A nano-platform based on attenuated bacterial outer membrane vesicles and capable of co-delivery of siRNA and doxorubicin and a preparation method thereof

Abstract

The application belongs to the technical field of drug co-delivery, and particularly relates to a nano platform based on attenuated bacterial outer membrane vesicles and capable of realizing co-delivery of siRNA and doxorubicin and a preparation method thereof. msbB extraction and purification of OMVs; synthesis of a targeting functional unit DSPE-PEG 2k -Angiopep-2; and finally, a ROS-responsive co-delivery nano platform AO@PTP / 47aD is prepared. The co-delivery nano platform prepared in the application has a small particle size, a uniform morphology and high biological safety, and does not cause obvious damage to various tissues and organs. The co-delivery nano platform can be used as a general platform for gene delivery and also as an immune activator, is suitable for intravenous injection and can completely overcome the immune resistance of glioblastoma.

Description

Technical Field

[0001] This invention belongs to the field of drug co-delivery technology, specifically relating to a nanoplatform based on attenuated bacterial outer membrane vesicles that can achieve co-delivery of siRNA and doxorubicin, and its preparation method. Background Technology

[0002] Immunotherapy is considered one of the most promising cancer treatments. However, current immunotherapies for glioblastoma (GBM) have not shown significant survival benefits for patients. In addition to the blood-brain barrier (BBB) ​​barrier, GBM is classified as a highly "cold" tumor, characterized by both "high intrinsic immune resistance" and "high adaptive immune resistance." These two forms of immune resistance are intricately intertwined, collectively reducing the effectiveness of external immune interventions. In short, GBM's intrinsic immune resistance is primarily manifested by its extremely low immunogenicity, characterized by a lower tumor mutational burden (TMB) and reduced expression levels of the major histocompatibility complex (MHC). Conversely, adaptive immune resistance refers to GBM's immune evasion and suppression mechanisms, including the overexpression of multiple checkpoint ligands and the infiltration of immunosuppressive cells within the tumor microenvironment (TME). Elucidation of the mechanisms of GBM immune resistance suggests that synergistically overcoming intrinsic and adaptive immune resistance in GBM is crucial for enhancing the efficacy of immunotherapy, requiring the co-delivery of multiple immunotherapeutic agents and simultaneous modulation by different cells.

[0003] Reports indicate that doxorubicin (DOX) can significantly enhance tumor immunogenicity by inducing immunogenic cell death (ICD), thereby overcoming intrinsic immune resistance, and it is widely used in the treatment of GBM. Given the crucial role of glioma-associated microglia and macrophages (GAMs) in adaptive immune resistance, modulating their function can be used in immunotherapy strategies. Among these methods, small interfering RNA (siRNA) technology overcomes the limitations of current small-molecule inhibitors targeting checkpoints and has significant advantages over large-molecule antibodies in terms of precision, efficacy, safety, and ease of preparation. However, the short half-life and susceptibility to enzymatic degradation of siRNAs greatly limit their application. Utilizing positively charged materials to bind negatively charged siRNAs via electrostatic interactions is currently the most common strategy for protecting and delivering siRNAs. Among numerous cationic polymers, branched polyethyleneimine (PEI) with a molecular weight of 25 kDa is a suitable candidate. 25k PEI is considered the "gold standard" for gene delivery due to its extremely high transfection efficiency. However, due to its high molecular weight and extremely strong positive charge, PEI... 25kIt is not easily metabolized in vivo, thus accumulating and causing physiological toxicity. Although lower molecular weight PEIs have good biocompatibility, their insufficient surface positive charge density makes it difficult to protect and compress siRNA. Therefore, there is an urgent need for a strategy that can deliver siRNA efficiently while achieving good biocompatibility. In addition, the differences in the physicochemical properties of DOX and siRNA (including molecular weight, lipid solubility, and stability) also pose considerable challenges to the selection of vectors and the design of reasonable co-delivery systems.

[0004] Outer membrane vesicles (OMVs) are nanoscale, bilayered lipid vesicles spontaneously produced by Gram-negative bacteria. Similar to exosomes, OMVs can serve as natural carriers, effectively loading various drugs, including small-molecule hydrophobic chemotherapeutic agents and large-molecule gene therapies, while ensuring their stability and long circulation in vivo. Furthermore, OMVs inherit many immunogenic components from the outer membrane and periplasm of their parent bacteria, making them potential vaccines or immune adjuvants to stimulate the immune system and exert anti-tumor effects. Notably, there is currently no research on the potential of OMVs to enhance the immune response against GBM. More importantly, OMVs possess a unique natural advantage in treating GBM by crossing the BBB through various mechanisms (e.g., through the interaction between outer membrane proteins and gp96, and by hitching a ride on neutrophils). It should be noted that although OMVs are less toxic than directly using bacteria, the large amount of toxic substances they carry may still trigger a cytokine storm. Furthermore, although OMVs can increase BBB permeability to some extent under the action of lipopolysaccharide (LPS), this is based on disrupting the tight junctions within the BBB. Summary of the Invention

[0005] To address the aforementioned technical problems, this invention provides a nanoplatform based on attenuated bacterial outer membrane vesicles that enables the co-delivery of siRNA and doxorubicin, and its preparation method.

[0006] To achieve the above-mentioned objectives, the present invention provides the following technical solution:

[0007] A method for preparing a nanoplatform based on attenuated bacterial outer membrane vesicles and capable of co-delivering siRNA and doxorubicin includes the following steps:

[0008] (1) Preparation of crosslinked compounds

[0009] S1. The reactive oxygen species (ROS) responsive linker 3-(propane-2,2-diylbis(thionyl))dipropionic acid (TK-COOH) and an amidation reagent were dissolved in an organic solvent, and the carboxyl group was activated at room temperature for 2 h under inert gas protection to obtain the activated ROS responsive linker.

[0010] S2. The activated ROS-responsive linker is combined with branched polyethyleneimine (PEI) with a molecular weight of 1800. 1.8k ) are dissolved separately in organic solvents, and PEI is disposed of under inert gas protection. 1.8k The solution was slowly added dropwise to the activated ROS-responsive linker solution. After reacting at room temperature for 22-24 h, the reaction solution was transferred to a dialysis bag and then dialyzed in deionized water until the organic solvent and impurities were completely removed. The liquid in the dialysis bag was filtered through a membrane and then lyophilized to obtain the crosslinked product. The reaction process is shown in Formula I:

[0011] ;

[0012] (2) The cross-linked material and polyethylene glycol (PEG) with succinimide esters at the ends and a molecular weight of 3500 are combined. 3.5k -NHS) was dissolved in PBS solution and reacted at room temperature for 6-24 h under inert gas protection. The reaction solution was then transferred to a dialysis bag and dialyzed in deionized water until all impurities were removed. The liquid in the dialysis bag was filtered through a membrane and then lyophilized to obtain the cationic polymer. The reaction process is shown in Formula II:

[0013] ;

[0014] (3) The aptamer and DOX were dissolved in ultrapure water treated with diethyl pyrocarbonate (DEPC) and sterilized by high temperature and high pressure. After mixing and blowing evenly under an enzyme-free environment, they were incubated at room temperature for 1 to 2 hours to prepare the aptamer-doxorubicin complex (aptamer-DOX). The reaction process is shown in Formula III:

[0015] ;

[0016] (4) Dissolve the aptamer-DOX, siRNA, and cationic polymer shown in step (1) in DEPC water. Mix the siRNA and aptamer-DOX with the cationic polymer separately under an enzyme-free environment. Then rapidly combine the two systems and vortex for 10-60 s. After that, let it stand on an ice-water bath for 20-40 min to obtain positively charged nanocores. The reaction process is shown in Formula IV:

[0017] ;

[0018] (5) Add LB medium to the Erlenmeyer flask and inoculate the knockout flask. msbB E. coli BL21 (Δ gene) msbBE. coliBL21), after being shaken on an air shaker for a period of time, the bacterial cells were removed by centrifugation and filtration. The filtrate was concentrated by ultrafiltration and then subjected to ultrafiltration to obtain Δ msbB OMVs, using phosphate-buffered saline (PBS) to treat Δ msbB OMVs are repeatedly washed to remove Δ msbB OMVs are resuspended in deionized water, and the reaction process is shown in Equation V:

[0019] ;

[0020] (6) Combine the positively charged nanonucleus described in step (4) with the Δ nanonucleus described in step (5). msbB After mixing, OMVs are ultrasonically disrupted in an ultrasonic disruptor to prepare coated nanoparticles, and the reaction process is shown in Formula VI:

[0021] ;

[0022] (7) The amphiphilic block copolymer (DSPE-PEG) with maleimide and a PEG molecular weight of 2000 is used. 2k -Mal) and the targeting functional peptide Angiopep-2 were dissolved in an organic solvent and reacted at room temperature for 20-24 h under inert gas protection. The reaction solution was then transferred to a dialysis bag and dialyzed in deionized water until the organic solvent and impurities were completely removed. The liquid in the dialysis bag was then freeze-dried to obtain the targeting functional unit DSPE-PEG. 2k -Angiopep-2, the reaction process is shown in equation VII:

[0023] ;

[0024] (8) The targeted functional unit DSPE-PEG described in step (7) 2k -Angiopep-2 was dissolved in an organic solvent, and then mixed with the coated nanoparticles described in step (6), and co-incubated for 0.5 ~ 1 h to prepare a co-delivery nanoplatform. The reaction process is shown in formula VIII:

[0025] .

[0026] Preferably, the amidation reagent in step (1) S1 is a mixture of 1-ethyl-(3-dimethylaminopropyl)carbodiimide hydrochloride (EDC·HCl) and N-hydroxysuccinimide (NHS); the molar ratio of TK-COOH, EDC·HCl and NHS is 2:5:5.

[0027] Preferably, the organic solvent in step (1) S1 is anhydrous N'N-dimethylformamide (DMF).

[0028] Preferably, the organic solvent in step (1) S2 is anhydrous DMF.

[0029] Preferably, in step (1) S2, PEI 1.8k The molar ratio with TK-COOH is 5:2.

[0030] Preferably, in step (1) S2, PEI 1.8k The dripping rate of the activated ROS-responsive linker was 1 mL / min.

[0031] Preferably, in step (1) S2, the dialysis bag is made of regenerated cellulose with a molecular weight cutoff of 8000; the total dialysis time is 48 h and the dialysis solution is replaced every 8 h.

[0032] Preferably, the pore size of the filter membrane selected during filtration in step (1) S2 is 450 nm.

[0033] Preferably, in step (2), the crosslinker and PEG 3.5k The molar ratio between -NHS is 1:1.

[0034] Preferably, in step (2), the concentration of the PBS solution is 2 mol / L, the pH is 7.4, and the PEG is... 3.5k The concentration of -NHS in PBS solution was 2.4 mg / mL.

[0035] Preferably, in step (2), the dialysis bag is made of regenerated cellulose with a molecular weight cutoff of 8000; more preferably, the total dialysis time is 24 h and the dialysis fluid is replaced every 8 h.

[0036] Preferably, the pore size of the filter membrane selected during filtration in step (2) is 220 nm.

[0037] Preferably, the sequences of the two DNA single strands that make up the ATP-responsive aptamer in step (3) are ACCTGGGGGAGTATTGCGGAGGAAGGT and ACCTTCCTCCGCAATACTCCCCCAGGT, respectively.

[0038] Preferably, in step (3), DOX is in desalted form; the molar ratio between aptamer and DOX is 1:16.

[0039] Preferably, in step (4), the mass ratios of siRNA and aptamer-DOX to the cationic polymer are 1:2 and 1:1.88, respectively; the molar ratio of siRNA to aptamer-DOX is 1:1.82.

[0040] Preferably, the ratio between the volume of LB culture medium and the volume of the Erlenmeyer flask in step (5) is 1:5.

[0041] Preferably, in step (5), Δ msbBE. coli The vaccination rate for BL21 is 1%.

[0042] Preferably, the conditions for shaking in step (5) are 220 rpm and 37 °C, and the shaking time is 18 h.

[0043] Preferably, the centrifugation conditions in step (5) are 4000 g, 25 °C, 10 min, and a total of 2 centrifugations; the pore size of the filter membrane selected to remove the bacteria is 450 nm.

[0044] Preferably, the ultrafiltration conditions in step (5) are 3500 rpm and 4 °C.

[0045] Preferably, the conditions for the excision in step (5) are 150,000 g, 4 °C, and 2 h.

[0046] Preferably, in step (5), the concentration of the PBS solution is 0.1 mol / L and the pH is 7.4; using PBS to treat Δ msbB OMVs should be washed at least 3 times.

[0047] Preferably, in step (6), the positively charged nanonucleus and Δ msbB The mass ratio between OMVs was 1:2; the ultrasound program was set as follows: power 324 watts, working time 99 s, stop time 10 s, total duration 2 min, temperature maintained at 4 °C.

[0048] Preferably, in step (7) DSPE-PEG 2k The molar ratio between -Mal and Angiopep-2 is 1:3.

[0049] Preferably, the organic solvent in step (7) is anhydrous dimethyl sulfoxide (DMSO).

[0050] Preferably, in step (7), the dialysis bag is made of regenerated cellulose with a molecular weight cutoff of 3500; more preferably, the total dialysis time is 48 h and the dialysis solution is replaced every 12 h.

[0051] Preferably, the organic solvent in step (8) refers to DMSO.

[0052] Preferably, in step (8), the concentration of Angiopep-2 in DMSO is 2 mg / mL; the Δ content of the coated nanoparticles is... msbBThe mass ratio of OMVs to Angiopep-2 contained in the target functional unit was 20:1; the co-incubation temperature was 37 °C.

[0053] The room temperature mentioned in this invention refers to 25 °C; the inert gas refers to argon; and the enzyme-free environment means that the surrounding environment, as well as the EP tubes and pipette tips used, do not contain RNase or DNase.

[0054] The present invention also provides a nanoplatform based on attenuated bacterial outer membrane vesicles prepared by the above method, which can achieve co-delivery of siRNA and doxorubicin, wherein the diameter of the nanoplatform is 80-100 nm.

[0055] The nanoplatform prepared in this invention is composed of modularly assembled components. Inspired by the interaction between DOX and DNA, DOX is loaded and modified into a "gene therapy" using an ATP-responsive aptamer; then, PEI is connected via a ROS-responsive linker. 1.8k Crosslinking and modification with polyethylene glycol yielded a water-soluble cationic polymer; subsequently, this cationic polymer was used to simultaneously compress siRNA and aptamer-DOX via electrostatic interactions to obtain a nanocore; further, Δ was introduced through engineering techniques. msbBE. coli BL21 was extracted and purified from this attenuated Escherichia coli to obtain Δ msbB OMVs, using ultrasound to deliver Δ msbB OMVs are encapsulated on the surface of the nanocore; finally, the targeted functional peptide Angiopep-2 is inserted into the Δ through lipid fusion. msbB The final co-delivery nanoplatform was prepared on OMVs.

[0056] This invention introduces Angiopep-2 into a co-delivery nanoplatform, which can assist the nanoplatform in continuously achieving BBB crossing and GBM targeting; while Δ msbB OMVs not only shield the positive charge on the surface of the nanocore, improving its stability, but their engineered detoxification design also enhances the biosafety of the nanoplatform, avoiding systemic cytokine storms caused by strong toxicity. Furthermore, and more importantly, Δ msbBOMVs retain some immunostimulatory capabilities; certain immunogenic substances they contain can act as adjuvants to promote GAMs transformation. When the nanoplatform is taken up by GBM cells and enters the cell, the positively charged nanocore can rapidly escape lysosomes through a proton sponge effect. Under the influence of high intracellular ROS concentrations, the cationic polymer disintegrates, releasing compressed aptamer-DOX and siRNA. The siRNA binds to the corresponding mRNA to exert a gene silencing effect, thereby reducing checkpoint expression levels. The aptamer-DOX further releases its loaded DOX under the action of ATP to induce ICD. The disintegrated PEI... 1.8k The reduced positive charge density weakens its cytotoxicity, and its smaller molecular weight also allows for easier metabolism and clearance by the body. This co-delivery nanoplatform provides a paradigm and new insight for the immunotherapy of GBM.

[0057] Compared with the prior art, the effective effects of the present invention include:

[0058] (1) The co-delivery nanoplatform prepared by this invention has a small particle size and uniform morphology, and the Δ can be clearly seen. msbB OMVs are characterized by encapsulating a positively charged core.

[0059] (2) The co-delivery nanoplatform prepared in this invention has high biosafety and causes no significant damage to any tissues or organs. Wherein Δ msbB OMVs reduce toxic side effects due to the reduction of endotoxins. On the other hand, cross-linked cationic polymers can rapidly disintegrate into small positively charged molecular units under the action of ROS, and then be rapidly metabolized and excreted.

[0060] (3) The co-delivery nanoplatform prepared in this invention can serve as both a general gene delivery platform and an immune activator, suitable for intravenous administration and capable of overcoming the immune resistance of glioblastoma. This co-delivery nanoplatform can continuously cross the BBB and target GBM with the help of Angiopep-2. When taken up by GBM cells, the positively charged nanocore can rapidly escape lysosomes by inducing the proton sponge effect. Under the action of high concentration of ROS in the cell, the cationic polymer disintegrates and releases the compressed aptamer-DOX and siRNA. The siRNA binds to the corresponding mRNA to play a gene silencing role, thereby reducing the expression level of checkpoints. The aptamer-DOX further releases the loaded DOX under the action of ATP to induce ICD. In addition, during the enrichment process into the GBM lesion area, Δ msbB Certain immunogenic substances on OMVs can also initiate the reprogramming of GAMs, thereby exerting their anti-tumor immune effects. Attached Figure Description

[0061] Figure 1 PEG is a ROS-responsive cationic polymer. 3.5k -TK-PEI 1.8k Synthetic route of (PTP);

[0062] Figure 2 A schematic diagram of loading DOX into an ATP-responsive aptamer to form an aptamer-DOX;

[0063] Figure 3 Simultaneous compression of Si for PTP Cd47 Forming ROS-responsive positively charged nanocore PEG with aptamer-DOX 3.5k -TK-PEI 1.8k / si Cd47 A schematic diagram of &aptamer-DOX (PTP / 47aD);

[0064] Figure 4 To from Δ msbBE. coli Extraction and purification of Δ from BL21 msbB A schematic diagram of OMVs;

[0065] Figure 5 For the targeted functional unit DSPE-PEG 2k - Synthetic route of Angiopep-2;

[0066] Figure 6 For Δ msbB OMVs encapsulate the ROS-responsive positively charged nanocore PTP / 47aD and modify it with the targeting peptide Angiopep-2 to construct the ROS-responsive co-delivery nanoplatform Angiopep-2-OMVs@PEG. 3.5k -TK-PEI 1.8k / si Cd47 A schematic diagram of &aptamer-DOX (AO@PTP / 47aD);

[0067] Figure 7 PEG is a ROS-nonresponsive cationic polymer. 3.5k -AA-PEI 1.8k Synthetic route of (PAP);

[0068] Figure 8 Angiopep-2-OMVs@PEG, a non-responsive ROS co-delivery nanoplatform 3.5k -AA-PEI 1.8k / si Cd47 A schematic diagram of the aptamer-DOX (AO@PAP / 47aD) build process;

[0069] Figure 9 To investigate the changes in DOX fluorescence intensity after co-incubation of ATP-responsive aptamer with different concentrations of DOX;

[0070] Figure 10 To investigate the recovery of DOX fluorescence intensity after co-incubation of aptamer-DOX with different concentrations of ATP;

[0071] Figure 11 ROS-responsive positively charged nanonuclei PTP / 47aD and ROS-non-responsive positively charged nanonuclei PEG 3.5k -AA-PEI 1.8k / si Cd47 A schematic diagram illustrating the disintegration or stability of aptamer-DOX (PAP / 47aD) under the influence of intracellular ROS.

[0072] Figure 12 The dynamic light scattering particle size changes after ROS-responsive positively charged nanonuclei PTP / 47aD and ROS-non-responsive positively charged nanonuclei PAP / 47aD were co-incubated with different concentrations of hydrogen peroxide (H2O2) at 37 °C for different times.

[0073] Figure 13 Dynamic light scattering particle size, polydispersity index (PDI), and potential distribution of the ROS-responsive co-delivery nanoplatform AO@PTP / 47aD;

[0074] Figure 14 ROS-responsive positively charged nanonuclei PTP / 47aD, Δ msbB Transmission electron microscopy images of OMVs and the ROS-responsive co-delivery nanoplatform AO@PTP / 47aD;

[0075] Figure 15 For ROS-responsive co-delivery nanoplatform AO@PTP / 47aD, Si Cd47 With Δ msbB An examination of OMVs co-location;

[0076] Figure 16 The dynamic light scattering particle size and PDI changes of the ROS-responsive co-delivery nanoplatform AO@PTP / 47aD after 7 days of storage in PBS at 7.4 and 4 °C;

[0077] Figure 17 To investigate the uptake pathway of the ROS-responsive co-delivery nanoplatform AO@PTP / 47aD by G422 cells;

[0078] Figure 18 To investigate the intracellular fate of the ROS-responsive co-delivery nanoplatform AO@PTP / 47aD after uptake by G422 cells;

[0079] Figure 19 AO@PTP / 47aD, a ROS-responsive co-delivery nanoplatform, and Angiopep-2-OMVs@PEG, a DOX-free ROS-responsive nanoplatform. 3.5k -TK-PEI 1.8k / si Cd47 Investigation on the effects of AO@PTP / 47a and the ROS-nonresponsive co-delivery nanoplatform AO@PAP / 47aD on calreticulin (CRT) exposure and high-mobility group box 1 (HMGB1) nuclear translocation in G422 cells;

[0080] Figure 20 The DOX-free ROS-responsive nanoplatform AO@PTP / 47a and the DOX-free ROS-non-responsive nanoplatform Angiopep-2-OMVs@PEG 3.5k -AA-PEI 1.8k / si Cd47 An investigation into the knockout efficiency of CD47 in G422 cells using aptamer (AO@PAP / 47a);

[0081] Figure 21 For ROS-responsive co-delivery nanoplatform AO@PTP / 47aD and Δ msbB An investigation into how OMVs promote the transformation of BV2 cells and bone marrow-derived macrophages (BMDMs). Detailed Implementation

[0082] The present invention will be further described below with reference to specific embodiments and comparative examples, and the advantages and features of the present invention will become clearer with the description. However, the embodiments and comparative examples are merely exemplary and do not constitute any limitation on the scope of the present invention. Those skilled in the art should understand that modifications or substitutions can be made to the details and form of the technical solutions of the present invention without departing from the spirit and scope of the present invention, but all such modifications and substitutions fall within the protection scope of the present invention.

[0083] Example 1

[0084] A method for preparing a nanoplatform based on attenuated bacterial outer membrane vesicles that enables co-delivery of siRNA and doxorubicin:

[0085] (1) Synthesis of ROS-responsive cationic polymer PTP

[0086] according to Figure 1The synthetic route involved dissolving 115 mg EDC·HCl (0.6 mmol), 69 mg NHS (0.6 mmol), and 60.48 mg TK-COOH (0.24 mmol) in 2 mL of anhydrous DMF, respectively. The mixture was then reacted at room temperature for 2 h under argon protection. Afterwards, 1 g of PEI was... 1.8k (1 mmol) was dissolved in 10 mL of anhydrous DMF and slowly added dropwise to the above reaction system at a rate of 1 mL / min. After reacting at room temperature for 22 h, the reaction solution was transferred to an 8K regenerated cellulose dialysis bag and dialyzed with pure water for 48 h (the dialysis solution was changed every 8 h). Finally, the liquid in the dialysis bag was filtered through a 450 nm filter membrane and then lyophilized to obtain a transparent gel-like liquid, which is the ROS-responsive crosslinker TK-PEI. 1.8k (TP).

[0087] 12.48 mg TP (1.35 μmol) was mixed with 4.72 mg PEG. 3.5k -NHS (1.35 μmol) was dissolved in 2 mL of 20×PBS (pH 7.4), and the mixture was reacted at room temperature for 6 h under argon protection. The reaction solution was then transferred to an 8K regenerated cellulose dialysis bag and dialyzed with pure water for 24 h (the dialysis solution was changed every 8 h). Finally, the liquid in the dialysis bag was filtered through a 220 nm filter membrane and lyophilized to obtain a white flocculent solid, which was the ROS-responsive cationic polymer PTP.

[0088] (2) Preparation of aptamer-DOX

[0089] according to Figure 2 The synthetic route involved dissolving desalted DOX and ATP-responsive aptamer in DEPC water under an enzyme-free environment to prepare concentrations of 320 μmol / L and 200 μmol / L, respectively. 400 μL of DOX solution was mixed with 40 μL of ATP-responsive aptamer solution and gently blown to mix. After standing at room temperature for 2 h, aptamer-DOX was obtained.

[0090] (3) Preparation of ROS-responsive positively charged nanonuclei PTP / 47aD

[0091] according to Figure 3 The synthetic route, under enzyme-free conditions, combines ROS-responsive cationic polymers PTP and Si... Cd47(siRNA targeting and silencing CD47 protein) and aptamer-DOX were dissolved in DEPC water to prepare concentrations of 5.28 mg / mL, 0.528 mg / mL (40 μmol / L), and 0.459 mg / mL (18.18 μmol / L), respectively. 40 μL of aptamer-DOX solution and 10 μL of siRNA were then mixed. Cd47 The solution was mixed with 6.54 μL and 2 μL of PTP solution respectively, and then the two were quickly combined into the same system. After vortexing for 30 s, the solution was placed on ice and allowed to stand for 30 min to obtain ROS-responsive positively charged nanonuclei PTP / 47aD.

[0092] (4) Δ msbB Extraction and purification of OMVs

[0093] according to Figure 4 The synthetic route involved adding 200 mL of LB medium to a 1 L Erlenmeyer flask and then adding 2 mL of Δ... msbBE. coli BL21 bacterial culture (strain purchased from Baosai Plasmid & Strains Company). The culture was incubated on an air shaker at 220 rpm and 37 °C for 18 h, followed by centrifugation (4000 g, 25 °C, 10 min, twice) and filtration through a 450 nm filter to remove bacterial cells. The filtrate was concentrated to 50 mL by ultrafiltration (3500 rpm, 4 °C) using a 100 kDa ultrafiltration tube, and then centrifuged at ultra-high speed (150000 g, 4 °C, 2 h) to obtain Δ. msbB OMVs were precipitated and washed three times with 1×PBS (pH 7.4). The final wash removed Δ... msbB OMVs precipitate was resuspended in deionized water.

[0094] (5) Targeting functional unit DSPE-PEG 2k -Angiopep-2 Synthesis Route

[0095] according to Figure 5 The synthetic route involved combining 10 mg Angiopep-2 (4.159 μmol) with 4.02 mg DSPE-PEG. 2k -Mal (1.386 μmol) was dissolved in 2 mL of anhydrous DMSO and reacted at room temperature for 24 h under argon protection. The reaction solution was then transferred to a dialysis bag containing regenerated cellulose with a molecular weight cutoff of 3500 and dialyzed with pure water for 48 h (the dialysate was changed every 12 h). Finally, the liquid in the dialysis bag was freeze-dried to obtain a white solid, which is the targeted functional unit DSPE-PEG. 2k -Angiopep-2.

[0096] (6) Preparation of ROS-responsive co-delivery nanoplatform AO@PTP / 47aD

[0097] according to Figure 6 The synthetic route involved mixing 63 μL of a 1.174 mg / mL ROS-responsive positively charged nanocore PTP / 47aD solution with 125.32 μL of a 1.18 mg / mL Δ msbB After mixing the OMVs solution and gently blowing it evenly, the mixture was placed in an ultrasonic homogenizer for ultrasonic treatment (ultrasonic program set to power 324 watts, working for 99 s, stopping for 10 s, for a total duration of 2 min, with the temperature maintained at 4 °C), thus obtaining ROS-responsive coated nanoparticles OMVs@PEG. 3.5k -TK-PEI 1.8k / si Cd47 &aptamer-DOX(O@PTP / 47aD).

[0098] Targeting functional unit DSPE-PEG 2k -Angiopep-2 was dissolved in DMSO to a concentration of 2 mg / mL. Then, 1.68 μL was added to 188.32 μL of freshly prepared ROS-responsive coated nanoparticle O@PTP / 47aD solution. After gently mixing, the system was incubated in a 37 °C water bath for 30 min to obtain the final ROS-responsive co-delivery nanoplatform AO@PTP / 47aD.

[0099] Compare with Example 2

[0100] A method for preparing a nanoplatform based on attenuated bacterial outer membrane vesicles that enables co-delivery of siRNA and doxorubicin:

[0101] The desalted doxorubicin solution in Example 1 was replaced with pure DEPC water, and the other steps were the same as in Example 1. The resulting DOX-free ROS-responsive co-delivery nanoplatform was denoted as AO@PTP / 47a.

[0102] Compare with Example 3

[0103] A method for preparing a nanoplatform based on attenuated bacterial outer membrane vesicles that enables co-delivery of siRNA and doxorubicin:

[0104] (1) Synthesis of ROS-nonresponsive cationic polymer PAP

[0105] according to Figure 7The synthetic route involved dissolving 115 mg EDC·HCl (0.6 mmol), 69 mg NHS (0.6 mmol), and 45.2 mg azelaic acid (AA) (0.24 mmol) in 2 mL of anhydrous DMF, respectively, and reacting the mixture at room temperature for 2 h. Then, 1 g of PEI was added... 1.8k (1 mmol) was dissolved in 10 mL of anhydrous DMF and slowly added dropwise to the above reaction system at a rate of 1 mL / min. After reacting at room temperature for 22 h, the reaction solution was transferred to an 8K regenerated cellulose dialysis bag and dialyzed with pure water for 48 h (the dialysis solution was changed every 8 h). Finally, the liquid in the dialysis bag was filtered through a 450 nm filter membrane and then lyophilized to obtain a transparent gel-like liquid, which is the ROS non-responsive crosslinker AA-PEI. 1.8k (AP).

[0106] 18.93 mg TP (2.06 μmol) was mixed with 7.21 mg PEG. 3.5k -NHS (1.35 μmol) was dissolved in 3 mL of 20×PBS (pH 7.4), and the mixture was reacted at room temperature for 6 h under argon protection. The reaction solution was then transferred to an 8K regenerated cellulose dialysis bag and dialyzed with pure water for 24 h (the dialysate was changed every 8 h). Finally, the liquid in the dialysis bag was filtered through a 220 nm filter membrane and lyophilized to obtain a white flocculent solid, which was the ROS-nonresponsive cationic polymer PAP.

[0107] (2) Preparation of ROS-non-responsive co-delivery nanoplatform AO@PAP / 47aD

[0108] according to Figure 8 The synthetic route was the same as in Example 1, except that the ROS-responsive cationic polymer PTP in Example 1 was replaced with the ROS-non-responsive cationic polymer PAP, and the remaining steps were the same. The ROS-non-responsive positively charged nanonuclei obtained in this process are denoted as PAP / 47aD.

[0109] Compare with Example 4

[0110] A method for preparing a nanoplatform based on attenuated bacterial outer membrane vesicles that enables co-delivery of siRNA and doxorubicin:

[0111] The desalted DOX solution in Comparative Example 3 was replaced with pure DEPC water, and the other steps were the same as in Comparative Example 4. The resulting DOX-free ROS non-responsive co-delivery nanoplatform was denoted as AO@PAP / 47a.

[0112] Experimental Example 1

[0113] The ability of ATP-responsive aptamers to load DOX was examined in Example 1 and Control Examples 2-4:

[0114] 500 μL of a 160 μmol / L DOX solution was mixed with 500 μL of ATP-responsive aptamer solutions at concentrations of 10, 5, 2.5, 1.25, and 0.625 μmol / L, respectively. The mixtures were gently blown to mix, and then allowed to stand at room temperature for 2 h. The fluorescence emission intensity of DOX was detected using fluorescence spectrophotometry (excitation wavelength 490 nm, emission wavelength 590 nm). The results are as follows: Figure 9 As shown, it can be seen that as the number of ATP-responsive aptamers increases, the fluorescence intensity of DOX gradually decreases. When the molar ratio between aptamer and DOX reaches 1:16, the fluorescence intensity of DOX almost disappears completely. This may be because there are a total of 16 GC base pairs in the aptamer available for DOX insertion, which also indicates that DOX has been completely loaded into the aptamer at this time.

[0115] Experimental Example 2

[0116] The ability of aptamer-DOX to release DOX in response to ATP, as obtained in Example 1 and Control Example 3:

[0117] 93 μL of aptamer-DOX solution with a DOX concentration of 1.38 μmol / L was mixed with 12 μL of ATP solutions of different concentrations (final ATP concentrations of 8, 1, and 0.2 μmol / L, respectively). Then, 45 μL of buffer solution (final concentrations of 5 mmol / L HEPES, 10 mmol / L MgCl2, and 100 mmol / L NaCl) was added. After vortexing for 30 s, the mixture was incubated at room temperature in the dark for 15 min. Solutions with the same DOX concentration but without aptamer or ATP served as controls. The fluorescence intensity of DOX was detected using a microplate reader (excitation wavelength 490 nm, emission wavelength 590 nm; fluorescence recovery rate (%) = (fluorescence intensity of target solution - fluorescence intensity of DOX solution without ATP) / (fluorescence intensity of DOX solution without aptamer - fluorescence intensity of DOX solution without ATP). The results are shown below. Figure 10 As shown, the fluorescence recovery of DOX increases with increasing ATP concentration, indicating that aptamer-DOX has the ability to release DOX in a concentration-dependent response to ATP, which lays the foundation for its intracellular release of DOX.

[0118] Experimental Example 3

[0119] To meet their needs for growth, metabolism, and invasion, GBM cells typically have high concentrations of ROS. Therefore, under the influence of high intracellular ROS concentrations, the TK bonds in the ROS-responsive positively charged nanonucleus PTP / 47aD in Example 1 break, leading to a decrease in the positive charge density of the cationic polymer PTP. This, in turn, causes the nanoparticles to disintegrate, releasing internally compressed SiO2. Cd47 And aptamer-DOX; while in control example 1, the ROS-non-responsive positively charged nanocore PAP / 47aD remains a complete cationic polymer because the carbon chain in the middle of the AA cannot be broken. Therefore, it can remain stable in a high concentration of ROS environment, and the internally compressed siRNA and aptamer-DOX cannot be released; a specific schematic diagram is shown below. Figure 11 As shown.

[0120] Test Example 4

[0121] The disintegration properties of the ROS-responsive positively charged nanonuclei PTP / 47aD obtained in Example 1 and the ROS-non-responsive positively charged nanonuclei PAP / 47aD obtained in Control Example 3 after being reacted with different concentrations of H2O2 for different times were investigated.

[0122] 100 μL of freshly prepared PTP / 47aD and PAP / 47aD were mixed with 100 μL of 0.2 mmol / L and 100 μL of 2 mmol / L H2O2 solution, respectively, and incubated on a shaker at 37 °C. After 12 h and 24 h, the dynamic light scattering particle size changes of PTP / 47aD and PAP / 47aD were measured using a dynamic light scattering nanoparticle size analyzer. The results are as follows: Figure 12 As shown, under simulated GBM cell extracellular low concentration ROS (0.1 mmol / L H2O2) conditions, the particle size of PTP / 47aD hardly changed; under simulated GBM cell intracellular high concentration ROS (1 mmol / L H2O2) conditions, the particle size of PTP / 47aD increased significantly with time; however, under both simulated conditions, the particle size of PAP / 47aD did not change significantly. This difference suggests that constructing cationic polymers using ROS-responsive linkers can ensure the precise intracellular release of siRNA and aptamer-DOX.

[0123] Experimental Example 5

[0124] Determination of dynamic light scattering particle size, PDI, and potential distribution of the ROS-responsive co-delivery nanoplatform AO@PTP / 47aD obtained in Example 1:

[0125] 40 μL and 800 μL of freshly prepared AO@PTP / 47aD solution were respectively placed in particle size analyzers and potentiometers, and the results were analyzed using a dynamic light scattering nanoparticle size analyzer. Figure 13 As shown, the particle size of AO@PTP / 47aD is approximately 93.71 nm, the PDI is approximately 0.186, and the potential is approximately -21.8 mV.

[0126] Experimental Example 6

[0127] The ROS-responsive positively charged nanonuclei PTP / 47aD obtained in Example 1, and the Δ obtained in Examples 1 and Comparative Examples 2-4 msbB Transmission electron microscopy morphology of OMVs and the ROS-responsive co-delivery nanoplatform AO@PTP / 47aD obtained in Example 1:

[0128] Take freshly prepared PTP / 47aD, Δ msbB 10 μL of OMVs and AO@PTP / 47aD solution were dropped onto the carbon film surface of a copper mesh and allowed to stand at room temperature for 1 min. Excess sample was then removed from the edge of the copper mesh using filter paper. A drop of 3% uranium acetate staining solution (10 μL per drop) was placed on the petri dish lid, and the copper mesh was floated in the staining solution for 1 min. Excess staining was then removed with filter paper, and the mesh was rinsed twice with deionized water. After drying at room temperature, the mesh was observed under a transmission electron microscope. The results are as follows: Figure 14 As shown, PTP / 47aD exhibits a complete and uniform spherical shape with a particle size between 70 and 80 nm, while Δ msbB OMVs exhibit a typical bowl-shaped vesicle structure with a particle size between 80 and 100 nm, while AO@PTP / 47aD exhibits a core-shell structure with clearly visible Δ msbB OMVs coated the PTP / 47aD nanocores with particle sizes ranging from 70 to 100 nm. Notably, the transmission electron microscopy (TEM) sizes of all three were close to their dynamic light scattering (DLS) particle size results.

[0129] Experimental Example 7

[0130] The ROS-responsive co-delivery nanoplatform AO@PTP / 47aD obtained in Example 1 contains Si Cd47 Examining the co-location situation with OMVs:

[0131] Add 100 μL of freshly prepared AO@PTP / 47aD (si Cd47Add 0.45 μL of 1,1'-bis(octadecyl-3,3,3',3'-tetramethylindocyanine) perchlorate (DiI) (final concentration 1 μmol / L) to the FAM-labeled solution. Gently mix and let stand at room temperature for 20 min. Take 20 μL of DiI-labeled AO@PTP / 47aD and mix it with 20 μL of Matrigel on ice. Then take 10 μL and drop it onto a glass slide. Cover with a coverslip and wait for Matrigel to solidify at room temperature. Observe the co-localization under confocal microscopy on a rotating disk. The results are as follows: Figure 15 As shown, it can be seen that: representing si Cd47 The green fluorescent signal and the Δ msbB The red fluorescence signals of OMVs almost completely overlap, emitting a strong yellow fluorescence signal, indicating that Si Cd47 With Δ msbB OMVs are highly co-localized, further indicating that Δ msbB OMVs successfully wrapped PTP / 47aD.

[0132] Experimental Example 8

[0133] In vitro stability testing of the ROS-responsive co-delivery nanoplatform AO@PTP / 47aD obtained in Example 1:

[0134] 190 μL of freshly prepared AO@PTP / 47aD solution was mixed with 10 μL of 20×PBS (pH 7.4) solution and gently blown to mix. The mixture was then incubated at 4 °C for 7 days. 40 μL of the AO@PTP / 47aD solution was collected daily to monitor the dynamic light scattering particle size and polydispersity index. The results are as follows: Figure 16 As shown, under the above conditions, the dynamic light scattering particle size of AO@PTP / 47aD remains at around 90 nm, and the polydispersity index remains below 0.2, indicating that the ROS-responsive co-delivery nanoplatform has good stability.

[0135] Experimental Example 9

[0136] Investigation of the uptake pathway of the ROS-responsive co-delivery nanoplatform AO@PTP / 47aD obtained in Example 1 by G422 cells:

[0137] G422 cells were seeded in 12-well plates (6 w / well) and pre-incubated for 20 min with various uptake inhibitors after 15 h (the uptake inhibitors were diluted with Hank's balanced salt solution (HBSS)). The final concentrations were: phenelzine 0.5 μg / mL (inhibiting the caveolin pathway); chlorpromazine 5 μg / mL (inhibiting the clathrin pathway); and colchicine 1 μg / mL (inhibiting the macropinocytosis pathway). The 4 °C group was incubated with HBSS and held at 4 °C for 20 min. Afterwards, all groups were washed once with HBSS and then incubated with AO@PTP / 47aD (si Cd47 The cells were labeled with Cy5 and diluted in Dulbecco modified Eagle medium (DMEM) basal medium. They were incubated at 37 °C for 30 min, while the 4 °C group was incubated at 4 °C for another 30 min. Afterward, the medium was removed, and the cells were washed twice with HBSS. Then, 200 μL of trypsin containing EDTA was added for digestion. Digestion was stopped after 1.5 min, and the cells were homogenized before flow cytometry analysis. Results are as follows: Figure 17 As shown, under the influence of 4 °C and chlorpromazine, the uptake of AO@PTP / 47aD by G422 cells was significantly reduced, indicating that AO@PTP / 47aD enters the cell through energy-dependent and clathrin-mediated endocytosis, further suggesting that it may enter the lysosomes within the cell.

[0138] Experimental Example 10

[0139] Investigation of the intracellular fate of the ROS-responsive co-delivery nanoplatform AO@PTP / 47aD obtained in Example 1 after uptake by G422 cells:

[0140] G422 cells were seeded in a four-grid confocal dish (2 w / grid). The new time starting point was recorded 15 h later. AO@PTP / 47aD (si) was administered at 0, 2, 4, and 5.5 h from this starting point. Cd47 (Labeled with Cy5), and the culture medium was removed 2 h after each administration, and fresh DMEM complete culture medium was added. 0.5 h after the last administration, the culture medium was uniformly removed, and 500 μL of a prepared HBSS solution containing Hoechst and LysoTracker (Hoechst concentration 5 μg / mL, LysoTracker concentration 50 nmol / L) was added. After incubation for 15 min, the solution was removed, and the cells were washed once with HBSS. The intracellular distribution of AO@PTP / 47aD was observed using confocal microscopy. The results are as follows: Figure 18As shown, at 0.5 h, the Cy5 red fluorescence signal representing the nanoplatform was primarily located on the cell membrane, indicating that most AO@PTP / 47aD had not yet been or was in the process of being taken up by the cell. At 2 h, a large number of red fluorescence signals appeared intracellularly and did not overlap with the green fluorescence signal representing lysosomes, indicating that AO@PTP / 47aD had been taken up but had not yet entered the lysosomes. At 4 h, the red and green fluorescence signals showed obvious co-localization, proving that the nanoparticles were in the lysosomes at this time, which corresponds to the results of the previous uptake pathway. At 6 h, the co-localization and the green fluorescence intensity of the lysosomes were significantly weakened, and a large number of red fluorescence signals diffused in the cytoplasm, indicating that the nanoplatform had escaped from the lysosomes or even disintegrated under the action of high intracellular ROS concentrations, releasing Si. Cd47 This may be attributed to the strong proton sponge effect induced by the positively charged nanonucleus PTP / 47aD.

[0141] Experimental Example 11

[0142] The effects of the ROS-responsive co-delivery nanoplatform AO@PTP / 47aD obtained in Example 1 and the ROS-non-responsive co-delivery nanoplatform AO@PAP / 47aD obtained in Control Example 3 on the induction of CRT production and HMGB1 nuclear translocation in G422 cells were investigated.

[0143] Cells were plated in G422 four-well confocal dishes (1.5 w / well). After 18 h, the supernatant was discarded, and the cells were washed once with HBSS and then given different formulations (DOX final concentration 0.6 μM). After 6 h, each group was supplemented with 400 μL of DMEM complete medium and incubated until 24 h, at which time the cells of each group were treated. For CRT: Wash cells three times with ice-cold 1×PBS (pH 7.4), fix with 0.25% paraformaldehyde at room temperature for 10 min; wash cells three times with ice-cold 1×PBS (pH 7.4), block with 2% goat serum on ice for 15 min; incubate with CRT primary antibody containing 2% goat serum (diluted with 1×PBS (pH 7.4)) at 4 °C for 1 h; wash twice with ice-cold 1×PBS (pH 7.4); incubate with Hoechst (diluted with 1×PBS (pH 7.4), final concentration 5 μg / mL) for 15 min, wash twice with 1×PBS (pH 7.4), and then use a confocal microscopy disc to detect CRT exposure. For HMGB1: Wash three times with ice-cold HBSS, fix with 4% paraformaldehyde at room temperature for 20 min. Permeabilize with 0.1% Triton (diluted with HBSS) for 10 min, then wash three times with HBSS. Blocked on ice for 1 h with 2% goat serum; incubated overnight at 4 °C with HMGB1 primary antibody (HBSS diluted) containing 2% goat serum. Washed twice with HBSS, then incubated with the corresponding secondary antibody at room temperature for 2 h. Washed twice with HBSS, then incubated for 15 min with Hoechst (HBSS diluted, 5 μg / mL); after washing twice with HBSS, HMGB1 nuclear translocation was detected using a disc confocal microscope. Results are as follows. Figure 19 As shown, compared to the ROS-non-responsive co-delivery nanoplatform AO@PAP / 47aD, the ROS-responsive co-delivery nanoplatform AO@PTP / 47aD exhibits stronger CRT exposure and more pronounced HMGB1 nuclear translocation, with effects comparable to or even slightly superior to free DOX. This indicates that our designed ROS-responsive co-delivery nanoplatform AO@PTP / 47aD can effectively deliver DOX into the cell to induce ICD.

[0144] Experimental Example 12

[0145] The efficiency of DOX-free ROS-responsive nanoplatform AO@PTP / 47a obtained in Control Example 2 and DOX-free ROS-non-responsive nanoplatform AO@PAP / 47a obtained in Control Example 4 in CD422 cell knockout was investigated.

[0146] G422 cells were seeded in 6-well plates (10 w / well), and after 24 h, AO@PTP / 47a and AO@PAP / 47a (diluted in 2 mL DMEM basal medium, si) were added. Cd47(Concentration of 100 nmol / L), using the commercial transfection reagent siRNA-Mate and si Cd47 The resulting complex served as a positive control and was denoted as Mate / si. Cd47 Five hours later, 1 mL of DMEM complete medium was added, and the cells were cultured for another 36 hours. After trypsin digestion, the cells were centrifuged at 2000 rpm and 4 °C for 5 min. The cell pellet was resuspended in 1×PBS (pH 7.4) containing 2% bovine serum albumin (BSA). After blocking at room temperature for 20 min, APC-conjugated CD47 primary antibody was added, and incubation continued for 30 min. Finally, the cell suspension was transferred to 96-well plates and analyzed using a Beckman flow cytometer. Results are as follows: Figure 20 As shown, it can be seen that: in the same si Cd47 At certain concentrations, the CD47 silencing efficiency induced by the DOX-free ROS-responsive nanoplatform AO@PTP / 47a was significantly higher than that induced by the DOX-free ROS-non-responsive nanoplatform AO@PAP / 47a, and even superior to the commercial transfection reagent siRNA-Mate. This may be due to the fact that siRNA-PTP / 47a is a more efficient form of transfection. Cd47 This is due to differences in the degree of intracellular release. It's worth noting that previous studies have shown that DOX induces upregulation of CD47 in tumor cells, which may be an immune resistance mechanism initiated by tumor cells in the face of external killers. Therefore, to fully investigate the effect of our constructed nanoplatform on Si... Cd47 For efficient delivery, we did not introduce DOX in this experiment.

[0147] Experimental Example 13

[0148] The ROS-responsive co-delivery nanoplatform AO@PTP / 47aD obtained in Example 1, and the Δ... msbB An examination of the ability of OMVs to promote the transformation of BV2 cells and BMDMs:

[0149] BV2 cells or BMDMs were seeded in 6-well plates (BV2 cells 15 w / well, BMDMs 65 w / well). After 24 h, the culture medium was removed, and the cells were washed once with HBSS and then replaced with DMEM or MEM complete medium containing different formulations (the final concentration of LPS in the M1 positive control group was 5 ng / mL, and the final concentration of interferon-γ (IFN-γ) was 30 ng / mL; the final concentration of interleukin-4 (IL-4) in the M2 positive control group was 10 ng / mL; while Δ msbB Δ in OMVs and AO@PTP / 47aD group msbBThe final concentration of OMVs was 1 μg / mL. After incubation for 24 h, cells were scraped off using a cell scraper and added to RIPA (strong) lysis buffer (containing 1% benzoyl sulfonyl fluoride (PMSF)). The cells were lysed on ice for 10 min, centrifuged at 14000 g and 4 °C for 10 min, and the supernatant was collected. The protein concentration in the supernatant was determined using a BCA protein quantification kit and the supernatant was flattened. The sample was diluted with 5× loading buffer and heated in hot water at 95 °C for 10 min to prepare the sample. The prepared sample was then processed using a sodium dodecyl sulfate polyacrylamide gel electrophoresis.

[0150] After separation by SDS-PAGE for 2 h (total protein content 20 μg), the protein was transferred to a polyvinylidene fluoride (PVDF) membrane, blocked in 5% skim milk solution at room temperature for 2 h, and then washed three times with 1× Tris-buffered saline (TBST) containing Tween 20. Primary antibody was added and incubated overnight, followed by three washes with 1× TBST. Horseradish peroxidase (HRP)-labeled secondary antibody was added and incubated at room temperature for 1.5 h, followed by three washes with 1× TBST. Finally, the membrane was incubated in developing solution for 10 min and chemiluminescence imaging was performed using a Bio-Rad gel imaging system. Results are as follows: Figure 21 As shown, consistent with the M1 type positive control group, Δ msbB Treatment with OMVs and AO@PTP / 47aD significantly increased the expression levels of M1 biomarkers CD80 and iNOS, while the expression levels of M2 biomarkers CD206 and Arg-1 were low or almost nonexistent. This indicates that Δ msbB Although OMVs have undergone engineered attenuation treatment, they still retain a certain immune-stimulating ability and can effectively promote GAMs to transform into the M1 phenotype to exert anti-tumor effects.

Claims

1. A method based on attenuated bacterial outer membrane vesicles that can achieve SI Cd47 A method for preparing a nanoplatform co-delivered with doxorubicin, characterized in that, Includes the following steps: (1) Preparation of crosslinked products: S1. Dissolve the active oxygen ROS-responsive linker 3-(propane-2,2-diylbis(thionyl))dipropionic acid TK-COOH and the amidation reagent in an organic solvent, and activate the carboxyl group at room temperature for 2 h under inert gas protection to obtain the activated ROS-responsive linker; S2. The activated ROS-responsive linker is combined with branched polyethyleneimine (PEI) with a molecular weight of 1800. 1.8k Dissolve PEI separately in organic solvents, and under inert gas protection, dissolve PEI... 1.8k The solution was slowly added dropwise to the activated ROS-responsive linker solution. After reacting at room temperature for 22-24 h, the reaction solution was transferred to a dialysis bag and then dialyzed in deionized water until the organic solvent and impurities were completely removed. The liquid in the dialysis bag was filtered through a membrane and then freeze-dried to obtain the crosslinked product. The reaction process is shown in Formula I: ； (2) The cross-linked material and polyethylene glycol PEG with succinimide esters at the ends and a molecular weight of 3500 are combined. 3.5k - NHS was dissolved in PBS solution and reacted at room temperature for 6-24 h under inert gas protection. The reaction solution was then transferred to a dialysis bag and dialyzed in deionized water until all impurities were removed. The liquid in the dialysis bag was filtered through a membrane and then lyophilized to obtain the cationic polymer. The reaction process is shown in Formula II. ； (3) The ATP-responsive aptamer and DOX were dissolved in ultrapure water treated with diethyl pyrocarbonate (DEPC) and sterilized by high temperature and high pressure. After mixing and homogenization under an enzyme-free environment, the mixture was incubated at room temperature for 1-2 h to prepare the aptamer-DOX complex. The reaction process is shown in Formula III: ； (4) Take the aptamer-DOX and si mentioned in step (3) Cd47 And the cationic polymer shown in step (2) is dissolved in DEPC water, and Si is added under an enzyme-free environment. Cd47 After aptamer-DOX was mixed with cationic polymers, the two systems were rapidly combined and vortexed for 10-60 s, and then allowed to stand in an ice-water bath for 20-40 min to obtain positively charged nanonuclei. The reaction process is shown in Formula IV. ； (5) Add LB medium to the Erlenmeyer flask and inoculate the knockout flask. msbB E. coli BL21Δ gene msbBE. coli BL21, after shaking the bacteria on an air shaker for a period of time, remove the bacteria by centrifugation and filtration; The filtrate is concentrated by ultrafiltration and then subjected to ultrafiltration to obtain Δ. msbB OMVs, using phosphate-buffered saline (PBS) to counteract Δ msbB OMVs are repeatedly washed to remove Δ msbB OMVs are resuspended in deionized water, and the reaction process is shown in Equation V: ； (6) Combine the positively charged nanonucleus described in step (4) with the Δ nanonucleus described in step (5). msbB After mixing, OMVs are ultrasonically disrupted in an ultrasonic disruptor to prepare coated nanoparticles, and the reaction process is shown in Formula VI: ； (7) The amphiphilic block copolymer DSPE-PEG with maleimide and a PEG molecular weight of 2000 is used. 2k -Mal and the targeting functional peptide Angiopep-2 were dissolved in an organic solvent and reacted at room temperature for 20-24 h under an inert gas atmosphere. The reaction solution was then transferred to a dialysis bag and dialyzed in deionized water until the organic solvent and impurities were completely removed. The liquid in the dialysis bag was then freeze-dried to obtain the targeting functional unit DSPE-PEG. 2k -Angiopep-2, the reaction process is shown in equation VII: ； (8) The targeted functional unit DSPE-PEG described in step (7) 2k -Angiopep-2 was dissolved in an organic solvent, then mixed with the coated nanoparticles described in step (6), and co-incubated for 0.5 ~ 1 h to prepare vesicles based on attenuated bacterial outer membranes that can achieve Si Cd47 The nanoplatform is co-delivered with doxorubicin, and the reaction process is shown in Equation VIII: 。 2. The preparation method according to claim 1, characterized in that, In step (1) S1, the amidation reagent is 1-ethyl-(3-dimethylaminopropyl)carbodiimide hydrochloride EDC·HCl and N-hydroxysuccinimide NHS; the molar ratio of TK-COOH, EDC·HCl and NHS is 2:5:5; the organic solvent in step (1) S1 is anhydrous N'N-dimethylformamide DMF; the organic solvent in S2 is anhydrous DMF.

3. The preparation method according to claim 1, characterized in that, In step (1) S2, PEI 1.8k The molar ratio between PEI and TK-COOH is 5:2; 1.8k The drip rate of the activated ROS-responsive linker is 1 mL / min; the dialysis bag is made of regenerated cellulose with a molecular weight cutoff of 8000; the total dialysis time is 48 h and the dialysis solution is replaced every 8 h; the pore size of the filter membrane selected for filtration is 450 nm.

4. The preparation method according to claim 1, characterized in that, In step (2), the crosslinking agent and PEG 3.5k The molar ratio between -NHS is 1:1; the concentration of the PBS solution is 2 mol / L, the pH is 7.4, and the PEG content is... 3.5k The concentration of -NHS in PBS solution is 2.4 mg / mL; the dialysis bag is made of regenerated cellulose with a molecular weight cutoff of 8000; the total dialysis time is 24 h and the dialysis solution is replaced every 8 h; the pore size of the filter membrane selected for filtration is 220 nm.

5. The preparation method according to claim 1, characterized in that, In step (3), the sequences of the two single-stranded DNA molecules that make up the ATP-responsive aptamer are ACCTGGGGGAGTATTGCGGAGGAAGGT and ACCTTCCTCCGCAATACTCCCCCAGGT, respectively; the DOX is in desalted form; the molar ratio between the aptamer and DOX is 1:16; in step (4), si Cd47 The mass ratios between aptamer-DOX and the cationic polymer were 1:2 and 1:1.88, respectively.

6. The preparation method according to claim 1, characterized in that, In step (5), the ratio between the volume of LB culture medium and the volume of the Erlenmeyer flask is 1:5; the Δ msbBE. coli The inoculation ratio of BL21 was 1%; the shaking conditions were 220 rpm and 37 ℃, with a shaking time of 18 h; the centrifugation conditions were 4000 g, 25 ℃, 10 min, for a total of 2 centrifugations; the pore size of the filter membrane selected to remove the bacterial cells was 450 nm; the ultrafiltration conditions were 3500 rpm and 4 ℃; the ultrafiltration conditions were 150000 g, 4 ℃, 2 h; the concentration of the PBS solution was 0.1 mol / L, and the pH was 7.4; Δ... msbB OMVs should be washed at least 3 times.

7. The preparation method according to claim 1, characterized in that, In step (6), the positively charged nanonucleus and Δ msbB The mass ratio between OMVs was 1:2; the ultrasound program was set as follows: power 324 watts, working time 99 s, stop time 10 s, total duration 2 min, temperature maintained at 4 ℃.

8. The preparation method according to claim 1, characterized in that, In step (7), DSPE-PEG 2k The molar ratio between -Mal and Angiopep-2 is 1:3; the organic solvent is anhydrous dimethyl sulfoxide (DMSO); the dialysis bag material in step (7) is regenerated cellulose with a molecular weight cutoff of 3500; the total dialysis time is 48 h and the dialysis solution is replaced every 12 h.

9. The preparation method according to claim 1, characterized in that, In step (8), the organic solvent refers to DMSO; in step (8), the concentration of Angiopep-2 in DMSO is 2 mg / mL; the Δ content of the coated nanoparticles msbB The mass ratio of OMVs to Angiopep-2 contained in the target functional unit was 20:1; the co-incubation temperature was 37 °C.

10. A preparation method according to any one of claims 1-9 containing attenuated bacterial outer membrane vesicles that can achieve Si Cd47 A nanoplatform co-delivered with doxorubicin, the nanoplatform having a diameter of 80-100 nm.

Images