (EDC) / N-hydroxysuccinimide (NHS) are dissolved in N,N-dimethylformamide in a molar ratio of (1:1.2-5:1-5) (preferably 1:1.2:1.2), reacted at room temperature for 0.5-4 hours (preferably 0.5 hours), and amino polyethylene glycol 1000 vitamin E succinate (TPGS-NH2) is added, with a molar ratio of TK to TPGS-NH2 of 1:0.2-1 (preferably 1:0.5), reacted at room temperature for 12-24 hours (preferably 24 hours), dialyzed with water for 1-3 days, and the dialysate was freeze-dried to obtain ROS-sensitive vitamin E succinate polyethylene glycol 1000 (TPGS-TK).
[0141] (2) Synthesis of ROS-sensitive amphiphilic polymer (TPGS-TK-PEI).
[0142] ROS-sensitive vitamin E succinate polyethylene glycol 1000 (abbreviated as TPGS-TK) and polyethyleneimine polymer (abbreviated as PEI) undergo condensation acylation reaction under catalyst catalysis to obtain ROS-sensitive amphiphilic polymer (abbreviated as TPGS-TK-PEI). Specifically: TPGS-TK and the catalyst system N-(3-dimethylaminopropyl)-N′-ethylcarbodiimide hydrochloride (EDC) / N-hydroxysuccinimide (NHS) are dissolved in N,N-dimethylformamide in a molar ratio of (1:1.2-5:1-5) (preferably 1:1.2:1.2), reacted at room temperature for 0.5-4 hours (preferably 0.5 hours), and polyethyleneimine polymer (PEI) is added. The molecular weight of PEI is in the range of 600-25000 Da, preferably a branched polyethyleneimine polymer with a molecular weight of 25000 Da. The mass ratio of TPGS-TK to PEI is 1:1-10 (preferably 1:3), reacted at room temperature for 24-48 hours (preferably 48 hours), dialyzed with water for 1-3 days, and the dialysate was freeze-dried to obtain a ROS-sensitive amphiphilic polymer (TPGS-TK-PEI).
[0143] 5 mg of the synthesized ROS-sensitive amphiphilic polymer (TPGS-TK-PEI) was dissolved in 5 ml of deionized water and sonicated in a waterbath for 10 minutes to obtain self-organizing nanoparticles (NPs). The nanocarrier was then mixed with the single-plasmid integrated adenine base editor ABE-TBG-PCSK at a mass ratio of 2-10:1 (preferably 4:1). The mixture was allowed to stand at room temperature for 15 minutes to obtain the integrated PCSK9 adenine base editing system nanoparticles (ABE-TBG-PCSK9 NPs).
[0144] Horizontal gel electrophoresis was used to investigate the ability of the nanoparticles to load plasmids, a laser particle size analyzer was used to investigate the particle size and potential of the nanoparticles, and transmission electron microscopy was used to investigate the morphology of the nanoparticles. Horizontal gel electrophoresis results showed that a nanoparticle to plasmid mass ratio of 4:1 was sufficient to completely adsorb nucleic acids; the NPs had a particle size of 118.17±1.96nm, a PDI of 0.164±0.005, and a zeta potential of 26.33±0.45mV. After loading the plasmid, the ABE-TBG-PCSK9 NPs had a particle size of 141.13±2.32nm, a PDI of 0.171±0.036, and a zeta potential drop of 12.27±2.06mV. Transmission electron microscopy revealed that the ABE-TBG-PCSK9 NPs were spherical. The characterization of the relevant results is shown in the table. Figure 3 、 Figure 4 .
[0145] Table 7
[0146] Size (nm) PDI Zeta potential (mV) NPs 118.17±1.96 0.164±0.005 26.33±0.45 ABE-TBG-PCSK9 NPs 141.13±2.32 0.171±0.036 12.27±2.06
[0147] Among them, NPs represents TPGS-TK-PEI plasmid; ABE-TBG-PCSK9 NPs represents the integrated PCSK9 adenine base editing system.
[0148] Example 3
[0149] This example provides a comparative verification of the transfection efficiency of the integrated PCSK9 adenine base editing system (referred to as the single-plasmid system) and the dual-plasmid base editing system (referred to as the dual-plasmid system) synthesized in Example 2.
[0150] The dual-plasmid base editing system provided in this example consists of the "ABE8.20m-EGFP" plasmid, which has been reported to express the CRISPR / Cas9 ABE protein, and the "LRC-PCSK9" plasmid, which expresses the experimentally constructed PCSK9 gRNA. The sequence of the gRNA used in the "LRC-PCSK9" plasmid is shown in SEQ ID NO. 3. The "ABE8.20m-EGFP" in the dual-plasmid base editing system is 9297 bp long, and the "LRC-PCSK9" is 7393 bp long, which is close to the length of the single-plasmid system.
[0151] Experimental steps: 293FT cells were plated one day in advance, and 1×10 cells were transfected with the nanocarriers (NPs) synthesized in Example 2 for the single plasmid system and the double plasmid system, respectively. 6 For cells / ml of 293FT cells, the transfection dose for the dual-plasmid system is 0.5 μg of each plasmid, and the transfection dose for a single plasmid is 1 μg.
[0152] After 24 hours of transfection, the transfection efficiency was observed under a fluorescence microscope. The results showed that the integrated PCSK9 adenine base editing system had a higher transfection efficiency than the dual-plasmid system. Figure 5 (Among them, ABE8.2m-EGFP and LRC-PCSK9 represent the dual-plasmid system; ABE-TBG-PCSK9 represents the single-plasmid system). The yellow light in 5A represents the transfection efficiency of the dual-plasmid system into the cell, and the green light alone or the red light alone indicates no editing effect. The green light alone in 5B represents the transfection efficiency of the single-plasmid system into the cell. Obviously, the integrated PCSK9 adenine base editing system shows a higher fluorescence when entering the cell. 5C is a statistical graph of the transfection efficiency of the two systems; as can be seen in the figure, the transfection efficiency of the single-plasmid system is significantly higher than that of the dual-plasmid system.
[0153] Example 4
[0154] The integrated PCSK9 adenine base editing system synthesized in Example 2 efficiently edits the PCSK9 gene in vitro and silences PCSK9 protein expression in liver cancer cells.
[0155] 1. Screening of gRNA targeting PCSK9.
[0156] Experimental steps: Using a mouse or human genome as a template, design a PCSK9 gRNA at the 5'-GT-3' position at the end of the first exon of PCSK9, ensuring that the T in the GT is located between positions 3-8 of the gRNA to ensure the highest editing efficiency in vivo. (The gRNA design principle is to be between 17bp and 24bp in length)
[0157] Table 8 Screened mouse PCSK9 gRNA
[0158] SEQ ID Mouse gRNA gRNA sequence (5'-3') BP No. 12 mPCSK9-gRNA-1 ATACCTTGGAGCAACGG 17 No. 13 mPCSK9-gRNA-2 CATACCTTGGAGCAACGG 18 No. 14 mPCSK9-gRNA-3 CCATACCTTGGAGCAACGG 19 NO.3 mPCSK9-gRNA-4 CCCATACCTTGGAGCAACGG 20 No. 15 mPCSK9-gRNA-5 ACCCATACCTTGGAGCAACGG 21 No. 16 mPCSK9-gRNA-6 CACCCATACCTTGGAGCAACGG 22 No. 17 mPCSK9-gRNA-7 CCCATACCTTGGAGCAA 17 No. 18 mPCSK9-gRNA-8 ACCCATACCTTGGAGCAA 18 No. 19 mPCSK9-gRNA-9 CACCCATACCTTGGAGCAA 19
[0159] Table 9 Screened human PCSK9 gRNA
[0160] SEQ ID Human gRNA gRNA sequence BP NO.20 hPCSK9-gRNA-1 GCACCTTGGCGCAGCGG 17 No. 21 hPCSK9-gRNA-2 CGCACCTTGGCGCAGCGG 18 No. 22 hPCSK9-gRNA-3 CCGCACCTTGGCGCAGCGG 19 No. 23 hPCSK9-gRNA-4 CCCGCACCTTGGCGCAGCGG 20 No. 24 hPCSK9-gRNA-5 ACCCGCACCTTGGCGCAGCGG 21 No. 25 hPCSK9-gRNA-6 CACCCGCACCTTGGCGCAGCGG 22 No. 26 hPCSK9-gRNA-7 CCCGCACCTTGGCGCAG 17 No. 27 hPCSK9-gRNA-8 ACCCGCACCTTGGCGCAG 18 No. 28 hPCSK9-gRNA-9 CACCCGCACCTTGGCGCAG 19
[0161] The synthesized integrated PCSK9 adenine base editing system was transfected into mouse H22 liver cancer cells or human HepG2 liver cancer cell lines. After 72 hours, the cells were harvested and genomic DNA extracted. DNA fragments containing the editing sites were amplified by PCR and then sequenced. The editing efficiency of the editing sites was calculated using Moriarity Lab-Edit R software. The editing efficiency results are shown in the table below.
[0162] Table 10 Editing efficiency data
[0163]
[0164]
[0165] 2. The integrated PCSK9 adenine base editing system efficiently edits the PCSK9 gene in vitro.
[0166] The dual-plasmid system prepared in Example 3 was still used as a control. mPCSK9-gRNA-4 was selected as the research object to construct a dual-plasmid transfection editing system. The above-synthesized dual-plasmid system and the integrated PCSK9 adenine base editing system were transfected into the mouse liver cancer H22 cell line, and the cells were collected after 72 hours to extract genomic DNA. The DNA fragment containing the editing site was amplified by PCR, and then gene sequencing was performed. The editing efficiency of the editing site was calculated using Moriarity Lab-Edit R software. The editing results were analyzed, see Figure 6 A. The results showed that the integrated PCSK9 adenine base editing system of the present invention can significantly edit the editing site with an editing efficiency of 73±2.5%; the editing efficiency is much higher than that of the control dual-plasmid editing system, which has an editing efficiency of only 54±3.5%.
[0167] 3. Integrated PCSK9 adenine base editing system inhibits PCSK9 protein expression in vitro
[0168] Protein extraction of mouse liver cancer H22 cells transfected with the integrated PCSK9 adenine base editing system (all the following steps are performed on ice). 72 hours after transfection, the cells were collected, and cell lysis buffer (containing PMSF) was added. After blowing with a pipette tip or vortexing to mix, the cell resuspension was placed on ice for 30 minutes for cell lysis; ice was placed in a small beaker, the EP tube was placed on ice, and the ultrasonic disruptor mode was turned on for 5 seconds, off for 1 second, and repeated until the cells were broken for 1 minute. The broken cell solution was centrifuged at 13,000 rpm and 4°C for 10 minutes. Carefully remove the EP tube, gently take the supernatant into another clean EP tube labeled with the cell name and treatment conditions, and place it on ice for protein concentration determination.
[0169] The silencing efficiency of the integrated PCSK9 adenine base editing system on PCSK9 protein was further tested by Western blot. The results showed that after editing by the editing system, the protein expression of PCSK9 could be significantly silenced, with a silencing efficiency of nearly 60% ( Figure 6 B).
[0170] Example 5
[0171] Mouse H22 liver cancer cells edited in vitro with the integrated PCSK9 adenine base editing system also inhibited tumor growth in vivo. The integrated PCSK9 adenine base editing system (ABE-TBG-PCSK9 NPs) synthesized in Example 2 edited and silenced PCSK9 in vitro and then inoculated into liver cancer xenografts to verify the inhibition of tumor growth.
[0172] Experimental Procedure: H22 and Hepa1-6 cell lines transfected with ABE-TBG-PCSK9 NPs were used to establish subcutaneous xenograft tumor models in Balb / C or C57 mice, respectively. The survival of the mice was observed every other day, and changes in tumor volume were recorded. Tumor volume curves and xenograft weights showed that the integrated PCSK9 adenine base editing system significantly inhibited xenograft tumor growth and prolonged mouse survival ( Figure 7 AC). Flow cytometry analysis revealed that CD8 + The proportion of T cells increased significantly, and IFNγ + CD8 + T cells and GzmB + CD8 + The proportion of T cells increased significantly, Treg cells and PD1 + CD8 + There was no significant change in the proportion of T cells ( Figure 7 D) Fluorescence staining was used to detect CD8 + T cells, IFNγ + CD8 + T cells and GzmB + CD8 + The proportion of T cells increased significantly ( Figure 7 E).
[0173] The above results show that the integrated PCSK9 adenine base editing system ABE-TBG-PCSK9NPs constructed by the present invention can effectively silence PCSK9 in mouse liver cancer cells, and the edited liver cancer cells can promote CD8 + T cell tumor infiltration inhibits transplanted tumor growth and prolongs mouse survival.
[0174] Example 6
[0175] Tail vein injection of the integrated PCSK9 adenine base editing system (ABE-TBG-PCSK9 NPs) synthesized in Example 2 into the liver cancer transplant tumor model can silence PCSK9 and inhibit the growth of liver cancer transplant tumors.
[0176] Experimental steps: Use mouse liver cancer H22 cell line to establish subcutaneous transplant tumor model in Balb / C mice. 3 Balb / C mice were then randomly divided into two groups. Each group received an intravenous injection of ABE-TBG-PCSK9 NPs every three days. The mice were observed every other day for survival and changes in tumor volume were recorded. Tumor volume curves and transplanted tumor weights showed that ABE-TBG-PCSK9 NPs significantly inhibited transplanted tumor growth and prolonged mouse survival ( Figure 8 AE). Flow cytometry analysis revealed that CD8 + The proportion of T cells increased significantly, and IFNγ + CD8 + T cells and GzmB + CD8 + The proportion of T cells increased significantly, while the proportion of Treg cells did not change significantly ( Figure 8 F) Fluorescence staining was used to detect CD8 + T cell ratio, IFNγ + CD8 + T cells and GzmB + CD8 + The proportion of T cells increased significantly ( Figure 8 G).
[0177] The above results demonstrate that the integrated PCSK9 adenine base editing system constructed by the present invention can effectively silence PCSK9 in vivo and promote CD8 + T cell tumor infiltration inhibits transplanted tumor growth and prolongs mouse survival.
[0178] Example 7
[0179] Example 2 The integrated PCSK9 adenine base editing system ABE-TBG-PCSK9 NPs synthesized can promote CD8 + The killing effect of T cells.
[0180] Experimental steps: Examples 5 and 6 have demonstrated that ABE-TBG-PCSK9 NPs can promote the proliferation of mouse CD8 +This example further used calcein staining to stain the mouse liver cancer H22 cells transfected with ABE-TBG-PCSK9 NPs in vitro and then compared them with CD8 + Mouse liver cancer cells were stained with calcein and co-cultured with different mouse CD8 + After 48 hours of co-culture with T cells, the death of liver cancer cells was detected by fluorescence microscopy and fluorescence microplate reader. + The killing ability of T cells on H22 liver cancer cells Figure 9 AB).
[0181] It should be noted that, in this document, the terms "comprises," "includes," or any other variations thereof are intended to encompass non-exclusive inclusion, such that a process, method, article, or apparatus that includes a series of elements includes not only those elements but also other elements not explicitly listed, or elements inherent to such process, method, article, or apparatus. In the absence of further limitations, an element defined by the phrase "comprises a ..." does not exclude the presence of other identical elements in the process, method, article, or apparatus that includes the element.
[0182] The embodiments of the present invention are described above in conjunction with the accompanying drawings, but the present invention is not limited to the above-mentioned specific implementation methods. The above-mentioned specific implementation methods are merely illustrative and not restrictive. Under the guidance of the present invention, ordinary technicians in this field can also make many forms without departing from the scope of protection of the present invention and the claims, all of which are protected by the present invention.
Claims
1. An integrated PCSK9 adenine base editing system, characterized in that: Includes the following structures: (1) Single plasmid; (2) A PCSK9 adenine base editor, comprising a U6 promoter structure, a TBG promoter structure, an AmpR promoter structure, and a plasmid backbone region; Wherein, the U6 promoter structure contains a gRNA targeting PCSK9; the gRNA targeting PCSK9 is the sequence shown in SEQ ID NO.3; Wherein, the TBG promoter structure comprises a liver-specific TBG promoter sequence and a CRIPSR / Cas9 ABE protein; The AmpR promoter structure includes an AmpR promoter and an ORI structure; The U6 promoter structure includes a U6 promoter, a gRNA targeting PCSK9, and a gRNA core skeleton; The single plasmid and the PCSK9 adenine base editor form a single plasmid integrated adenine base editor; (3) Delivery vehicle; The integrated adenine base editor is encapsulated by the delivery vector to form the integrated PCSK9 adenine base editing system; The delivery carrier includes a nanocarrier, which is obtained by covalently linking a ROS-sensitive ketal thiol linker with vitamin E succinate polyethylene glycol 1000 as a hydrophobic end and polyethyleneimine as a hydrophilic end.
2. The integrated PCSK9 adenine base editing system according to claim 1, wherein: The liver-specific TBG promoter sequence is shown in SEQ ID NO.
5.
3. The integrated PCSK9 adenine base editing system according to claim 1, wherein: The nanocarrier and the single-plasmid integrated adenine base editor form a stable complex through electrostatic interaction.
4. The integrated PCSK9 adenine base editing system according to claim 3, wherein: The nanocarrier and the single-plasmid integrated adenine base editor are compounded at a mass ratio of 2-10:
1.
5. The integrated PCSK9 adenine base editing system according to claim 1, wherein: The delivery vehicles also include liposome vehicles.
6. Use of the integrated PCSK9 adenine base editing system according to any one of claims 1 to 5 in the preparation of liver cancer targeted preparations.
7. A combined drug combination for the treatment of targeted liver cancer, characterized in that: The combination drug comprises the integrated PCSK9 adenine base editing system and immune cells described in any one of claims 1-5.
8. The combined drug combination according to claim 7, characterized in that: The combined drug combination may also include other pharmaceutically feasible carriers and / or adjuvants.
Citation Information
Patent Citations
Base editing system based on bimolecular deaminase complementation and application thereof
CN114686456A
CRISPR / Cas9 delivery system and preparing method and application thereof
CN110215522A
Compositions and methods for targeting PCSK9
CN115427570A