Antibacterial protein derived from Bacillus amyloliquefaciens BS-3 and its application

Abstract

The invention discloses an antibacterial protein derived from Bacillus amyloliquefaciens BS-3 and its application, belonging to the technical field of microorganisms and genetic engineering. The invention discloses an antibacterial protein derived from Bacillus amyloliquefaciens BS-3, and its amino acid sequence is shown in SEQ ID NO.7. The antibacterial protein derived from Bacillus amyloliquefaciens BS-3 can inhibit Colletotrichum oxysporum, Alternaria rubber, and Pseudomonas microsporus.

Description

[0001] This application is a divisional application of the invention patent application with application date of July 4, 2024, application number 202410892552.1, and invention name “An antibacterial protein derived from Bacillus amyloliquefaciens BS-3 and its application”. Technical Field

[0002] The invention relates to the technical field of microorganisms and genetic engineering, and more specifically to an antibacterial protein derived from Bacillus amyloliquefaciens BS-3 and application thereof. Background Art

[0003] Bacillus amyloliquefaciens is a Gram-positive bacterium closely related to Bacillus subtilis. Its strains grow and reproduce quickly and are biological agents with good biocontrol potential. They have strong antibacterial activity and can produce a variety of antibacterial substances such as peptides, lipopeptides, bacteriocins and antibacterial proteins. The antibacterial substances it produces are of various types and play an important role in inhibiting the infection of plant pathogens. They are often used in plant disease prevention and control. In addition, this type of strain can also decompose insoluble or fixed components in the rhizosphere soil, promote the absorption and utilization of elements by plants, and can indirectly or directly improve the soil environment, promote plant growth, and enhance plant resistance.

[0004] The research team isolated an endophytic bacterium BS-3 from rubber trees. The strain had a strong inhibitory effect on Colletotrichum acutatum, Alternaria heveae, Pestalotiopsis microspora, Peronophythora litchii, Phytophthora melonis Katsura, Phytophthora capsici, and Diaporthepassifloricola. In order to further explore the disease prevention and growth promotion mechanism of this strain and explore the gene resources of secondary metabolites, we used the sequencing technology combining the second-generation BGISEQ and the third-generation PacBio platform to sequence the whole genome of the BS-3 strain. From this, we found that there were 10 secondary metabolite synthesis gene clusters in the strain, encoding antibacterial substances such as surfactant, fengycin, polyene, and catechol-type siderophore. The genome sequencing data GenBank accession number is cp060384. The TasA gene sequence was obtained through research. TasA protein is a protein produced by Bacillus that is related to spore and biofilm formation and has strong antibacterial activity. Due to the differences in TasA gene sequences and expression vectors of different strains, the structure and activity, expression level and antibacterial spectrum of their gene expression products will be different. Even if the same gene is expressed using different expression vectors, there are differences in its gene expression rate and expression product activity. pCZN1 is a special prokaryotic expression vector with low-temperature induction. It carries the promoter of the cold shock protein cspA gene and can be induced at low temperatures of 11°C, increasing the probability of soluble protein expression. So far, there has been no research report on the use of pCZN1 vector to express the TasA gene.

[0005] From the whole genome annotation information of strain BS-3, it was found that its TasA encoding gene had great differences from the reported TasA domain. The antibacterial protein TasA gene from strain BS-3 consists of 483 bases in total length, encoding 160 amino acids, the first 27 amino acids are signal peptide sequences, and 7 to 29 amino acids are transmembrane domains. It is 303 bases less than the TasA gene from Bacillus amyloliquefaciens TF28, and is also the shortest TasA gene reported so far. Therefore, how to express, purify and verify this single protein in vitro is of great significance for subsequent protein and nucleic acid hybridization experiments.

[0006] Colletotrichum oxysporum is the main pathogen of anthracnose of rubber trees. The harm of anthracnose of rubber trees to the rubber industry is second only to powdery mildew. It is an important disease on rubber trees, harming rubber seedlings, field saplings and tapped rubber trees, infecting multiple parts such as tender leaves, petioles, tender shoots and fruits, causing tender leaves to fall off, tender shoots to wither and fruit to rot, and even forming dead fruits hanging on the trees. In severe cases, it causes repeated leaf fall and tender shoots to wither, delaying the time of tapping, resulting in a decrease in latex production. In recent years, it has been widely prevalent at home and abroad, and the trend of disease is becoming increasingly serious, resulting in increasing losses in the rubber industry year by year. Colletotrichum oxysporum has a wide host range and can infect peppers, peaches, apples, blueberries, citrus, mangoes and other plants to cause anthracnose. It is also a pathogen that causes rot in kiwifruit after harvest.

[0007] Alternaria hevea is the causative agent of rubber leaf spot disease. Rubber leaf spot disease caused by this pathogen has occurred in many rubber-planting areas in Yunnan Reclamation Area, causing damage to a certain area and posing a potential threat to the healthy development of the rubber industry.

[0008] Pestalotiopsis microsporus is a fungus of the genus Pestalotiopsis. It has a wide host range and is the causative agent of diseases such as macadamia nut and tea leaf blight, Machilus macranthoides, Phoebe kurwaniensis, Photinia fraseri and oil palm leaf spot, American red maple brown spot, and pecan black spot, causing serious economic losses.

[0009] Litchi downy mildew is the causative agent of litchi downy mildew disease, which can infect litchi leaves, young shoots, flower spikes, fruiting twigs, fruit stalks and fruits, causing a large number of rotten fruits and fruit drop. Litchi downy mildew disease is the most serious disease that harms litchi production and post-harvest, seriously affecting the growth and development of litchi and restricting the healthy development of my country's litchi industry.

[0010] Phytophthora cucurbitae causes melon blight, which has a wide host range and can infect almost all melons, bringing great impacts to the breeding and production of melon vegetables. The melon blight caused by this fungus is a serious disease in China's winter melon and cucumber producing areas, mainly harming the stems, leaves and fruits of the plants, and can occur from the seedling stage to the adult stage. The pathogen survives in the soil, has a short incubation period after infecting the host, has strong infectivity, spreads quickly, and is highly destructive to the plants. Under suitable temperature and humidity conditions, it can cause a pandemic in a very short time, and the yield loss caused by the disease is as high as 20% to 50%.

[0011] Capsicum phytophthora can infect the rhizomes of pepper plants, causing root and stem rot; it can harm leaves and fruits, causing them to wither. Capsicum phytophthora infects the roots of peppers and causes root rot. The roots darken and small lesions appear, which quickly spread to the entire root system and stem, eventually causing the entire plant to wilt and die. This is the most destructive disease in pepper production. Pepper blight is fast-susceptible and develops rapidly, and can break out over a large area in a short period of time, seriously affecting pepper production. Capsicum phytophthora can also infect peppers and cause pepper blight, which is the number one disease in pepper production.

[0012] Citrus black spot pathogen is the causative agent of citrus black spot disease, which occurs in citrus producing areas in China, including Jiangxi, Guangxi, Guangdong, Shaanxi, Fujian, Hunan, Chongqing and Shanghai.

[0013] At present, plant disease prevention and control mainly relies on chemical prevention combined with agricultural prevention measures. Agricultural prevention measures include improving the shade and humid environment of the nursery, applying fertilizers reasonably, improving the disease resistance of plants, cleaning up dead branches and leaves and weeds in the forest, pruning branches and leaves, improving planting conditions, etc. Agricultural prevention measures are difficult to promote on a large scale, and can only control the spread of the disease locally in the short term. Improper use of chemical pesticides can easily lead to problems such as reduced prevention effectiveness and drug resistance, threatening the safety of humans and animals and damaging the ecological environment. In comparison, biological control has many advantages such as not easy to produce drug resistance, low toxicity, low residue, safety for humans and animals, and environmental friendliness, which makes up for the shortcomings of chemical pesticides.

[0014] Therefore, providing an antibacterial protein derived from Bacillus amyloliquefaciens BS-3 and its application is an urgent problem to be solved by those skilled in the art. Summary of the invention

[0015] In view of this, the present invention provides an antibacterial protein derived from Bacillus amyloliquefaciens BS-3 and application thereof.

[0016] The present invention isolates an endophytic bacterium BS-3 with inhibitory effect on plant pathogens, extracts TasA protein therefrom and uses thereof, and is used to inhibit various plant anthracnose pathogens caused by Colletotrichum acutatum, leaf spot of rubber tree caused by Alternaria heveae, leaf spot and leaf blight caused by Pestalotiopsis microspora, litchi downy mildew caused by Peronophythoralitchii, melon blight caused by Phytophthora melonis Katsura, pepper blight and pepper blast caused by Phytophthora capsici, citrus black spot caused by Diaporthepassifloricola and the like.

[0017] In order to achieve the above object, the present invention adopts the following technical solution:

[0018] A strain of Bacillus amyloliquefaciens BS-3, with a deposit number of CCTCCNO: M 2024893, has been deposited in the China Center for Type Culture Collection, referred to as CCTCC, address: Wuhan University, Wuhan, China, with a deposit date of May 10, 2024, and is classified and named Bacillus amyloliquefaciens BS-3.

[0019] Furthermore, the Bacillus amyloliquefaciens BS-3 is used in inhibiting Colletotrichum acutatum, Alternaria heveae, Pestalotiopsis microspora, Peronophythora litchii, Phytophthora melonis Katsura, Phytophthora capsici, and Diaporthe passiflora.

[0020] Furthermore, the Bacillus amyloliquefaciens BS-3 is used in producing siderophores.

[0021] Furthermore, the Bacillus amyloliquefaciens BS-3 is used in nitrogen fixation.

[0022] Furthermore, the Bacillus amyloliquefaciens BS-3 is used in phosphorus solubilization.

[0023] Furthermore, an antibacterial protein derived from Bacillus amyloliquefaciens BS-3 has an amino acid sequence as shown in SEQ ID NO.7.

[0024] Furthermore, the antibacterial protein derived from Bacillus amyloliquefaciens BS-3 is used in inhibiting Colletotrichum acutatum, Alternaria heveae, and Pestalotiopsis microspora.

[0025] It can be known from the above technical scheme that, compared with the prior art, the present invention discloses an antibacterial protein derived from Bacillus amyloliquefaciens BS-3 and its application, and Bacillus amyloliquefaciens BS-3 can inhibit Colletotrichum acutatum, Alternaria heveae, Pestalotiopsis microspora, Peronophythora litchii, Phytophthora melonis Katsura, Phytophthora capsici, and Diaporthepassifloricola. The antibacterial protein derived from Bacillus amyloliquefaciens BS-3 can inhibit Colletotrichum acutatum, Alternaria heveae, and Pestalotiopsis microspora. The TasA protein sequence involved in the present invention is shorter than the TasA protein sequence disclosed in the literature, but still has a good inhibitory effect on pathogens, laying a foundation for the subsequent development of antibacterial protein products; and because the TasA protein has antibacterial activity, the TasA protein sequence can be transferred into the corresponding plants in the later stage to induce the plants to develop disease resistance. The TasA protein sequence is shorter, which is conducive to the later transfer into plants. BRIEF DESCRIPTION OF THE DRAWINGS

[0026] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments or the description of the prior art will be briefly introduced below. Obviously, the drawings described below are only embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on the provided drawings without paying creative work.

[0027] Figure 1The accompanying drawing shows the antagonistic effect of strain BS-3 on Colletotrichum acutatum using the plate confrontation method of the present invention;

[0028] Among them, A, control; B, antagonistic effect of strain BS-3;

[0029] Figure 2 The accompanying drawing shows the antagonistic effect of strain BS-3 on Alternaria heveae by the plate confrontation method of the present invention;

[0030] Among them, A, control; B, antagonistic effect of strain BS-3;

[0031] Figure 3 The accompanying drawing shows the antagonistic effect of strain BS-3 on Pestalotiopsis microspora by using the plate confrontation method of the present invention;

[0032] Among them, A, control; B, antagonistic effect of strain BS-3;

[0033] Figure 4 The accompanying drawing shows the antagonistic effect of strain BS-3 on Peronophythoralitchii using the plate confrontation method of the present invention;

[0034] Among them, A, control; B, antagonistic effect of strain BS-3;

[0035] Figure 5 The accompanying drawing shows the antagonistic effect of strain BS-3 on Phytophthoramelonis Katsura using the plate confrontation method of the present invention;

[0036] Among them, A, control; B, antagonistic effect of strain BS-3;

[0037] Figure 6 The accompanying drawing shows the antagonistic effect of strain BS-3 on Phytophthora capsici using the plate confrontation method of the present invention;

[0038] Among them, A, control; B, antagonistic effect of strain BS-3;

[0039] Figure 7 The accompanying drawing shows the antagonistic effect of strain BS-3 on citrus black spot pathogen (Diaporthe passifloricola) using the plate confrontation method of the present invention;

[0040] Among them, A, control; B, antagonistic effect of strain BS-3;

[0041] Figure 8 The accompanying figure is a multiple sequence alignment analysis of TasA protein;

[0042] Among them, EU131674: Bacillus amyloliquefaciens YN-1; BS-3: Bacillus amyloliquefaciens BS-3; JQ309841: Bacillus CQBS03; KC692521.1: Bacillus pumilus DX01; KP409225.1: Bacillus amyloliquefaciens TF28; FJ713582.1: Bacillus subtilis ME0717 endophytic in mulberry trees;

[0043] Fig. 9 The attached figure shows the expression and identification analysis of BL21-TasA protein;

[0044] Wherein, M: 10-180Kda protein molecular weight standard; 1: pET28a induced (empty); 2: uninduced; 3: after induction; 4: supernatant after induction and fragmentation; 5: precipitate after induction and fragmentation;

[0045] Fig.10 The attached figure shows the SDS-PAGE analysis of TasA protein expression, identification, purification and quality control;

[0046] A: TasA protein expression identification SDS-PAGE analysis; M: protein molecular weight standard; 1: pCZN1 induced (empty); 2: uninduced; 3: induced; 4: supernatant after induced fragmentation; 5: precipitate after induced fragmentation;

[0047] B: SDS-PAGE analysis of TasA protein purification; M: protein molecular weight standard; 1: supernatant after induced fragmentation; 2: flow-through sample (effluent from Nickel-NTA resin purification step (1)); 3-4: two replicates, both elution samples (effluent from Nickel-NTA resin purification step (4));

[0048] C: TasA protein analysis; M: protein molecular weight standard; 1: 0.5 mg / mL BSA, 2: purified sample;

[0049] Fig.11 The attached figure shows the inhibitory activity analysis of TasA fusion protein on Colletotrichum acutatum spores (magnification 400), and the scale bar is 20 μm;

[0050] Among them, A, CK (12h); B, 30μg / mL TasA protein treatment (12h);

[0051] Fig.12 The accompanying drawings show the inhibitory effect of TasA protein on Colletotrichum acutatum of the present invention;

[0052] Among them, A, control; B, TasA protein treated group;

[0053] Fig.13 The accompanying drawings show the inhibitory effect of TasA protein of the present invention on Alternaria heveae;

[0054] Among them, A, control; B, TasA protein treated group;

[0055] Fig.14 The accompanying drawings show the inhibitory effect of TasA protein on Pestalotiopsis microspora of the present invention;

[0056] Among them, A, control; B, TasA protein treated group. DETAILED DESCRIPTION

[0057] The following will be combined with the drawings in the embodiments of the present invention to clearly and completely describe the technical solutions in the embodiments of the present invention. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0058] Colletotrichum acutatum, Alternaria heveae, Pestalotiopsis microspora, Peronophythora litchii, Phytophthora melonis Katsura, Phytophthora capsici, and Diaporthepassifloricola were all preserved by the Plant Protection and Microbial Utilization Research Center of Yunnan Tropical Crops Science Institute. Bacterial genomic DNA extraction kit was provided by Bruker (Beijing) Technology Co., Ltd.; DL2000 DNAMarker was provided by Beijing Tiangen Biochemical Technology Co., Ltd. PCR instrument was provided by Applied Biosystems; electrophoresis instrument was provided by Beijing Liuyi Biotechnology Co., Ltd.; NanoDrop2000 was provided by Thermo Fisher Scientific. PCR primers: Beijing Liuhe BGI Technology Co., Ltd.; analytical reagents such as glucose, yeast extract, and tryptone, Sangon Biotechnology Co., Ltd.; improved CAS agar / siderophore detection medium (PM0821-1L), Beijing Coolbo Technology Co., Ltd.; constant temperature incubator, Shanghai Boxun Industrial Co., Ltd.

[0059] Example 1 Isolation and screening of antagonistic bacteria

[0060] (1) Sample source

[0061] Healthy rubber tree root, stem and other tissues were collected from the rubber tree planting area of ​​Jinghong City, Xishuangbanna Prefecture, Yunnan Province, placed in sterile self-sealing bags, and brought back to the laboratory and refrigerated at 4°C for later use.

[0062] (2) Culture medium

[0063] LB medium (g / L): peptone 10.0, yeast extract 5.0, NaCl 10.0;

[0064] PDA medium (g / L): potato 200.0, glucose 20.0. Solid medium was supplemented with agar powder 19g / L. 1×10 5 Pa sterilization for 30 minutes.

[0065] (3) Isolation of antagonistic bacteria

[0066] The healthy rubber tree tissues collected from the rubber planting area were washed, disinfected with 0.1% mercuric chloride solution and 75% alcohol, rinsed repeatedly with sterile water, and the surface moisture was absorbed. The outermost layer of the plant tissue was removed, cut into small pieces, and cultured in LB plate culture medium. The sterile water used to wash the plant tissue for the last time was used as a control. The plate was placed in a 37℃ incubator for culture, and a single colony was picked and inoculated on a new plate after 12 hours.

[0067] (4) Initial screening of antagonistic bacteria

[0068] Use a 5mm diameter hole puncher to punch holes in the activated Colletotrichum acutatum plate, take a bacterial cake and inoculate it in the center of a new PDA plate, inoculate different strains to be tested around it, and use the plate inoculated with pathogens as a control. After constant temperature cultivation at 28℃ for 4 days, select the strains with antibacterial effect, streak them, preserve them, and record them by number.

[0069] (5) Rescreening of antagonistic bacteria

[0070] The plate confrontation method was used to determine the inhibition rate of antagonistic bacteria. Use a 5mm diameter puncher to punch holes in the activated Colletotrichum acutatum plate, take the pathogen cake and place it in the center of a new PDA plate, inoculate the bacteria cake at equal distances around the cake to obtain strains with antibacterial effects, and use the plate inoculated with only pathogens as a control. Repeat 3 times, culture in a constant temperature box at 28°C for 4 days, and measure the diameter of the pathogens. The strength of the antagonistic effect of antagonistic bacteria on pathogens was evaluated by the growth inhibition rate of indicator bacteria. The antagonistic bacteria with the best inhibition effect was named BS-3, mixed with 20% glycerol and stored at -80°C.

[0071] Example 2 Identification and Whole Genome Sequencing of Antagonistic Bacteria

[0072] (1) Extraction of total DNA of strains

[0073] The strain BS-3 was inoculated in LB medium and cultured at 37°C and 180 rpm for 12 h. The culture solution was centrifuged at 10,000 rpm for 5 min to collect the bacteria. The genome was extracted using a bacterial genomic DNA extraction kit. The operation steps were referred to the kit instructions. 1% agarose gel electrophoresis and NanoDrop 2000 were used to detect the concentration, purity and degradation of the DNA sample.

[0074] The results showed that the genomic DNA bands detected by 1% agarose gel electrophoresis were bright, clear, single, and had good integrity. 260 / A 280 The value is 1.82, which can be used for subsequent experimental operations.

[0075] (2) 16S rDNA gene identification

[0076] The BS-3 strain was cultured in LB liquid medium at 37°C and 180r / min shaking until the logarithmic growth phase, and the bacteria were collected by centrifugation at 10000r / min for 5min. The bacterial genomic DNA was extracted using a kit, and primers 27F and 1492R were selected for 16SrDNA amplification. The specific primer sequences are as follows:

[0077] 27F: 5'-AGAGTTTGATCCTGGCTCAG-3'; SEQ ID NO.1;

[0078] 1492R: 5'-GGTTACCTTGTTACGACCCTT-3'; SEQ ID NO. 2;

[0079] PCR reaction system: 2×EsTaq MasterMix 25μL, genomic DNA 2μL, 27F / 1492R primers (10μmol / L) 1μL each, add ddH2O to 50μL. PCR reaction conditions: 95℃ denaturation 5min; 95℃ 30s, 55℃ 30s, 72℃ 2min, 35 cycles; 72℃ 10min. PCR products were purified and sequenced. The sequencing results were compared with the BLASTn program in the GenBank database. The taxonomic status of the strain was determined by multiple sequence alignment and phylogenetic analysis using MEGA 7.0 software. The phylogenetic tree was constructed using the Neighbor-Joining method, and the Bootstrap was set to 1000.

[0080] The species of strain BS-3 was identified using 16S rDNA, and the sequencing result is shown in SEQ ID NO.3.

[0081]

[0082] The full length of the 16SrDNA sequence of the strain is 1450 bp, and the homology with the 16SrDNA sequence of Bacillus amyloliquefaciens B3 (accession number MH521169.1) reaches 99.66%, and the strain is preliminarily identified as Bacillus amyloliquefaciens.

[0083] (3) Whole genome sequencing and analysis

[0084] The BS-3 whole-genome sequencing was commissioned to Shenzhen BGI Genomics Co., Ltd. After the sample quality inspection was qualified, the DNA sample was ultrasonically sheared using a Covaris instrument for library construction. The sequencing was performed using a sequencing technology that combines the second-generation BGISEQ platform with the third-generation PacBio platform.

[0085] Results The total genome size of strain BS-3 was 3870130 bp, with an average GC content of 46.88%, encoding 4161 genes. The BS-3 genome sequencing data was submitted to GenBank with the accession number CP060384.

[0086] (4) Identification of BS-3 and gyrA analysis

[0087] Due to the close relationship between species within the genus Bacillus, the 16S rRNA gene cannot be used to analyze the evolutionary relationship between species of the genus Bacillus. In recent years, it has been reported that the gyrA gene can be used to distinguish the differences between species of Bacillus subtilis. Based on the whole genome annotation information, the gyrA gene sequence and the NCBI database comparison analysis results were selected, and the Neighbor-Joining method of MEGA7.0 software was used to construct a phylogenetic tree.

[0088] The phylogenetic tree was constructed by combining strain BS-3 with the GyrA protein sequences from 9 Bacillus sp. strains. It was found that the GyrA proteins from strain BS-3, FZB42, UCMB5113, and Y2 were clustered together, indicating that they were very closely related and belonged to the same genus Bacillus amyloliquefaciens. The strain was named Bacillus amyloliquefaciens BS-3.

[0089] Example 3 Application of Bacillus amyloliquefaciens BS-3 in Inhibiting Plant Pathogens

[0090] (1) After activating seven pathogens, including Colletotrichum acutatum, Alternaria heveae, Pestalotiopsis microspora, Peronophythoralitchii, Phytophthora melonis Katsura, Phytophthora capsici, and Diaporthe passifloricola, the bacteria were punched along the outer edge of the colony using a 5 mm diameter punch for later use.

[0091] (2) Seven pathogenic bacteria cakes were selected and inoculated on PDA plates, and Bacillus amyloliquefaciens BS-3 was inoculated at equal distances around the bacterial cakes. The plate inoculated with only pathogens was used as the control. The process was repeated three times and cultured at a constant temperature of 28°C. When the mycelium of the control group grew to the edge of the culture dish, the colony diameter was measured by the cross method, and the result was calculated according to the inhibition rate formula. Inhibition rate (%) = [(control pathogen growth diameter - treatment pathogen diameter) / (control pathogen growth diameter - bacterial cake diameter)] × 100. The antagonistic effect of Bacillus amyloliquefaciens BS-3 on pathogens is shown in Figures 1 to 7 The inhibition rate results are shown in Table 1.

[0092] Table 1 Inhibition rate of Bacillus amyloliquefaciens BS-3 against 7 plant pathogens

[0093]

[0094] From the results in Table 1, it can be seen that Bacillus amyloliquefaciens BS-3 has a high inhibitory effect on the 7 tested pathogens, and it is speculated that BS-3 has application prospects for diseases caused by such pathogens; and Bacillus amyloliquefaciens BS-3 has a good inhibitory effect on litchi downy mildew, cucurbit phytophthora, and pepper phytophthora, and it is speculated that Bacillus amyloliquefaciens BS-3 has good application prospects in diseases caused by phytophthora pathogens.

[0095] Example 4 Study on the antibacterial and growth-promoting mechanism of Bacillus amyloliquefaciens BS-3

[0096] (1) Culture medium

[0097] Modified CAS agar / siderophore assay medium (PM0821-1L).

[0098] Ashby nitrogen-free medium (g / L): glucose 10, KH2PO4 0.2, MgSO4·7H2O 0.2, NaCl 0.2, CaSO4·2H2O 0.2, CaCO3 5.0, agar 18, sterilized at 113°C for 30 min.

[0099] Montgina inorganic phosphorus medium (g / L): glucose 10, (NH4)2SO4 0.5, NaCl 0.3, KCl 0.3, FeSO4·7H2O 0.03, MnSO4·4H2O 0.03, MgSO4·7H2O 0.3, Ca3(PO4)2 10, yeast extract 0.4, agar 18, pH 7.0, sterilization at 121℃ for 20 min.

[0100] Montgina organophosphorus medium (g / L): glucose 10, (NH4)2SO4 0.5, NaCl 0.3, KCl 0.3, FeSO4·7H2O 0.03, MnSO4·4H2O 0.03, MgSO4·7H2O 0.3, lecithin 0.2, CaCO3 5.0, yeast extract 0.4, agar 18, pH = 7.0-7.5, sterilization at 121°C for 20 min.

[0101] (2) Qualitative detection of siderophore production capacity

[0102] Qualitative detection of the ability to produce siderophores: Bacillus amyloliquefaciens BS-3 was inoculated in the center of the modified CAS agar / siderophore detection medium plate, and the modified CAS agar / siderophore detection medium plate without inoculation of Bacillus amyloliquefaciens BS-3 was used as the control. Repeat 3 times and culture at 30℃ for 5 days. If an orange halo appears, it means that the strain has the ability to produce siderophores. The larger the orange halo, the stronger the ability of the strain to produce siderophores. The results showed that the surrounding of the colony changed from blue to orange-yellow, indicating that the strain can produce siderophores to seize iron ions in the detection medium. It is speculated that the siderophores produced by Bacillus amyloliquefaciens BS-3 can rob iron ions in the living environment, which may cause abnormal development of pathogens due to iron deficiency, and play a role in controlling the occurrence and development of plant diseases; at the same time, it can provide iron elements for plants and promote plant growth, reflecting the ability of Bacillus amyloliquefaciens BS-3 to prevent diseases and promote growth. Bacillus amyloliquefaciens BS-3 has an inhibitory effect on a variety of plant pathogens. It is speculated that the ability of Bacillus amyloliquefaciens BS-3 to produce siderophores may be one of the mechanisms for the inhibition of plant pathogens.

[0103] (3) Nitrogen fixation capacity test

[0104] Bacillus amyloliquefaciens BS-3 was inoculated into Ashby nitrogen-free medium for 3 times and cultured at 30℃ for 5 days. If colonies appeared on Ashby nitrogen-free medium, it was transferred to Ashby nitrogen-free medium again. After 5 consecutive transfers, if colonies appeared on Ashby nitrogen-free medium, it indicated that the strain had nitrogen fixation ability. The results showed that Bacillus amyloliquefaciens BS-3 could still grow well after being transferred to Ashby nitrogen-free medium for 5 consecutive times. It was speculated that Bacillus amyloliquefaciens BS-3 could convert inorganic nitrogen into organic nitrogen that was easily absorbed and utilized by plants, which could directly affect the recycling of nitrogen sources in the soil and soil nitrogen fertility, improve soil quality, promote plant growth and development, increase soil nitrogen supply capacity, and improve soil environment.

[0105] (4) Determination of phosphorus dissolving capacity

[0106] Bacillus amyloliquefaciens BS-3 was inoculated on the Montkina inorganic phosphorus medium and the Montkina organic phosphorus medium, respectively. The Montkina inorganic phosphorus medium and the Montkina organic phosphorus medium without Bacillus amyloliquefaciens BS-3 were used as controls. The experiment was repeated three times and cultured at 30°C for 10 days. If a phosphorus-dissolving ring was produced, it indicated that the strain had the ability to dissolve phosphorus. The results showed that after inoculation with Bacillus amyloliquefaciens BS-3, transparent rings appeared on both the Montkina inorganic phosphorus medium and the Montkina organic phosphorus medium, indicating that the strain had the ability to dissolve inorganic and organic phosphorus. It is speculated that Bacillus amyloliquefaciens can dissolve the insoluble or fixed components in the soil, improve the plant growth environment, promote plant absorption and utilization, and provide plants with the nutrients needed for growth and development.

[0107] Example 5 Sequence Analysis and Cloning of Antibacterial Gene TasA

[0108] The data obtained by genome sequencing were predicted by reading frame and local BLAST comparison to obtain the TasA gene. The TasA gene from strain BS-3 is 483 bp in length, with a start codon of ATG and a stop codon of TGA. The gene sequence is shown in SEQ ID NO.4.

[0109] ATGGGTATGAAAAAGAAATTAAGCTTGGGCGTTGCCTCAGCCGCACTCGGTTTAGCATTAGTAGGAGGAGGCACATGGGCCGCATTTAATGATGTGAAGTCCACGGACGCCACATTTGCGTCAGGAACACTTGATTTATCGGCTAAAGAACAATCAGCCAATGTCAATTTGTCAAACTTAAAACCAGGCGACAAATTGACAAAAGATTTTGAATTCAGAAACAACGGTTCACTTGCCATTAAA GAAGTGCTGATGGCTTTGAACTTTACTGACTTCAAAGGAGCAAAGAAAGGAAACGAATCTGCGGAGGATTTCCTCAGCCAGTTTGAAATTACGGTTCTGACAGTCGGTAAAGAAGGGGGCAACGGCTACCCTAAAAATATCATTTTGAAGGCGGCCAGCCTGAAAGACTTATACTTAATGTCTGCAAAGCAGGATAAAGCAGCGGCTGAAGCGATCAGCATATTGATCCGAAGTTCTTGA; SEQ. ID NO.4.

[0110] The primary structure of TasA protein was predicted online. The prediction results showed that the protein was composed of 160 amino acids. The molecular formula was C 749 H 1218 N 198 O 233 S4, the theoretical molecular weight is 16.853 kDa, and the theoretical isoelectric point (pI) is 9.05. The secondary structure of the protein was predicted online, and the results showed that the proportions of α-helix, β-fold and random coil in the secondary structure were 42.50%, 19.38% and 38.12% respectively. SignalP was used to predict the signal peptide of the protein, and the results showed that amino acids 1 to 27 were signal peptide structures (MGMKKKLSLGVASAALGLALVGGGTWA; SEQ ID NO.5). Hydrophilicity analysis found that most of the amino acid score values ​​were below 1, indicating that the protein is a hydrophilic protein. Transmembrane domain analysis found that 7 to 29 aa are transmembrane domains. Bioedit was used to compare the amino acid sequence of TasA from BS-3 with the amino acid sequence of TasA reported to have antibacterial activity ( Figure 8), the results showed that the first 27 amino acids were signal peptide sequences and were consistent, with three positively charged residues KKK near the N-terminus of the signal peptide, followed by a central hydrophobic region separated by glycine residues, and a highly conserved region GVASAALGLALVGGGTWA; SEQ ID NO. 6. The difference is that the protein from BS-3 in this study is shorter, with only 160 amino acids.

[0111] Strain BS-3, strain YN-1 and strain TF28 belong to the same family of Bacillus amyloliquefaciens. The TasA protein sequence from BS-3 was compared with the TasA protein sequence from YN-1 (EU131674), and the amino acids at positions 137, 143, 155, 156, 158, 159 and 160 were mutated, which were "G→D", "T→A", "K→I", "H→L", "D→R", "P→S" and "K→S", respectively; the TasA protein sequence from BS-3 was compared with the TasA protein sequence from TF28 (KP409225.1), and the amino acids at positions 143, 155, 156, 158, 159 and 160 were mutated, which were "T→A", "K→I", "H→L", "D→R", "P→S" and "K→S", respectively. This may indicate a change in the function of the TasA protein from BS-3.

[0112] After truncating the signal peptide, transmembrane domain and stop codon, the target gene is 393 bp, with only 131 amino acids, and the amino acid sequence is shown in SEQ ID NO.7.

[0113] SEQ ID NO.7.

[0114] The remaining fragments after truncating the signal peptide and transmembrane domain were compared and analyzed using BLASTp, and it was found that it had the highest similarity of 98.41% with the TasA protein (WP_276787698.1) from Bacillus sp. (in: firmicutes); the similarity with the TasA protein (WP_065981876.1) from B. amyloliquefaciens strain was 96.90%; and the similarity with the TasA protein from the B. amyloliquefaciens model strain FZB42 was 96.90%.

[0115] (1) Preparation of TasA antibacterial protein using pET28a vector

[0116] The synthetic primers were completed by BGI Sequencing Center Co., Ltd., and EcoR Ⅰ and Not Ⅰ restriction sites (indicated by underline) were designed at the 5′ end of the upstream and downstream primers of pET28a-TasA, respectively;

[0117] pET28a-TasA-F:

[0118] 5'-CAAATGGGTCGCGGATCC GAATTC GCATTTAATGATGTGAAGTC CAC-3'; SEQ ID NO.8;

[0119] pET28a-TasA-R:

[0120] 5'-GTGGTGGTGCTCGAGT GCGGCCGC AGAACTTCGGATCAATATGC TGAT-3'; SEQ ID NO. 9.

[0121] ①Gene cloning

[0122] pET28a-TasA-F and pET28a-TasA-R were used as primer pairs, and BS-3 genomic DNA was used as a template. Touch-down PCR was used for PCR amplification, and the amplification conditions were: 94°C for 5 min; 94°C for 30 s, 63°C for 30 s (0.5°C drop for each cycle), 72°C for 1 min 30 s, 28 cycles; 94°C for 30 s, 49°C for 30 s, 72°C for 1 min 30 s, 7 cycles; 72°C for 10 min.

[0123] PCR reaction system: dNTP mixture (2.5mM) 4μL, 10×PCRBuffer 5μL, F (10μmol / L) 2μL, R (10μmol / L) 2μL, genome (75ng / μL) 0.5μL, ExTaq enzyme (5U / μL) 0.5μL, ddH2O to 50μL. After the PCR product was recovered, it was sent to the BGI sequencing center for sequence verification.

[0124] ② Construction of prokaryotic expression vector (pET28a)

[0125] The above gel recovery product was digested with restriction endonucleases EcoR Ι and Not Ι, and the target fragment was recovered for later use. pET28a was double digested with EcoR Ι and Not Ι to form a linearized vector, and the One Step Clonging Kit connection system was used for connection (linearized cloning vector 1 μL, gel recovery product 2 μL, 5×CE Ⅱ Buffer 2 μL, Exnase TM Ⅱ 1 μL, H2O 4 μL), and the connection product was transformed into E. coli DH5α competent cells, and the transformants were screened on a plate containing 50 μg / mL kanamycin resistance. The recombinant plasmid pET28a-TasA was extracted and transformed into the E. coli BL21 strain. The recombinant E. coli strain BL21 (DE3) / TasA was sent to the BGI sequencing center for sequencing verification, and the transformants were stored at -20 ° C for later use.

[0126] ③Protein expression and purification

[0127] The E. coli strain BL21(DE3) / TasA containing the recombinant expression vector pET28a-TasA was inoculated into LB culture medium (containing 50 μg / mL kanamycin) at a 0.1% inoculum and shaken at 180 r / min at 37°C overnight. The activated bacterial solution was then transferred to fresh LB culture medium (containing 50 μg / mL kanamycin) at a 1% inoculum and cultured at 180 r / min for 2-3 h (OD 600 After reaching 0.6~1.0), add IPTG with a final concentration of 0.7mmol / L for induction, continue shaking culture at 37℃ for about 20h, and obtain the induced sample (the treatment without IPTG induction is the uninduced group, and the Escherichia coli strain BL21 (DE3) without the expression vector pET28a of the target gene is the pET28a induced empty load). The culture solution is centrifuged at 4℃, 9500r / min for 5min, and the bacteria are collected. After adding an appropriate amount of pH 7.0 Tris-HCl buffer to the bacteria for full suspension, the bacteria are ultrasonically broken in an ice bath, and centrifuged at 12000r / min, 4℃ for 10min to obtain the supernatant and precipitate after induced breaking; the supernatant is aspirated and the target protein containing 6×His-tag is purified with Nickel-NTA Agarose, and the purified protein is analyzed by 12% SDS-polyacrylamide gel electrophoresis (SDS-PAGE).

[0128] BL21-TasA protein expression and identification analysis see Fig. 9 The results showed that the BL21-TasA protein was in the precipitate after induced fragmentation. The theoretical value of the protein was 14.28 kDa, and the actual molecular weight was consistent with the theoretical molecular weight, but BL21 / TasA was an inclusion body.

[0129] (2) Preparation of TasA antibacterial protein using pCZN1 vector

[0130] The synthetic primers were completed by BGI Sequencing Center Co., Ltd., and the pCZN1 vector was provided by Nanjing Zhongding Biotechnology.

[0131] pCZN1-TasA-F:

[0132] 5'-TACGTCTGGGGAATTC CATATG GCATTTAATGATGTGAAGTCCA C-3'; SEQ ID NO.10;

[0133] pCZN1-TasA-R:

[0134] 5'-GCGATTTCCGTCGCTAG TCTAGA AGAACTTCGGATCAATATGCT-3'; SEQ ID NO.11;

[0135] NdeI and XbaI restriction sites were designed at the 5' ends of the upstream and downstream primers of pCZN1-TasA, respectively, and are indicated by underscores.

[0136] ①Gene cloning

[0137] pCZN1-TasA-F and pCZN1-TasA-R were used as primer pairs, and BS-3 genomic DNA was used as a template. Touch-down PCR was used for PCR amplification, and the amplification conditions were: 94°C for 5 min; 94°C for 30 s, 63°C for 30 s (0.5°C drop for each cycle), 72°C for 1 min 30 s, 28 cycles; 94°C for 30 s, 49°C for 30 s, 72°C for 1 min 30 s, 7 cycles; 72°C for 10 min.

[0138] PCR reaction system: dNTP mixture (2.5mM) 4μL, 10×PCRBuffer 5μL, F (10μmol / L) 2μL, R (10μmol / L) 2μL, genome (75ng / μL) 0.5μL, ExTaq enzyme (5U / μL) 0.5μL, ddH2O to 50μL. After the PCR product was recovered, it was sent to the BGI sequencing center for sequence verification.

[0139] ② Construction of prokaryotic expression vector (pCZN1)

[0140] The target fragment was recovered by restriction endonuclease NdeI and XbaI (enzyme digestion system: 1 μg of PCR gel recovery product, 1.5 μL of endonuclease Nde I, 1.5 μL of endonuclease Xba I, 3 μL of 10× buffer Tango TM, 18 μL of ddH2O); the pCZN1 plasmid was digested at the same time, and the target fragment and the vector were connected using T4 DNA ligase, and the Arctic-Express Escherichia coli competent cells were transformed to obtain the recombinant plasmid pCZN1-TasA; the recombinant Escherichia coli strain Arctic-Express / TasA was sent to the BGI Sequencing Center for sequencing verification, and the transformant was stored at -20°C for future use.

[0141] ③Protein expression and purification

[0142] E. coli Arctic-Express / TasA containing the recombinant expression vector pCZN1-TasA was inoculated at 0.1% into LB liquid medium containing Amp (final concentration 100 μg / mL) and cultured at 37°C with shaking at 180 rpm until OD 600 The value reached about 0.6; IPTG with a final concentration of 0.2mM was added for induction and culture for 12h (cultured at 15℃) to fuse the expression protein (the treatment without IPTG induction was the uninduced group, and the E. coli Arctic-Express without the expression vector pCZN1 of the target gene was the pCZN1 induction empty load), 1mL of culture was taken out, centrifuged at 10000r / min at room temperature for 2min, the supernatant was discarded, and the bacterial precipitate was resuspended with 100μL 1× loading buffer to obtain the induced sample. The remaining culture was centrifuged at 4000r / min for 10min, the supernatant was discarded, and the bacterial precipitate was resuspended with PBS; after the resuspension was ultrasonically disrupted, the supernatant and the precipitate after induced disruption were taken and added to the loading buffer for resuspending.

[0143] Nickel-NTA resin purification: (1) Using a low-pressure chromatography system, the supernatant solution was loaded onto a Ni-IDA-Sepharose Cl-6B affinity chromatography column pre-equilibrated with Ni-IDA Binding-Buffer at a flow rate of 0.5 mL / min to obtain an effluent sample. (2) The effluent was rinsed with Ni-IDA Binding-Buffer at a flow rate of 0.5 mL / min until the OD of the effluent was 280 (3) Wash with Ni-IDA Washing Buffer (20 mM Tris-HCl, 30 mM imidazole, 0.15 M NaCl, pH 8.0) at a flow rate of 1 mL / min until the OD value of the effluent reaches 0.1. 280The value reaches the baseline. (4) Use Ni-IDA Elution-Buffer (20mM Tris-HCl, 250mM imidazole, 0.15MNaCl, pH 8.0) to elute the target protein at a flow rate of 1mL / min, collect the effluent, and obtain the elution sample. (5) Add the above collected protein solution to a dialysis bag and dialyze it with PBS overnight. (6) Perform 12% SDS-PAGE analysis.

[0144] Results: Arctic-Express / TasA was expressed in the supernatant (see Fig.10 A), Arctic-Express / TasA was used for further research in later experiments; after purification by Nickel-NTA resin, the recombinant protein Arctic-Express / TasA reached SDS-PAGE electrophoresis purity (see Fig.10 B), the theoretical molecular weight of TasA is 15.62KDa, and the actual molecular weight is consistent with the theoretical molecular weight. According to the SDS-PAGE identification results (see Fig.10 C), protein content is 500 mg / L.

[0145] Example 6 Detection of antibacterial activity of recombinant protein TasA

[0146] The spores of Colletotrichum oxysporum from rubber trees cultured at 28°C for 5 days were washed with sterile water and filtered through three layers of mirror paper to obtain a conidial suspension (1×10 4 The spore suspension was treated with TasA fusion protein at a final concentration of 30 μg / mL and 60 μg / mL, and sterile water was added to the blank control. After being incubated at 28°C for a certain period of time, the spore germination was observed under a microscope.

[0147] The results showed that when treated with TasA fusion protein at a final concentration of 30 μg / mL for 4.5 h, the spore germination rate of the blank control was 33.6%, while that of the treated sample was 4.05%; after 6 h of culture, the spore germination rate of the blank control had reached 52.0%, while that of the treated sample was only 7.05%; after 12 h of culture, the spore germination rate of the blank control had reached 81.05%, while that of the treated sample was only 10%. Fig.11 .

[0148] When the spores of Colletotrichum oxysporum were treated with TasA fusion protein at a final concentration of 60 μg / mL, no spore germination was observed after static culture at room temperature for 12 hours. The results of this study prove that TasA fusion protein has a significant inhibitory effect on the germination of Colletotrichum oxysporum spores.

[0149] Example 7 Detection of antibacterial activity of recombinant protein TasA

[0150] The three test pathogens were inoculated on PDA plates, cultured at 28°C for 4 days, and then punched along the outer edge of the colony with a 5mm diameter puncher for later use. The pathogenic bacteria cake was selected and inoculated on a PDA plate coated with 300μL recombinant protein (500mg / L), and the pathogenic bacteria plate without recombinant protein was used as a control. The process was repeated 3 times. After culturing at 28°C for 4 days, the colony diameter was measured by the cross method, and the inhibition rate was calculated according to the formula.

[0151] The results showed that TasA protein had an inhibitory effect on the tested pathogens Colletotrichum acutatum, Alternaria heveae, and Pestalotiopsis microspora. Figure 12-14 ), among which the strongest inhibitory effect was on Colletotrichum oxysporum, with an inhibition rate of 99.38%, followed by Alternaria heveae, with an inhibition rate of 66.17%, and the weakest inhibition was on Pestalotiopsis microspora, with an inhibition rate of 30.88%. Finally, it was found that the inhibition rates of Bacillus amyloliquefaciens BS-3 and TasA proteins on the same pathogen were different.

[0152] The above description of the disclosed embodiments enables one skilled in the art to implement or use the present invention. Various modifications to these embodiments will be apparent to one skilled in the art, and the general principles defined herein may be implemented in other embodiments without departing from the spirit or scope of the present invention. Therefore, the present invention will not be limited to the embodiments shown herein, but rather to the widest scope consistent with the principles and novel features disclosed herein.

Claims

1. An antibacterial protein derived from Bacillus amyloliquefaciens BS-3, characterized in that: Its amino acid sequence is shown in SEQ ID NO.

7.

2. The antibacterial protein derived from Bacillus amyloliquefaciens BS-3 according to claim 1, characterized in that: The deposit number of the Bacillus amyloliquefaciens BS-3 is CCTCC NO: M2024893.

3. Use of the antibacterial protein derived from Bacillus amyloliquefaciens BS-3 according to claim 1 in inhibiting Colletotrichum acutatum, Alternaria heveae and Pestalotiopsis microspora.

Images