Application of intervening B cell miR-330-5p in preparing medicament for treating SLE

Abstract

The present invention belongs to the field of biomedical technology and discloses the application of intervening in B cell miR-330-5p in the preparation of drugs for treating Systemic lupus erythematosus (SLE). The present invention applies miR-330-5p, mimics of miR-330-5p, and expression vectors of miR-330-5p to the preparation of drugs for preventing and / or treating SLE and drugs for inhibiting the activation of B cells in the SLE state. The present invention provides a new intervention target for inhibiting the activation of B cells and a new way and means for treating autoimmune diseases mediated by the activation of B cells.

Description

Technical Field

[0001] The present invention relates to the field of biomedical technologies, and particularly to the application of intervening B cell miR-330-5p in the preparation of drugs for treating SLE. Background Art

[0002] Systemic lupus erythematosus (SLE) is a typical autoimmune disease, the main feature of which is the disorder of the patient's own immune tolerance, resulting in the imbalance of various cellular immune responses in the body, such as the overactivation of immune cells and the production of a large number of autoantibodies, thus involving multiple organs and systems and causing diseases. In recent years, biotherapies centered on targeting B cell activation, including intervening in co-stimulatory molecules and activating factors on the B cell surface, interfering with the signal transduction function within B cells, and even eliminating B cells, etc., are the research focuses of current clinical trials. Although it can improve the condition of SLE to a certain extent, its non-specific interference with B cells often affects the normal immune system, limiting its clinical application.

[0003] The B-cell receptor (BCR) is crucial for the development and maturation of normal B cells. The mechanisms of BCR activation are diverse. KRAS is a member of the RAS family and plays an important role in signal transduction and cell cycle control. In the past, the clinical importance of KRAS has always been in the context of cancer, and it is considered to be closely related to the occurrence and development of cancer. Mutations in this gene exist in up to 25% of human cancers. It plays a key role in B cell development, proliferation and survival, and the lack of KRAS can seriously affect B cell development. However, with the progress of research, people have begun to find that KRAS also plays an important role in the progression of immune system diseases such as rheumatoid arthritis and SLE. MicroRNA (miRNA) is a kind of non-coding RNA widely existing in eukaryotes, and mainly regulates the expression of target genes through RNA processing after gene transcription. miRNA can inhibit the expression of a gene by complementary binding to the mRNA fragment of the target gene. miRNA participates in a variety of biological processes through the regulation of mRNA, including gene expression, cell differentiation, proliferation, apoptosis, immune regulation, etc., and plays an important role in the development of organisms, the occurrence and development of diseases, etc. Since there is currently no safe and effective scheme to inhibit the abnormal activation of B cells in SLE patients. Therefore, for the treatment of SLE, it is urgent to explore new targets to develop new safe and effective drugs and provide new ideas for the treatment of SLE. Summary of the Invention

[0004] The purpose of the present invention is to overcome the deficiencies of the prior art and provide the application of intervening B cell miR-330-5p in the preparation of drugs for treating SLE.

[0005] To achieve the above object, the technical solution adopted by the present invention is as follows:

[0006] In a first aspect, the present invention relates to the use of miR-330-5p in the preparation of a drug for preventing and / or treating SLE.

[0007] In a second aspect, the present invention relates to the use of a mimic of miR-330-5p in the preparation of a drug for preventing and / or treating SLE.

[0008] In a third aspect, the present invention relates to the use of an expression vector of miR-330-5p in the preparation of a drug for preventing and / or treating SLE.

[0009] As a preferred embodiment of the application described in the present invention, the miR-330-5p, or the mimic, or the expression vector is overexpressed in B cells; the miR-330-5p targets and inhibits KRAS in B cells.

[0010] In a fourth aspect, the present invention relates to the use of miR-330-5p in the preparation of a drug for inhibiting the activation of B cells in SLE.

[0011] In a fifth aspect, the present invention relates to the use of a mimic of miR-330-5p in the preparation of a drug for inhibiting the activation of B cells in SLE.

[0012] In a sixth aspect, the present invention relates to the use of an expression vector of miR-330-5p in the preparation of a drug for inhibiting the activation of B cells in SLE.

[0013] B cells play a key role in SLE. B cells can produce a large number of autoantibodies, which can affect multiple organs and systems and cause diseases, exacerbating the progression of SLE. The present invention takes B cells as the research object and finds that KRAS is highly expressed in activated B cell lines (U266 and Raji) and B cells of SLE patients, while miR-330-5p is weakly expressed in B cells of SLE patients. After overexpressing miR-330-5p (exogenous supplementation of miR-330-5p) in B cells of peripheral blood mononuclear cells (PBMC) of SLE patients and transplanting them into immunodeficient mice to construct a humanized SLE mouse model, it is found that the disease state of the humanized SLE mice can be significantly improved.

[0014] In a seventh aspect, the present invention provides a B cell for preventing and / or treating SLE, the B cell comprising miR-330-5p or its mimic and / or modified miR-330-5p, or a vector comprising miR-330-5p and / or modified miR-330-5p.

[0015] In an eighth aspect, the present invention provides a drug or preparation for preventing and / or treating SLE, the drug or preparation comprising a therapeutically effective dose of miR-330-5p or its mimic and / or modified miR-330-5p, or a vector comprising miR-330-5p and / or modified miR-330-5p, or the B cells as described above.

[0016] As a preferred embodiment of the drug or preparation according to the present invention, it further comprises pharmaceutically acceptable excipients.

[0017] Compared with the prior art, the beneficial effects of the present invention are as follows:

[0018] The present invention has confirmed that overexpression of miR-330-5p in B cells can target and bind to KRAS, inhibit B cell activation, and improve the progression of SLE disease, providing a new idea for the treatment of SLE disease mediated by B cell activation. miR-330-5p, the mimic of miR-330-5p, and the expression vector of miR-330-5p can be applied to the preparation of drugs for preventing and / or treating SLE and drugs for inhibiting B cell activation in SLE. The present invention provides a new intervention target for inhibiting B cell activation and a new approach and means for treating autoimmune diseases mediated by B cell activation. Description of the Drawings

[0019] Figure 1 It is a signal pathway diagram of B cell activation.

[0020] Figure 2 It is the detection of the signal pathway of B cell (U266 and Raji) activation.

[0021] Figure 3 It is the bioinformatics prediction that miR-330-5p targets and binds to KRAS.

[0022] Figure 4 is the detection of miR-330-5p targeting and binding to KRAS. In the figure, Figure 4A It is the information of the dual-luciferase reporter gene plasmid; Figure 4B It is the verification of miR-330-5p targeting and binding to KRAS by the dual-luciferase reporter gene; P<0.05 indicates significant difference, marked with *.

[0023] Figure 5 is the detection of the expression of miR-330-5p and KRAS in B cells of SLE patients. In the figure, Figure 5A It is the detection of the expression of miR-330-5p in B cells of SLE patients; Figure 5B It is the detection of the expression of KRAS in B cells of SLE patients; P<0.05 indicates significant difference, marked with *.

[0024] Figure 6Plasmid information for knocking down miR-330-5p.

[0025] Figure 7 Plasmid information for overexpressing miR-330-5p.

[0026] Figure 8 shows the effect of intervening miR-330-5p in B cells of SLE patients on their activation; in the figure, Figure 8A Flow cytometry was used to detect the expression level of CD80 after intervening miR-330-5p in B cells of SLE patients; Figure 8B Statistical analysis was performed on the expression level of CD80 after intervening miR-330-5p in B cells of SLE patients; Figure 8C Flow cytometry was used to detect the expression level of CD86 after intervening miR-330-5p in B cells of SLE patients; Figure 8D Statistical analysis was performed on the expression level of CD86 after intervening miR-330-5p in B cells of SLE patients; P<0.05 indicates significant difference, marked with *.

[0027] Figure 9 shows the effect of intervening miR-330-5p in B cells of SLE patients on the disease progression of humanized SLE mice; in the figure, Figure 9A Expression level of anti-nuclear autoantibodies in plasma of humanized SLE mice; Figure 9B Expression level of anti-dsDNA autoantibodies in plasma of humanized SLE mice; Figure 9C Ratio of white pulp in spleen of humanized SLE mice; P<0.05 indicates significant difference, marked with *. Detailed implementation manners

[0028] To better illustrate the purpose, technical solution and advantages of the present invention, the present invention will be further described below in conjunction with specific embodiments. Those skilled in the art should understand that the specific embodiments described herein are only used to explain the present invention and are not used to limit the present invention.

[0029] The experimental methods used in the examples are all conventional methods unless otherwise specified; the materials, reagents, etc. used are all commercially available unless otherwise specified.

[0030] Example 1: miR-330-5p targets and binds to KRAS in the B cell activation signaling pathway

[0031] (1) Construction of B cell (U266 and Raji) activation model

[0032] 1) Prepare complete medium in advance (10% FBS, 1% double antibody, RPMI 1640 medium). Take out B cell lines (U266 and Raji) from liquid nitrogen, quickly shake in a 37°C water bath. When the content in the cryopreservation tube completely changes from solid to liquid, take it out, dry it with a gauze piece, disinfect it with alcohol, and then put it into the laminar flow hood. Quickly transfer the cells in the cryopreservation tube to a 15 mL centrifuge tube, resuspend them to 5 mL with complete medium, and centrifuge (300 g, 6 min, room temperature). Remove the supernatant, resuspend with 2 mL PBS, wash, and centrifuge (300 g, 6 min, room temperature). Remove the supernatant, resuspend with complete medium, transfer the cells to a T25 culture flask, culture in 5% CO2 at 37°C for 24 h, then change the medium to remove dead cells. When the cell density grows to 80% - 90%, passage the cells. Detect cell viability: Take 10 μL of B cells into a 200 μL Ep tube, add 10 μL of trypan blue, gently pipette and mix with a 10 μL pipette tip, take 10 μL and detect cell viability in a counting chamber. When the cell viability reaches over 99% and the cell growth state is observed to be good under the microscope, continue with the subsequent experiments.

[0033] 2) Add anti-IgM (BCR activation pathway, the first-level signal for B cell activation in SLE patients), sCD40L (activating the co-stimulatory factor CD40 pathway for B cell activation, the second-level signal for B cell activation in SLE patients), and IL-4 (the third-level signal for B cell activation in SLE patients) to the cell culture medium. The usage concentration of anti-IgM is: 5 μg / mL, the usage concentration of sCD40L is: 100 ng / mL, and the usage concentration of IL-4 is: 10 ng / mL. After activating B cells (U266 and Raji), culture them in an incubator with 5% CO2 at 37°C for 48 h to construct an in vitro B cell activation model.

[0034] (2) Detection of KRAS expression in activated B cells (U266 and Raji)

[0035] Perform detection of the B cell activation pathway (see Figure 1 ) on the activated B cells in step (1):

[0036] 1) Extract RNA by the Trizol method

[0037] Seed the cells in a 6-well plate, culture in 5% CO2 at 37°C for 48 h. When the cells grow to 80% - 90%, collect the cells, centrifuge (300 g, 6 mim, room temperature), and remove the supernatant. After washing with PBS, transfer to a 1.5 mL Ep tube, centrifuge (300 g, 6 mim, room temperature), and remove the supernatant. For every 1×10 6Add 1 mL of RNAiso Plus to the cells and let it stand at room temperature for 10 min. Add BCP in a ratio of RNAiso Plus:BCP = 5:1, vortex vigorously for 15 s, mix well, and let it stand for 5 min. Centrifuge at 15000g at 4°C for 20 min. After centrifugation, an obvious stratification can be seen. Gently aspirate about 400 μL of the upper clear aqueous layer to a new 1.5 mL Ep tube with a pipette tip (note to avoid sucking the middle white membrane layer). Add isopropanol in a ratio of clear aqueous layer:isopropanol = 1:2, invert the tube up and down to mix well. Let it stand at 4°C for 30 min. Centrifuge at 15000g at 4°C for 20 min. Remove the supernatant, add 500 μL of 75% alcohol pre-cooled at 4°C, and gently pipette to suspend the precipitate. Centrifuge at 15000g at 4°C for 20 min. Repeat the step once. Remove the supernatant, place the EP tube in the laminar flow hood to air dry, and resuspend with 25 μL of DEPC water. Measure the concentration.

[0038] 2) Reverse transcription of mRNA

[0039] Kit: TAKARA Prime Script TM RT reagent Kit with gDNA Eraser(PerfectReal Time)

[0040] The reverse transcription system of mRNA is shown in Table 1:

[0041] Table 1 Reaction system for removing genomic DNA

[0042] Reagent Volume 5×gDNA Eraser Buffer 2.0 μL gDNA Eraser 1.0 μL Total RNA 0 μL - 7 μL <![CDATA[RNase Free dH2O]]> Up to 10 μL

[0043] Reaction conditions: 42°C, 2 min, 4°C;

[0044] In a 10 μL system, the amount of RNA should not exceed 1 μg.

[0045] Table 2 Reaction system for reverse transcription of mRNA

[0046] Reagent Volume Genomic DNA-removing reaction solution 10.0 μL PrimeScript RT Enzyme Mix I 1.0 μL RT Primer Mix 1.0 μL 5×PrimeScript Buffer 2 (for Real Time) 4.0 μL RNase Free dH2O 4.0 μL

[0047] Reaction conditions: 37°C, 15 min; 85°C, 5 s; 4°C.

[0048] 3) qPCR

[0049] Kit: TB Green Premix Ex Taq II(Tli RNaseH Plus), the qPCR reaction system using TB green dye method is as follows:

[0050] Table 3 Reaction system for qPCR

[0051] Reagent Final concentration Volume TB Green Premix Ex Taq II (Tli RNaseH Plus) (2×) 1× 5 μL PCR Forward primer (10 μM) 0.4 μM 0.4 μL PCR Reverse primer (10 μM) 0.4 μM 0.4 μL RT reaction solution 1 μL RNAse Free dH2O Up to 10 μL

[0052] Reaction conditions: In the first stage, pre-denaturation (1 cycle), 94 °C, 30 s; in the second stage, qPCR reaction (40 cycles), denaturation at 95 °C for 5 s; annealing and extension at 60 °C for 20 s.

[0053] 4) Primer sequences

[0054] Table 4 Primer sequences

[0055]

[0056]

[0057] The experimental results are shown in Figure 2 , and the KRAS expression in activated B cells (U266 and Raji) was significantly increased.

[0058] (3) Detection of miR-330-5p targeting and binding to KRAS

[0059] 1) Prediction of target genes of miR-330-5p was performed through bioinformatics databases such as miRDB, miRTar-Base, and TargetScan. Taking TargetScan as an example, the specific steps are as follows: Open the Targetscan website, select the corresponding species, fill in the gene name, input the miRNA name; click submit. If the gene has multiple transcripts, select the most commonly used transcript and click on the ID; all predicted miRNA information will be retrieved. The prediction results show that miR-330-5p can bind to the target gene KRAS ( Figure 3 ).

[0060] 2) Synthesize the wild-type target gene, and the gene sequence is as follows:

[0061] CCTAATTTTTTTCCTGCTCCATGCAGACTGTTAGCTTTTACCTTAAATGC

[0062] TTATTTTAAAATGACAGTGGAAGTTTTTTTTTCCTCTAAGTGCCAGTATTCC

[0063] CAGAGTTTTGGTTTTTGAACTAGCAATGCCTGTGAAAAAGAAACTGAATAC

[0064] CTAAGATTTCTGTCTTGGGGCTTTTGGTGCATGCAGTTGATTACTTCTTATTT

[0065] T;

[0066] Synthesize the mutant target gene, and the gene sequence is as follows:

[0067] CCTAATTTTTTTCCTGCTCCATGCAGACTGTTAGCTTTTACCTTAAATGC

[0068] TTATTTTAAAATGACAGTGGAAGTTTTTTTTTCCTCTAAGTGCCAGTATTAA

[0069] ACTCTTTTTGGTTTTTGAACTAGCAATGCCTGTGAAAAAGAAACTGAATAC

[0070] CTAAGATTTCTGTCTTGGGGCTTTTGGTGCATGCAGTTGATTACTTCTTATTT

[0071] T;

[0072] The dual-luciferase reporter plasmid GV272 was purchased from Shanghai Genechem Co., Ltd. (the plasmid map is shown in Figure 4A ); The wild-type target gene and the mutant target gene fragments were respectively ligated with the dual-luciferase reporter plasmid to construct recombinant vectors, which were denoted as WT (KRAS-WT-3'-UTR) and MUT (KRAS-MUT-3'-UTR) respectively.

[0073] Seed B cells evenly in a 24-well cell culture plate, and statically culture them with RPMI 1640 medium containing 10% fetal bovine serum. Transiently transfect B cells with Lipofectamine 2000 respectively. The experiment was divided into 4 groups: WT + miR-330-5p mimics group, WT + mimics negative control group, MUT + miR-330-5p mimics group, and MUT + mimics negative control group. 48 hours after transfection of B cells, the activities of Renilla luciferase and firefly luciferase were detected respectively, and the relative luciferase activity values were calculated. The dual-luciferase reporter gene was detected using the Dual-Luciferase Reporter Assay System kit. Take out the transfected B cells from the incubator, leave 75 μL of the original medium (discard the rest of the medium), and add 75 μL to each well Luciferase Reagent, mix well, and incubate for 10 min to allow the cells to lyse fully. Transfer the lysate to a 96-well plate and detect the firefly fluorescence in a multifunctional microplate reader. Then add 75 μL to each well Stop&Glo Reagent was mixed well and incubated for 10 min to detect Renilla fluorescence. The ratio of the results of two detections represented the relative fluorescence intensity of each well sample. The negative control for each group was 1. The relative fluorescence intensity of the mimics group was obtained and statistical analysis was performed.

[0074] The experimental results are shown in Figure 4B , compared with the wild-type plasmid (KRAS-WT-3'-UTR) + miR-NC group, the relative expression level of luciferase in the wild-type plasmid (KRAS-WT-3'-UTR) + miR-330-5p group was significantly decreased, and the difference was statistically significant (P < 0.001), indicating that miR-330-5p could bind to the 3'-UTR of wild-type KRAS and inhibit its expression; however, there was no significant difference in the relative expression level of luciferase between the mutant plasmid (KRAS-MUT-3'-UTR) + miR-NC group and the mutant plasmid (KRAS-MUT-3'-UTR) + miR-330-5p group, indicating that miR-330-5p could not bind to the 3'-UTR of mutant KRAS. The above results showed that miR-330-5p could target and bind to KRAS and inhibit its expression.

[0075] Example 2: B cells of SLE patients highly express KRAS and lowly express miR-330-5p

[0076] Clinical blood specimens were from SLE patients who were clearly diagnosed in the Affiliated Hospital of Guangdong Medical University from September 2023 to November 2024. Healthy volunteers were recruited and peripheral blood was drawn for the isolation of human peripheral blood B cells. This invention was reviewed and approved by the Ethics Committee of the Affiliated Hospital of Guangdong Medical University. The diagnosis of all enrolled SLE patients met the 1997 revised American College of Rheumatology (ACR) classification criteria; patients with other autoimmune diseases such as infection, hepatitis B, allergic diseases, rheumatoid arthritis, tumors, and other serious systemic diseases were excluded.

[0077] (1) Extraction of B cells from SLE patients

[0078] Extract PBS containing 2% FBS. Place the peripheral blood of SLE patients in an EDTA anticoagulant tube into a 50 mL centrifuge tube, and add PBS containing 2% FBS at a ratio of peripheral blood: PBS containing 2% FBS = 1:1, and mix well. Place lymphocyte separation medium in a 50 mL lymphatic vessel, and slowly add the mixed solution in step 2) above to the lymphocyte separation medium at a ratio of lymphocyte separation medium: peripheral blood: PBS containing 2% FES = 1:1:1 using a 1 mL pipette tip. Centrifuge at 800 g for 20 min at room temperature. After centrifugation, remove the upper plasma, and take the peripheral blood mononuclear cells (PBMC) in the cloudy layer into a new 50 mL centrifuge tube, and wash with 4 times the volume of PBS containing 2% FBS. Centrifuge at 3000 rpm for 10 min at room temperature to remove platelets. Remove the supernatant, and continue to resuspend and wash with PBS containing 2% FBS. Centrifuge at 1200 rpm for 10 min at room temperature. Remove the supernatant, resuspend the PBMC with 1 mL - 1.5 mL of PBS containing 2% FBS, and place it in a 5 mL flow tube. Count the cells and adjust the cell concentration to 5×107 cells / mL, add 50 μL of Cocktail Enhancer and Isolation Cocktail per milliliter, and let it stand at room temperature for 7 min, then add an equal volume of RapidSpheres TM (Vortex for 15 s in advance). Resuspend the PBMC with EasySep TM Buffer to 2.5 mL, immediately place the flow tube in a magnet, let it stand for 3 min, pour the liquid into a new flow tube, continue to place it in the magnet and let it stand for 1 min, and finally obtain B cells. Centrifuge at 300 g for 6 min at room temperature. Remove the supernatant and resuspend with 1 mL of culture medium.

[0079] Count and detect cell viability: Take 10 μL of B cells into a 200 μL Ep tube, add 10 μL of trypan blue, gently pipette and mix with a 10 μL pipette tip, take 10 μL and count and detect cell viability on a counting plate. When the cell viability reaches more than 95%, continue with the subsequent experiments.

[0080] (2) Detection of KRAS and miR-330-5p in B cells of SLE patients

[0081] 1) Take the B cells of SLE patients in (1) above for qPCR detection. The experimental method refers to step (2) of Example 1.

[0082] The experimental results are shown in Figure 5. B cells of SLE patients highly express KRAS and lowly express miR-330-5p. The above results indicate that miR-330-5p may be a potential target for the treatment of SLE.

[0083] Example 3: Intervention of miR-330-5p can inhibit the activation of B cells in SLE patients

[0084] (1) Preparation of miR-330-5p knockdown and overexpression plasmids: The miR-330-5p knockdown and overexpression plasmids were purchased from Guangzhou Aiji Biotechnology Co., Ltd. The plasmid map of the miR-330-5p knockdown plasmid is shown in Figure 6 , and the plasmid map of the miR-330-5p overexpression plasmid is shown in Figure 7 .

[0085] (2) Electroporation of B cells from SLE patients: Take 10 μl each of celetrix electroporation solution A and electroporation solution B, mix well, add B cells from SLE patients, and then add 2 μg / uL of miR-330-5p knockdown and overexpression plasmids respectively, and mix evenly. Then add the mixed solution into an electroporation tube with a volume of 20 μL, put the electroporation tube into the electroporation instrument, and set the electroporation parameters as 850 V and a duration of 20 ms.

[0086] (3) Culture the B cells of SLE patients with miR-330-5p knockdown and overexpression prepared in the above example (2) for 24 h.

[0087] (4) Detection of B cell activation level by flow cytometry:

[0088] 1) Extract the cultured B cells, add extracellular staining antibodies (see the following table), protect from light, incubate at 4 °C for 30 min, and then wash twice with PBS.

[0089] Table 5 Staining antibodies and incubation systems

[0090] Staining antibody Incubation system CD19 FITC (BD Biosciences, USA) 5 μL / 100 μL system CD80PE (BD Biosciences, USA) 5 μL / 100 μL system CD86BB700 (BD Biosciences, USA) 5 μL / 100 μL system

[0091] 2) Detection by flow cytometer: Resuspend the sample with 200 μL PBS (BD Biosciences, USA), and detect it using a BDFACS Celesta flow cytometer (BD Biosciences, USA).

[0092] The experimental results are shown in Figure 8. The expressions of CD80 and CD86 in the miR-330-5p overexpression group were significantly lower than those in the Control group and the miR-330-5p knockdown group of B cells from SLE patients. The above results indicate that overexpression of miR-330-5p in B cells of SLE patients inhibits B cell activation.

[0093] Example 4: Intervention of miR-330-5p in B cells of SLE patients improves the disease progression of humanized SLE mice

[0094] (1) Construction of humanized SLE mouse model

[0095] 1) NKG immunodeficient mice at 4 - 6 weeks of age were purchased from Cyagen Biosciences Inc. and randomly divided into a B cell miR-330-5p knockdown group (miR-330-5p KD ), a B cell miR-330-5p overexpression group (miR-330-5p OE ), and a control group transplanted with PBMC from SLE patients (Control). Cell transplantation was performed via the tail vein injection of mice in each group, and the number of transplanted cells was 1×10 7 cells / mouse.

[0096] 2) Peripheral blood was drawn from SLE patients, PBMC were isolated, and B cells were obtained (refer to Example 2). After separately knocking down and overexpressing miR-330-5p in the isolated B cells (refer to Example 3), the B cells were mixed with PBMC from which B cells had been removed and injected into NKG immunodeficient mice via the tail vein to construct a humanized SLE mouse model.

[0097] (2) Disease assessment of humanized SLE mice:

[0098] 1) The Roche cobas automatic biochemical analyzer was used to detect the plasma autoantibodies anti-nuclear Ab and anti-dsDNA Ab in humanized SLE mice.

[0099] 2) Pathological assessment of the spleen of humanized SLE mice: Deparaffinization: The slides were placed in xylene I for 20 min and xylene II for 20 min; the slides were placed in absolute ethanol I for 5 s, absolute ethanol II for 5 s → 95% ethanol I for 5 s, 95% ethanol II for 5 s → washed with water for 15 s; the slides were placed in hematoxylin staining solution and stained for 2 min → washed with water for 15 s × 2 → stained with 1% hydrochloric acid alcohol for 3 s → washed with water for 15 s → stained with 1% ammonia water for 3 s → washed with water for 15 s; the slides were placed in eosin staining solution and stained for 2 min → washed with water for 15 s → absolute ethanol for 2 s → dried, and sealed with neutral resin; photographed.

[0100] The experimental results are shown in Figure 9. In the miR-330-5p overexpression group, the plasma autoantibodies anti-nuclear Ab and anti-dsDNA Ab in humanized SLE mice were significantly lower than those in the Control group and the miR-330-5p knockdown group, and the proportion of white pulp (WP) in the spleen was significantly reduced. The above results indicate that overexpressing miR-330-5p in B cells of SLE patients improves the disease progression of humanized SLE mice.

[0101] In summary, the expression of KRAS is enhanced in activated B cell lines (U266 and Raji) and B cells of SLE patients, while the expression of miR-330-5p is decreased in B cells of SLE patients. Bioinformatics prediction reveals that miR-330-5p can target and bind to KRAS, and inhibit the activation of B cells. After overexpressing miR-330-5p in B cells of peripheral blood PBMCs from SLE patients and transplanting them into immunodeficient mice to construct a humanized SLE mouse model, it is found that the disease state of the humanized SLE mice can be significantly improved. This invention confirms that overexpressing miR-330-5p in B cells can target and bind to KRAS, inhibit B cell activation, and improve the progression of SLE disease, providing a new idea for the treatment of SLE disease mediated by B cell activation.

[0102] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention rather than to limit the protection scope of the present invention. Although the present invention has been described in detail with reference to the preferred embodiments, those of ordinary skill in the art should understand that the technical solutions of the present invention can be modified or equivalently replaced without departing from the essence and scope of the technical solutions of the present invention.

Claims

1. Use of miR-330-5p in the preparation of a medicament for preventing and / or treating SLE.

2. Use of an expression vector of miR-330-5p in the preparation of a medicament for preventing and / or treating SLE.

3. The application according to claim 1 or 2, characterized in that The miR-330-5p or the expression vector is overexpressed in B cells; the miR-330-5p targets and inhibits KRAS in B cells.

4. A B cell for preventing and / or treating SLE, characterized in that, The B cells contain miR-330-5p or an expression vector containing miR-330-5p.

Images