Gene pbl1 for regulating plant type and panicle type of rice and application thereof

Abstract

The gene PBL1 for regulating rice plant type and panicle type and its application, by finding and utilizing specific proteins (such as SEQ ID NO: 2) and their encoding genes (PBL1, such as SEQ ID NO: 1), provides an effective means for precise regulation of rice plant type and panicle type. This protein acts as a negative regulator and plays a key role in regulating rice growth, helping to achieve optimization of rice plant type and improvement of panicle type, thereby improving rice yield and quality.

Description

Technical Field

[0001] This invention relates to the field of rice molecular breeding technology, specifically to the rice gene PBL1 and its applications. Background Technology

[0002] In agricultural production, increasing crop yield and improving crop varieties have always been important topics of concern for researchers. As one of the world's major food crops, rice's plant type and panicle type characteristics have a crucial impact on yield. Dwarfing and erect panicle characteristics are important plant type and panicle type features for achieving high-density planting and increasing yield per unit area. Most japonica rice varieties in my country have erect panicle characteristics, which are beneficial for increasing light utilization and photosynthetic efficiency in the field, thereby increasing yield.

[0003] Traditional methods for breeding upright-panicle, dwarf rice varieties primarily rely on hybridization between upright-panicle varieties and pedigree screening of their offspring. However, this method is not only time-consuming and labor-intensive but also requires extensive field phenotypic observations to select new lines that meet breeding requirements. Therefore, traditional breeding methods have significant limitations in efficiency and are difficult to meet the needs of the rapid development of modern agriculture.

[0004] With the rapid development of biotechnology, gene editing technology has provided a new avenue for crop genetic improvement. Through gene editing, genes controlling plant and ear types can be precisely edited, rapidly improving related traits and significantly accelerating the breeding process. In particular, factors with negative regulatory effects on plant and ear types have become optimal targets for breeding due to the greater ease of gene editing.

[0005] Although several genes related to plant and panicle type regulation have been cloned in rice, their application often presents challenges. For example, some genes, while reducing plant height, also lead to a decrease in the number of grains per panicle, thus affecting the final yield of rice. Therefore, how to maintain or increase the number of grains per panicle while reducing plant height, achieving an effective balance between plant height and panicle type, has become a critical issue that urgently needs to be addressed in current rice genetic improvement.

[0006] To address this issue, researchers in this field urgently need to discover new genetic resources. These genes should be able to effectively reduce plant height without affecting the number of grains per panicle, or increase or maintain the number of grains per panicle while reducing plant height, thereby achieving an optimized combination of plant height and panicle type. Editing and utilizing these new genes through gene editing technology holds promise for breeding new rice varieties with superior plant and panicle type characteristics, further improving rice yield and quality, and meeting the ever-growing global food demand. Summary of the Invention

[0007] Technical problem solved: This invention addresses the problems existing in the prior art by providing a gene PBL1 that regulates rice plant type and panicle type and its application.

[0008] Technical solution: A protein that regulates rice plant type and panicle type, having an amino acid sequence as shown in SEQ ID NO:2, or an amino acid sequence having at least 90% homology with the amino acid sequence shown in SEQ ID NO:2, and retaining the function of regulating rice plant type and panicle type.

[0009] The gene PBL1 encoding the above-mentioned protein has a nucleic acid sequence as shown in SEQ ID NO:1, or a nucleic acid sequence that has at least 90% homology with the nucleic acid sequence shown in SEQ ID NO:1, and can encode a protein that regulates rice plant type and panicle type.

[0010] The above-mentioned proteins are used as negative regulators in the regulation of rice plant type and panicle type, wherein the regulation includes, but is not limited to, reducing rice plant height and / or promoting the formation of erect panicles.

[0011] The above-mentioned gene is used as a negative regulator in the regulation of rice plant type and panicle type, wherein the regulation is achieved by adjusting the expression level of the gene, including but not limited to reducing rice plant height and / or promoting the formation of erect panicles.

[0012] A method for reducing rice plant height and achieving an erect panicle characteristic includes the step of downregulating the expression of the aforementioned protein, wherein the method of downregulating expression includes, but is not limited to, gene silencing, gene mutation, gene knockout, or the use of antisense RNA technology.

[0013] A method for breeding rice varieties with reduced plant height and erect panicles, the method comprising screening for plants with downregulated expression of the aforementioned genes.

[0014] A kit for detecting the presence or expression level of the protein or gene in rice, comprising an antibody that specifically recognizes the protein or a probe that specifically binds to the gene.

[0015] The above-mentioned proteins are used as detection markers in the preparation of biological agents for detecting and regulating rice plant type and panicle type.

[0016] The above-mentioned genes are used as detection markers in the preparation of transgenic rice or biological agents for detecting and regulating rice plant type and panicle type.

[0017] Beneficial Effects: 1. Improved Efficiency of Rice Plant and Panicle Type Regulation: By discovering and utilizing specific proteins (as shown in SEQ ID NO:2) and their encoding genes (PBL1, as shown in SEQ ID NO:1), this invention provides an effective means for precise regulation of rice plant and panicle types. This protein, as a negative regulator, plays a crucial role in regulating rice growth, helping to optimize plant and panicle types, thereby increasing rice yield and quality. 2. Enhanced Rice Resistance and Adaptability: By regulating rice plant and panicle types, this invention helps to cultivate rice varieties more adaptable to different environmental conditions. For example, reducing rice plant height and giving it upright panicle characteristics can improve lodging resistance and reduce yield losses caused by natural factors such as wind and rain. Simultaneously, this adjustment of plant and panicle types also helps to improve the photosynthetic efficiency and nutrient utilization efficiency of rice, further enhancing its resistance and adaptability. 3. Enriched Resources for Rice Genetic Improvement: The gene PBL1 and its encoded protein provided by this invention offer new genetic resources for rice genetic improvement. Through genetic engineering, these genes can be introduced into different rice varieties to create new varieties with superior traits. This not only enriches the genetic diversity of rice but also provides strong support for the continuous improvement and efficient production of rice. 4. It promotes the development of rice molecular biology: The implementation of this invention involves knowledge and technology from multiple fields such as molecular biology and genetics, promoting the application and development of these disciplines in rice research. Simultaneously, by analyzing the function and regulatory mechanism of the protein PBL1 and its encoding gene, it also provides new perspectives and ideas for a deeper understanding of the molecular mechanisms of rice growth and development. 5. It has broad application prospects: As rice is one of the most important food crops globally, the implementation of this invention is of great significance for ensuring food security and promoting sustainable agricultural development. By applying the technologies and methods provided by this invention, higher-yielding, higher-quality, and more stress-resistant rice varieties can be cultivated to meet the growing global population's food needs. At the same time, these technologies and methods can also provide reference for the genetic improvement of other crops, possessing broad application prospects. Attached Figure Description

[0018] Figure 1 Changes in IPA1 expression dosage in transgenic plants and near-isogenic lines altered plant and ear types.

[0019] Figure 2 The spatiotemporal expression pattern of PBL1 and its response to changes in IPA1 dose.

[0020] Figure 3 PBL1 knockout target location information and CAPS marker identification results. Note: Arrows indicate the three genotypes: mutant, heterozygous, and wild-type.

[0021] Figure 4 Different sequence variation types in T1 generation mutant plants of the PBL1 knockout line.

[0022] Figure 5 Comparison of plant type and spike type images of PBL1 knockout line T2 generation wild-type and mutant sister lines. Detailed Implementation Plan

[0023] To enable those skilled in the art to better understand the technical solutions of the present invention, specific embodiments of the present invention are now described in detail. This detailed description should not be construed as a limitation of the present invention, but rather as a clearer, more complete, and more detailed exposition of the technical aspects of the present invention. Without departing from the scope and spirit of the present invention, those skilled in the art can make improvements to the specific embodiments of the present invention for multiple applications. All other embodiments obtained by those skilled in the art without inventive effort are within the protection scope of the present invention.

[0024] Example 1

[0025] ipa1-2D is a QTL locus we previously cloned that simultaneously affects rice plant architecture and panicle type. It is a novel allele of the naturally occurring variation of the SBP domain transcription factor gene IPA1, and upregulation of this gene expression can alter plant height and panicle type. To test the effects of different IPA1 expression doses on plant and panicle type, we transgenically introduced IPA1 genomic DNA into the Nipponbare rice variety, obtaining self-pollinated stable transgenic positive plants with one copy (IPA1_1C) and four copies (IPA1_4C). Phenotypic observation in Yangzhou during the peak rice season revealed that compared to IPA1_1C plants, IPA1_4C plants had slightly lower plant height, a drastically reduced number of tillers, and a significantly increased number of primary branches per panicle, although the length of the primary branches was somewhat reduced, exhibiting certain erect panicle characteristics. This indicates that specific IPA1 expression doses can achieve a moderately dwarfed, erect panicle phenotype. Figure 1 To clarify this effect, we further introduced the ipa1-2D allele, which upregulated IPA1 expression, into the japonica rice variety Huruan 1212 using marker-assisted selection. After seven generations of backcrossing, we screened for a pair of near-isogenic lines, NIL_IPA1 and NIL_ipa1-2D. Phenotypic observation in Yangzhou during the peak season revealed that, compared to NIL_IPA1, NIL_ipa1-2D showed a moderately reduced plant height, a drastically reduced number of tillers, and a significantly increased number of primary branches per panicle, but with a significantly reduced primary branch length, similar to the behavior of the four-copy IPA1 transgenic plants. Figure 1 :B).

[0026] Since IPA1 is a transcription factor, we hypothesized that it affects plant height and panicle phenotype through downstream targets. To identify these downstream targets, we sampled panicle primordia tissue from genetic materials with different IPA1 expression doses, extracted RNA using the Trizol method, and performed transcriptome sequencing on the obtained RNA to obtain a list of differentially expressed downstream genes responding to IPA1 doses. To identify negative regulators of moderate dwarfing and erect panicle, we screened downregulated genes and compared their expression patterns based on the Rice eFP Browser (https: / / bar.utoronto.ca / efprice / cgi-bin / efpWeb.cgi) database. We found that one gene, LOC_Os02g49560, was specifically highly expressed in elongated young panicles. Figure 2 The gene :A) has a spatiotemporal correspondence with the regulation of panicle branch length, and there were no previous reports on the function of this gene. Therefore, it was used as a candidate gene for functional verification. Since it was subsequently shown to affect panicle branch length, we named it Panicle branch length 1 (PBL1). Its expression level was downregulated by about 2-fold in transcriptome analysis. Figure 2 :B).

[0027] We also sampled young spike primordia and extracted RNA from near-isogenic NIL_ipa1-2D plants. After reverse transcription into cDNA, we performed qRT-PCR analysis of the PBL1 gene. The results showed that the downregulation of this gene was more pronounced, approximately 5-fold. Figure 2 This demonstrates that the gene can stably respond to high doses of IPA1 expression. We also sampled and extracted RNA from eight tissues at different developmental stages of the Nipponbare variety using the Trizol method, including roots, young leaves, shoot tips, young spikelets smaller than 1 cm, young spikelets 1-3 cm, young spikelets 3-5 cm, young spikelets 5-10 cm, and young spikelets larger than 10 cm. qRT-PCR analysis showed that the gene was highly expressed in young spikelets of 1-3 cm and 3-5 cm, moderately expressed in young leaves, shoot tips, young spikelets smaller than 1 cm, and young spikelets 5-10 cm, and almost not expressed in roots and young spikelets larger than 10 cm. Figure 2 :D), consistent with results from gene expression databases, this expression pattern suggests that PBL1 mainly plays a role in the elongation of young spike tissue.

[0028] To clarify the function of this gene, we constructed a gene knockout vector and performed genetic transformation. The specific methods are as follows: First, we downloaded the coding region sequence LOC_Os02g49560 from the Rice Genome Annotation Project website. It was found that this gene does not contain introns, and the full-length coding region sequence is 510 bp (see the PBL1 gene CDS coding sequence), encoding 170 amino acids. Then, using the targetDesign online tool in the CRISPR-GE toolkit developed by Academician Liu Yaoguang's laboratory at South China Agricultural University (http: / / skl.scau.edu.cn / ), we pasted the coding region sequence into the website, submitted it, and screened target primer sequences. To facilitate the subsequent identification of mutant materials, we selected target primers containing commonly used restriction enzyme sites before the PAM sequence (NGG) during target screening. Finally, we successfully found a target with a SacI restriction site in the middle of the gene. Figure 3 :A) The first 20 bp of the PAM sequence was used as the forward primer. Since it needs to be ligated into the SK-gRNA vector by AarI restriction enzyme digestion, the GGCA sequence was added before the primer, and the AAAC sequence was added before the reverse complementary primer. Finally, a pair of target primers GGCAAGAAACAGCTAAGTGAGCTC and AAACGAGCTCACTTAGCTGTTTCT were obtained and sent to the company for primer synthesis.

[0029] After primer synthesis, water was added to achieve a final concentration of 100 μM. Then, 20 μL of each primer was aspirated into a new PCR tube, mixed thoroughly, and placed in a PCR instrument at 95°C for denaturation for 5 minutes. The tubes were then allowed to cool naturally to room temperature to form primer dimers. Simultaneously, SK-gRNA was digested using Fermentas' AarI enzyme to obtain a linear vector with sticky ends. The reaction mixture was 50 μL, comprising 5 μL of 10× buffer, 1 μL of 50× oligonucleotide, 2 μL of AarI enzyme, and 1–2 μg of SK-gRNA vector. Water was then added to bring the final volume to 50 μL. After incubating the reaction system overnight at 37°C for 8-16 hours via enzyme digestion, perform 1% agarose gel electrophoresis and recycle the linear SK-gRNA vector by gel cutting. Use NEB T4 ligase to ligate the primer dimer with the recycled linear vector. The ligation system is 10 μL, including 1 μL of linear SK-gRNA, 1 μL of 10× ligation buffer, 7 μL of primer annealing product, and 1 μL of T4 ligase. After mixing, incubate at room temperature for 2 hours.

[0030] The ligation products were transformed into competent *E. coli* Trans-T1 cells using the heat shock method. The cells were then plated on ampicillin-resistant LB agar plates and incubated at 37°C for approximately 8 hours. Single clones on the plates were screened for positive clones using colony PCR. The primers for colony PCR were the T3 common primer from the vector and the target reverse complementary primer AAACGAGCTCACTTAGCTGTTTCT. The reaction volume was 20 μL, containing 10 μL of 2×Taq Master Mix (P112) from Nanjing Novizan, 1 μL each of the two primers, and 4 μL of bacterial culture, with water added to a final volume of 20 μL. The PCR program was as follows: denaturation at 95°C for 3 minutes, followed by 36 cycles of denaturation at 95°C for 15 seconds, extension at 55°C for 20 seconds, extension at 72°C for 15 seconds, and a final extension at 72°C for 5 minutes. The amplified products were subjected to 1% agarose gel electrophoresis; the appearance of a band of approximately 500 bp indicated a positive clone. The positive clones were then sent to a sequencing company for sequencing. The sequencing primers were the T7 common primers. After obtaining the sequencing results, the sequencing results were opened with the Editseq sequence editing tool of Lasergene software. The sequence was searched using AAACGAGCTCACTTAGCTGTTTCT. If a completely identical target sequence was found, it proved that the target had been successfully ligated into the SK-gRNA vector.

[0031] The target site in the SK-gRNA vector, along with its gRNA, was further ligated into the final vector pC1300-Cas9 after enzyme digestion. The specific procedures were as follows: the SK-gRNA vector containing the target site was double-digested with Fermentas' rapid enzymes KpnI and BglII, while the pC1300-Cas9 vector was double-digested with Fermentas' rapid enzymes KpnI and BamHI. The double digestion system was 20 μL, including 2 μL of... 10× restriction enzyme buffer, 0.5 μL each of the two enzymes, and 1 μg of target SK-gRNA or pC1300-Cas9 were added, and water was added to a final volume of 20 μL. After digestion at 37°C for 30 minutes, 1% agarose gel electrophoresis was performed. The target SK-gRNA was excised into a band of approximately 500 bp, while the linear pC1300-Cas9 vector band was approximately 14.6 kb. The DNA of both bands was recovered by gel extraction, and then the two were ligated using NEB T4 ligase. The ligation system was 10 μL, including 7 μL of target gRNA fragment, 1 μL of pC1300-Cas9 vector fragment, 1 μL of 10× ligation buffer, and 1 μL of T4 ligase. After mixing, the mixture was incubated at room temperature for 2 hours. The cells were then transformed into competent E. coli Trans-T1 cells using the heat shock method and plated on kanamycin-resistant LB plates and incubated at 37°C for approximately 8 hours.

[0032] The single clones that grew from the plate were then picked and transferred to a 50ml centrifuge tube containing 5ml of kanamycin-resistant LB liquid culture. To ensure the discovery of positive clones, more than 6 clones should be picked. The culture was then incubated at 37°C with shaking for 12 hours. Plasmid DNA was extracted from the cultured bacterial culture using the alkaline lysis method. The extracted plasmid was then digested with Fermentas' XbaI enzyme in a 20μL digestion system, including 5μL plasmid, 2μL 10× digestion buffer, 0.3μL XbaI enzyme, and 12.7μL water. After digestion at 37°C for 1 hour, the culture was removed and subjected to 1% agarose gel electrophoresis. If a band of about 500bp appeared, it was considered a possible positive clone. The clone was then sent to a sequencing company for sequencing using universal primer P1. If the sequencing results contained the target sequence, it proved that the target was successfully ligated into the final vector pC1300-Cas9.

[0033] The obtained knockout vector was used to construct and transform Agrobacterium EHA105, and further transformed into our cultivated rice variety using Agrobacterium-mediated transformation. The Agrobacterium-mediated genetic transformation was performed by Rice Transformation Biotechnology Co., Ltd. At least 20 transgenic positive plants were obtained. DNA was extracted from seedling leaves using the TPS small-scale DNA extraction method, followed by PCR amplification using hygromycin-specific primers. A 1% agarose gel electrophoresis was performed; the appearance of a bright band indicated a positive result. The identification primer sequences were: TGAAAAAGCCTGAACTCACCG and TATTTCTTTGCCCTCGGACG. The amplification system was the same as the colony PCR system, but the annealing temperature was changed to 60℃, and the amplification template was 2 μL of DNA. Since the knockout target sequence contains a SacI restriction site, CAPS markers were developed to identify the mutant plants. If the plant mutated, its restriction site disappeared, and the PCR amplification product could not be cleaved, while the wild type was completely cleaved. The CAPS marker design method involves directly selecting 600bp sequences (300bp upstream and downstream of the target site). Primer Premier 5 primer design software was used, with the forward primer set to fall within the range of 1-280bp and the reverse primer within the range of 320-600bp. Finally, the highest-scoring primer pair was selected and synthesized by the company. The forward primer sequence is GCTAGTTTTCCATACTTGTCA, and the reverse primer sequence is GAAGGTACTCTCCGTGTTCTC. After being dissolved in water, the primers were used for PCR amplification of transgenic plants. The amplification system was the same as the colony PCR system, and the amplification template was 2μL of DNA.

[0034] After amplification, 5 μL of the amplified product was aspirated for gel electrophoresis to confirm the presence of a band. If a band was found, another 10 μL of the PCR product was aspirated and digested with SacI from Fermentas. The digestion system consisted of 20 μL, including 10 μL of PCR product, 2 μL of 10× digestion buffer, 0.3 μL of SacI enzyme, and 7.7 μL of water. After digestion at 37°C for 1 hour, the digested product was removed and subjected to 3% agarose gel electrophoresis. CAPS marker identification was performed on the T0 generation plants. Plants that could not be completely cleaved were found, indicating that the corresponding target sequence had mutated. Further field planting of the T1 generation plants revealed genotype segregation with three band types: an uncleaved 474 bp band (corresponding to a sequence mutation), two completely cleaved bands (295 bp and 179 bp, corresponding to the wild type), and a type containing all three bands (heterozygous). The appearance of the above banding pattern proves that we can effectively track target mutations using molecular markers.

[0035] Subsequently, we performed high-fidelity amplification of DNA templates showing mutant bands in different T1 generation lines using Phanta-Max Super-Fidelity DNA Polymerase (P505) from Novizan. The amplification system was 20 μL, containing 2 μL DNA template, 0.4 μL dNTP mix (10 mM), 10 μL 2× buffer, 0.3 μL high-fidelity enzyme, 6.3 μL water, and 0.5 μL each of the aforementioned pair of CAPS-labeled primers. After mixing, amplification was performed under the same CAPS-labeled amplification conditions. The amplified products were sent to the company for sequencing to obtain the sequence mutation information of different mutant plants. Using the wild-type sequence as a control, we found that different mutants had different sequence mutation types, including 1 bp deletion, 3 bp deletion, 1 bp insertion, and base substitution. These mutations all resulted in the disappearance of the SacI GAGCTC restriction site. Figure 4 For the T1 generation lines, we simultaneously conducted hygromycin primer identification and selected T2 generation seeds that did not contain transgenic fragments for continued planting.

[0036] Phenotypic observations of different T2 generation stable mutant lines during the grain-filling stage revealed an erect panicle phenotype. To accurately assess the gene effect, a detailed phenotypic investigation was conducted on T2 generation wild-type and mutant sister lines derived from the same T1 line. In the early grain-filling stage of both wild-type and mutant plants, the panicles of wild-type plants were noticeably curved, while those of mutant plants exhibited erect panicle characteristics. At maturity, only the panicle tip of the mutant plants showed some curvature, similar to the panicle morphology of erect-panicle rice varieties. Figure 5:A). Furthermore, the mutant plants were slightly shorter than the wild type. A comparison of ear types revealed that the primary branch length of the mutant plants was significantly shortened, thus exhibiting an erect ear characteristic. Figure 5 Statistical analysis (Table 1) showed that the mutant plant height and ear length were significantly lower than the wild type, decreasing by approximately 6.7% and 8.6%, respectively. However, the number of primary branches per ear increased significantly, by 12.2%, while the number of secondary branches remained unchanged. The mutant ear had approximately 19 more grains than the wild type, demonstrating molecular breeding value for high-density planting in the field and for increasing yield and resistance to lodging.

[0037] Table 1. Comparison of different agronomic traits between wild-type and mutant sister lines of the PBL1 knockout line T2 generation.

[0038]

[0039] The above embodiments are preferred embodiments of the present invention and are not intended to limit the present invention. Any technical improvements and equivalent substitutions made to the present invention by those skilled in the art without departing from the spirit or scope of the present invention are within the protection scope of the present invention.

Claims

1. A method for regulating rice plant type and panicle type, characterized in that, The protein shown in SEQ ID NO:2 was used as a negative regulator, wherein the regulation included reducing rice plant height and promoting the formation of erect panicles, wherein the regulation was achieved by downregulating the expression of the protein shown in SEQ ID NO:

2.

2. A method for regulating rice plant type and panicle type, characterized in that, The gene PBL1, which encodes the protein shown in SEQ ID NO:2, is used as a negative regulator. The gene PBL1 has the nucleic acid sequence shown in SEQ ID NO:

1. The regulation is achieved by downregulating the expression level of the gene, including reducing rice plant height and promoting the formation of erect panicles.

3. A method for reducing rice plant height while maintaining erect panicle characteristics, characterized in that, The method includes the step of downregulating the expression of the protein shown in SEQ ID NO:2, wherein the downregulation method includes gene silencing, gene mutation, gene knockout, or the use of antisense RNA technology.

4. A method for breeding rice varieties with reduced plant height and erect panicles, characterized in that, The method includes screening plants with downregulated expression of the gene PBL1, which encodes the protein shown in SEQ ID NO:2, and the gene PBL1 has the nucleic acid sequence shown in SEQ ID NO:1.

Images