A dsRNA targeting the GABA gene of Tetranychus urticae and its application

A dsRNA targeting the GABA gene in T. urticae silences gene expression, improving pesticide efficacy against the mites and addressing resistance and environmental concerns.

CN119530222BActive Publication Date: 2025-07-15SOUTHWEST UNIV
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202411254453.7
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2024-09-09
Publication Date
2025-07-15
Estimated Expiration
2044-09-09

AI Technical Summary

Technical Problem

The existing chemical methods for controlling 2-spot spider mites have problems such as environmental pollution, pest resistance and high cost of continuous use, and require a green, pollution-free and sustainable control method.

Method used

DsRNA targeting the GABA gene of the genus spider mite is used, and it is introduced into the mites through injection to silence the expression of GABA gene and enhance the acaricidal effect of acaricide.

Benefits of technology

It significantly enhances the acaricide effect of acaricide on the diploid spider mites, reduces the preparation cost, and has high targeting and environmentally friendly.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN119530222B_ABST
    Figure CN119530222B_ABST
Patent Text Reader

Abstract

The present invention relates to the technical field of controlling Tetranychus urticae, and particularly relates to a dsRNA targeting the GABA gene of Tetranychus urticae and its application. The dsRNA targeting the GABA gene of Tetranychus urticae according to the present invention is a double-stranded RNA composed of the nucleotide sequence shown in SEQ ID NO.1 as the sense RNA and its reverse complementary sequence as the antisense RNA. The present invention provides a dsRNA targeting the GABA gene of Tetranychus urticae, its preparation method and application; by injecting this dsRNA fragment into the abdomen of mites through injection, the silencing effect on the target GABA gene is good, and this dsRNA specifically targeting the GABA of Tetranychus urticae has the efficient effect of targeting and degrading the GABA gene; after the dsRNA of the present invention achieves the silencing of the GABA gene, it can significantly enhance the acaricidal effect of acaricides on Tetranychus urticae. The dsRNA provided by the present invention has high targeting property, low preparation cost and strong practicability.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to the technical field of Tetranychus urticae control, and particularly relates to a dsRNA targeting the GABA gene of Tetranychus urticae and its application. Background Art

[0002] In 1983, Tetranychus urticae first appeared in Beijing [1] and quickly spread to areas such as Hebei, Shandong, Shaanxi, Ningxia, and Gansu [2] and became an alien species that poses a great threat to the environment and human health. According to research reports, the host plants of Tetranychus urticae are as high as more than 1100 species, causing damage to important cash crops such as vegetables, cotton, fruit trees, and flowers worldwide [3] . Tetranychus urticae is a common harmful mite. They usually gather and reproduce around the veins of plants. When the population density grows to a certain number, the tails of the mites will spin silk and transfer to new leaves to cause harm. In addition to the leaves of host plants, Tetranychus urticae also harms parts such as the flower pistils, stems, and fruit stalks of plants, sucking the internal sap, turning them from normal green to yellow, and in severe cases, causing the entire plant to wither and die. The widespread presence of Tetranychus urticae and its rapid reproductive ability, combined with their high sensitivity, make their prevention and control in the fields difficult. The number of this harmful mite is gradually increasing and will bring extremely bad consequences to agriculture, resulting in huge financial losses. Among them, the nymphs and adult mites cause the most serious harm. The present invention conducts research on adult Tetranychus urticae.

[0003] Currently, the control methods of Tetranychus urticae include agricultural, biological, and chemical technologies. Agricultural control generally controls Tetranychus urticae through field management measures or by selecting resistant crop varieties. For example, methods such as deep plowing in autumn and flooding in winter can eliminate a large number of overwintering pests (mites) [9] . However, restricted by factors such as different regions, labor, and seasons, the effect of agricultural control is not as good as that of chemical control [7][8] ; Biological control can effectively control their reproduction by using the predatory and parasitic natural enemies of Tetranychus urticae. Its predatory natural enemies include predatory mites, predatory spiders, and predatory insects, etc.; its parasitic natural enemies include some bacteria, fungi, and viruses

[10] . Although biological control performs well in terms of environmental friendliness and pest (mite) drug resistance, establishing a dominant population of natural enemies is still challenging, and the storage and transportation costs are also quite high. Therefore, it has not yet become the mainstream control method. Chemical control generally controls Tetranychus urticae by using chemical pesticides. Currently, common acaricides are divided into mitochondrial electron transport chain inhibitor types, antibiotic types, growth inhibitor types, and pyrethroid types, etc. [5]. It has the advantages of quick control effect and simple operation, and has long occupied the dominant position in pest (mite) control, making it the main means of controlling Tetranychus urticae. However, the pollution of excessive chemical pesticides not only causes serious damage to nature, but also harms our human health. In addition, if these pesticides are continuously misused, it is easy to cause pests to develop drug resistance, thus reducing the efficiency of prevention and control, and even possibly causing more disasters. If these problems are not solved, chemical control will ultimately not be a long-term solution. We need a green, pollution-free and sustainable control method to replace chemical control.

[0004] When a chemical pesticide is first launched on the market, the control effect can generally reach more than 90%. However, due to the long-term reliance on a single acaricide in the same area and unscientific and non-standard use of pesticides, Tetranychus urticae has developed drug resistance.

[12] . Due to the rapid reproduction and short generation cycle of Tetranychus urticae, and they can also reproduce alone, which makes them more likely to develop drug resistance. Research shows that Tetranychus urticae has developed varying degrees of drug resistance to 96 kinds of insecticides. [5] , becoming one of the most serious pests in the world

[11] . In recent years, due to the long R & D cycle of new acaricides, the field populations of Tetranychus urticae in many places have developed drug resistance to traditional acaricides, and will develop a higher level of drug resistance as the use time increases. The newly developed acaricides also show low resistance, medium resistance and high resistance levels. The current high degree of dependence on chemical pesticides has indirectly led to the accelerated development of drug resistance in Tetranychus urticae. According to the latest research results, many field populations of Tetranychus urticae in China show extremely strong resistance to abamectin, and the resistance multiple can reach 316.67 - 1809.51 times. [4] . Research shows that mutations in the target sites of insecticides (acaricides) may cause a decrease in the sensitivity of pests (mites) to the agents, leading to the resurgence of pests (mites). The current high degree of dependence on chemical pesticides remains unchanged, and the problems related to drug resistance cannot be fundamentally solved. In addition, the harm of chemical pesticides to the environment does not conform to the concept of sustainable development. Therefore, from a long-term development perspective, it is very necessary to explore a highly efficient, environmentally friendly pesticide that is not easy to develop drug resistance.

[0005] RNA interference is a method used to explore the genomic expression in cells. By introducing endogenous and exogenous double-strand RNA (dsRNA) into cells, they are then cleaved by Dicer nuclease into double-strand RNA (small interference RNA) of 21 - 23 bp. SiRNA can utilize its own mechanism to combine nuclease and helicase to construct an RNA-inducing silence complex (RISC) silencing complex, which can effectively inhibit the expression of the target gene

[16]

[17] , resulting in the expression level of the target protein being significantly lower than the normal level, ultimately leading to the loss of its corresponding physiological function

[13]

[14]

[15] . The RNAi method is widely used in biology, and its uniqueness lies in its rapidity, precision, stability, and heritability.

[0006] In this invention, Tetranychus urticae is used as the research object. After measuring the target gene sequences of six mainstream acaricides and designing primers, the corresponding dsRNA is synthesized. Through RNAi experiments by injection method, bioassays are carried out on the sensitive strain (SS) of Tetranychus urticae, and suitable RNAi molecular targets are screened out. Thus, a dsRNA targeting the GABA gene of Tetranychus urticae is provided for controlling Tetranychus urticae. Summary of the Invention

[0007] The purpose of this invention is to provide a dsRNA targeting the GABA gene of Tetranychus urticae and its application for controlling Tetranychus urticae.

[0008] To achieve the above purpose, this invention adopts the following technical solutions:

[0009] This invention provides a dsRNA targeting the GABA gene of Tetranychus urticae, and the dsRNA is a double-strand RNA composed of the nucleotide sequence shown in SEQ ID NO.1 as the sense RNA and its reverse complementary sequence as the antisense RNA.

[0010] This invention also provides the application of the above dsRNA, and the application includes at least one of the following:

[0011] 1) Controlling Tetranychus urticae or preparing a product for controlling Tetranychus urticae;

[0012] 2) Promoting the death of Tetranychus urticae or preparing a product for promoting the death of Tetranychus urticae;

[0013] 3) Inhibiting the growth of Tetranychus urticae or preparing a product for inhibiting the growth of Tetranychus urticae;

[0014] 4) Inhibiting the expression of the GABA gene in Tetranychus urticae or preparing a product for inhibiting the expression of the GABA gene in Tetranychus urticae.

[0015] The present invention also provides a composition for preventing and controlling Tetranychus urticae, and the composition includes the dsRNA as described above, and a miticide.

[0016] The present invention has at least the following beneficial effects:

[0017] The present invention provides dsRNA targeting the GABA gene of Tetranychus urticae, its preparation method and application; by injecting the dsRNA fragment into the abdomen of the mite through the injection method, the silencing effect on the target GABA gene is good, and the dsRNA specifically targeting the GABA of Tetranychus urticae has the efficient effect of targeting and degrading the GABA gene; after the dsRNA of the present invention realizes the silencing of the GABA gene, it can significantly enhance the miticidal effect of miticides on Tetranychus urticae. The dsRNA provided by the present invention has high targeting, low preparation cost and strong practicability. BRIEF DESCRIPTION OF THE DRAWINGS

[0018] In order to more clearly illustrate the technical solutions of the embodiments of the present invention, the drawings required for use in the description of the embodiments will be briefly introduced below. Obviously, the drawings in the following description are some embodiments of the present invention. For those of ordinary skill in the art, other drawings can be obtained based on these drawings without creative efforts.

[0019] Figure 1 Gel electrophoresis map of RNAi fragments of Tetranychus urticae (from left to right are 4 replicates of Glu-Cl1, VGSC and PSST respectively);

[0020] Figure 2 Gel electrophoresis map of RNAi fragments of Tetranychus urticae (from left to right are 4 replicates of Glu-Cl3, CHS1, SdhB and GABA respectively);

[0021] Figure 3 Survival rate experimental data of dsRNA-CHS1;

[0022] Figure 4 Survival rate experimental data of dsRNA-PSST;

[0023] Figure 5 Survival rate experimental data of dsRNA-VGSC;

[0024] Figure 6 Survival rate experimental data of dsRNA-GABA;

[0025] Figure 7 Survival rate experimental data of dsRNA-Glu-Cl1;

[0026] Figure 8 Survival rate experimental data of dsRNA-Glu-Cl3;

[0027] Figure 9 Experimental data on the survival rate of dsRNA-SdhB. Specific implementation manners

[0028] To make the objectives, technical solutions, and advantages of the embodiments of the present invention clearer, the technical solutions in the embodiments of the present invention will be clearly and completely described below. For those not specified in the embodiments, the conventional conditions or the conditions recommended by the manufacturer are followed. The reagents or instruments not specified by the manufacturer are all conventional products that can be obtained through commercial purchase.

[0029] It should be noted that, without conflict, the embodiments in the present application and the features in the embodiments may be combined with each other. The present invention will be described in detail below with reference to specific embodiments.

[0030] The experimental methods not specified in the following embodiments usually follow the conventional conditions, such as those described in "Molecular Cloning: A Laboratory Manual" (New York: Cold Spring Harbor Laboratory Press, 1989) or the operation methods described in the kits provided by the manufacturer.

[0031] Embodiment

[0032] This embodiment is used to specifically disclose the dsRNA fragment of the present invention, as follows:

[0033] SEQ ID NO.1

[0034] TAATACGACTCACTATAGGGAAGCACGTCACGGAATCTCACAAATCTTGGTAGATGCTGAGGTTGCCGACAAGATTTGGGTTCCAGATACATTTTTTGCCAATGAAAAACAAGCCTATTTTCACGAAGCTACAACCAAAAATACCTTTTTACGTATAAGCCATGATGGTCAAGTACTTCGAAGTATAAGATTAACGGTAACTGCAAGTTGTCCAATGAATTTACAATATTTTCCAATGGACAGGCAAAAGTGCAACATTGAAATTGAAAGTTATGGTTATTCAATGACGGATATAATTTACAATTGGGTTGATGAGAATGCAGTTAAAATTGATAGTAACTTGATGCTTCCTCAGTTCTCAATTGCCAGTATACGTCAAAGCTGGAAGTATATTAGTTTAACTACAGGAAATTATTCTCGTCTCATGTGCGAAATTCAGTTGACTCGAAGTATGGGCTATTACATGATTCAAATTTATGTTCCAGCAAGTTTAATTGTGATCATTAGTTGGGTCTCTTTTTGGCTTCATCGTAATGCAACACCGGCCCCTATAGTGAGTCGTATTA

[0035] It should be noted that whether the nucleotide sequence shown in SEQ ID NO.1 above or the double-stranded RNA composed of the nucleotide sequence shown in SEQ ID NO.1 above as sense RNA and its reverse complementary sequence as antisense RNA should be within the scope of protection of this patent application.

[0036] Example 2

[0037] This example is used to provide the method and its specific effects when the above SEQ ID NO.1 targets the GABA gene of Tetranychus urticae.

[0038] First, materials and methods

[0039] Tetranychus urticae has a fast growth rate, a very short life cycle, and a relatively strong tolerance to chemical pesticides. At present, the main method for controlling Tetranychus urticae is chemical control, but the "3R" problem it faces is a worldwide challenge. Chemical pesticides mainly act on targets at the protein level. Once the corresponding target genes mutate successfully, target resistance will occur, resulting in a decrease in the sensitivity of pests (mites) to chemical pesticides. RNAi technology can achieve the deletion of corresponding functional phenotypes by silencing the expression of corresponding genes at the RNA level. Therefore, the research on RNA pesticides is of great significance. Currently, the research on screening the corresponding RNAi targets of mainstream acaricides on the market is still blank. In this experiment, bioassays will be carried out on the sensitive strain of Tetranychus urticae using RNA interference technology to screen out the corresponding targets for subsequent research.

[0040] 1 Test strains of Tetranychus urticae

[0041] In 2015, an indoor sensitive variety of Tetranychus urticae (Tu-YN) was discovered in a rose garden in Kunming, Yunnan. To obtain the best growth effect, they were placed in a constant temperature and light incubator and cultivated under the conditions of a temperature of 26 ± 1 °C, a relative humidity of 55% - 75%, and a light and dark cycle of L:D = 16h:8h.

[0042] Fresh cowpea seedlings Vigna sesquipedalis were used in the laboratory to rear the Tetranychus urticae population, and water seals were used to isolate each population to avoid cross-contamination between populations. During this period, they had never been exposed to any chemical agents.

[0043] 2 Main reagents

[0044]

[0045] 3 Main instruments

[0046]

[0047]

[0048] 4 Preparation of common reagents

[0049] Prepare 50×TAE (electrophoresis buffer):

[0050] Add 900 mL of deionized water to 242 g of Tris and 37.2 g of Na2EDTA·2H2O, and let them dissolve completely. Then, measure 57.1 mL of glacial acetic acid and add it. After thorough mixing, adjust the pH to 8.5 with NaOH. Transfer the liquid to a 1 L volumetric flask, and finally make up the volume to 1000 mL with deionized water;

[0051] Prepare 1×TAE (electrophoresis buffer):

[0052] Measure 20 mL of 50× TAE with a graduated cylinder and pour it into a 1 L reagent bottle. Then add 980 mL of deionized water and stir vigorously until it is completely dissolved.

[0053] Prepare 1% agarose gel:

[0054] First, put 0.4 g of agar powder into 40 mL of 1× TAE aqueous solution, mix well, then place it in a microwave oven and heat for 1 min. Then add 0.4 μL of nucleic acid dye and mix thoroughly. Finally, pour it into an agarose gel mold and wait for it to solidify before use.

[0055] Prepare 2% water agar gel:

[0056] Dissolve 0.8 g of agar powder in 40 mL of deionized water, mix well, place it in a microwave oven and heat for 1 min, then pour it into a disposable petri dish to spread it completely, and let it stand at room temperature. Wait for it to solidify before use.

[0057] 5 Experimental methods

[0058] 5.1 Design of RNAi primers

[0059] According to the gene sequences of the six main types of acaricide target sites (CHS1, VGSC, Glu-Cl1, Glu-Cl3, PSST, SdhB, GABA) and green fluorescent protein (GFP) of Tetranychus urticae, use the PCR primer design software Primer 5.0 and the primer design website NCBI (www.ncbi.nlm.nih.gov) to design RNAi primers, and add the T7 promoter sequence (shown in bold) to the 5' end of the primers.

[0060] Table 1 Primer sequences of RNAi fragments

[0061]

[0062]

[0063] 5.2 Extraction of total RNA from Tetranychus urticae (Trizol method)

[0064] Pick about 100 adult female Tetranychus urticae for the extraction of total RNA. The following are the specific operation steps:

[0065] (1) Clean the fume hood in the laboratory with alcohol, and then light the alcohol lamp to ensure the disinfection and sterilization of the experimental operation table.

[0066] (2) Put the collected Tetranychus urticae into a 1.5 mL enzyme-free centrifuge tube, then add 150 μL of Trizol, grind it with a tissue grinder treated with DEPC in liquid nitrogen, and then wash the residue on the grinding rod with 350 μL of Trizol to make it fully dissolved and let it stand at room temperature for 5 min;

[0067] (3) Pour 100 μL of chloroform into the enzyme-free centrifuge tube and stir vigorously for 15 s to ensure that the liquid is completely uniform, and then store it at room temperature for 15 min;

[0068] (4) Use a 4 °C low-temperature centrifuge to centrifuge at a speed of 13000 rpm for 15 minutes, and transfer the supernatant to a new 1.5 mL enzyme-free centrifuge tube;

[0069] (5) Pour the same volume of isopropanol into the centrifuge tube, shake it evenly, then put the liquid into a -20 °C refrigerator and maintain it for 20 min;

[0070] (6) Put the sample into a 4 °C low-temperature centrifuge and run it at a speed of 13000 rpm for 10 min, then slowly pour out the supernatant and retain the precipitate;

[0071] (7) Pour 500 μL of pre-cooled 75% ethanol into the enzyme-free centrifuge tube, and then repeatedly pipette gently with a pipette until the precipitate is completely dissolved;

[0072] (8) Put the enzyme-free centrifuge tube into a 4 °C low-temperature centrifuge and centrifuge at a high speed of 13000 rpm for 10 min, then pour out the supernatant;

[0073] (9) Let the sample after high-speed centrifugation stand for 15 min to dry it;

[0074] (10) After the ethanol has fully volatilized, add 30 μL of RNase-Free H2O, and gently pipette to completely dissolve and mix the precipitate;

[0075] (11) Put 2 μL of the RNA sample into a multifunctional microplate reader for detection. The value of OD260 / OD230 of the sample should be greater than 2, and the value of OD260 / OD280 should be in the range of 1.8 - 2.0;

[0076] (12) Add 1 μL of 6×Buffer loading buffer to 5 μL of the RNA sample, mix it well, then perform electrophoresis with 1% agarose gel. After detecting and confirming that the integrity of the RNA meets the requirements, store it in a -80 °C refrigerator.

[0077] 5.3 Removal of genomic DNA from total RNA

[0078] According to the instructions of the RQ1 RNase-Free DNase kit, perform the operations on an ice box according to the specified experimental steps:

[0079]

[0080] Among them, after adding RNase-Free Water, it needs to react at 37 °C for 30 min, and after adding DNase Stop Solution, it needs to react at 65 °C for 10 min. After the reaction, the solution system is stored at -20 °C.

[0081] 5.4 Reverse transcription to synthesize cDNA

[0082] According to the instructions of the Prime ScriptTM RT reagent Kit DRR037A, perform the operations according to the following steps:

[0083] (1) Add the following reagents in sequence for the reaction (operate on ice);

[0084]

[0085] (2) After shaking and mixing evenly, put it into a PCR instrument, and set the program as: 37 °C, 15 min; 85 °C, 5 s;

[0086] (3) Store at -20 °C.

[0087] 5.5 Synthesis of RNAi fragments

[0088] (1) Add the following reagents in sequence for the reaction;

[0089]

[0090] (2) Set the program of the PCR instrument;

[0091]

[0092]

[0093] (2) Perform electrophoresis through an agarose gel electrophoresis instrument and take pictures using a gel imaging analyzer.

[0094] 5.6 Recovery of PCR products

[0095] According to the instructions of the centrifugal column type DNA purification and recovery kit, perform the gel recovery experiment according to the following operation steps:

[0096] (1) Cut the single band containing the target DNA fragment from the gel in sequence and put it into a 1.5 mL centrifuge tube, weigh it with a precision balance and record it;

[0097] (2) Add Binding Buffer in proportion to the mass of the gel block measured previously, place at 50°C, and allow them to melt completely. During this process, stir and mix every 3 minutes.

[0098] (3) Place the adsorption column C1 into the collection tube, add 500 μL of the equilibrium solution BL into it, and then centrifuge at 12,000 rpm for 1 min. Finally, drain the waste liquid in the collection tube;

[0099] (4) Place the melted agarose-DNA into the adsorption column and centrifuge at 12,000 rpm for 1 min, and finally drain the waste liquid in the collection tube;

[0100] (5) Add 300 μL Binding Buffer and centrifuge at 12,000 rpm for 1 min to drain the waste liquid in the collection tube;

[0101] (6) Add 700 μL of SPWWashing Buffer to the container and centrifuge at 12,000 rpm for 1 min, then drain the collected waste liquid;

[0102] (7) Repeat the previous operation steps;

[0103] (8) Centrifuge the empty column at 12,000 rpm for 2 min, then transfer the adsorption column into a new centrifuge tube and let it stand for 5 min;

[0104] (9) Add 30 μL of Elution Buffer to the center of the adsorption column, let it stand at room temperature for 2 min, centrifuge at 12000 rpm for 2 min, and finally collect the DNA product;

[0105] (10) The DNA concentration was measured using a multifunctional microplate reader and then stored in a -20 °C refrigerator for ready use.

[0106] 5.7 Synthesis and purification of dsRNA

[0107] According to the instructions of the TranscriptAid T7 HighYield TranscmptionKit, dsRNA was synthesized and purified according to the following steps:

[0108] 5.7.1 Synthesis of dsRNA

[0109] (1) Add the following reaction systems (20 μL) in sequence;

[0110]

[0111] (2) Incubate at 37°C for 4 - 6 h after mixing and centrifuging.

[0112] 5.7.2 Purification of dsRNA

[0113] (1) Add 2 μL of DNase I to the reaction system, mix well, and place it in a PCR instrument. Set the temperature to 37°C and the reaction time to 15 min.

[0114] (2) Add 2 μL of EDTA to the reaction system, stir evenly, place it in a PCR instrument, adjust the temperature to 65°C, and maintain the reaction time for 10 minutes.

[0115] (3) In a 1.5 mL enzyme-free centrifuge tube, add 115 μL of RNase-Free Water and 15 μL of sodium acetate with a pH of 5.2 to ensure complete equilibrium of the reaction system.

[0116] (4) Mix the freshly prepared chloroform / phenol mixture with a volume ratio of 1:1 and 300 μL of chloroform at a ratio of 1:2. Then place the mixture in a centrifuge at 4°C and centrifuge at a high speed of 13000 rpm for 10 min.

[0117] (5) Pour the supernatant into a new enzyme-free centrifuge tube and add 350 μL of absolute ethanol to it to mix them completely. Then place them in a -20°C refrigerator for 1 h.

[0118] (6) Transfer the sample to a centrifuge at 4°C and centrifuge at a high speed of 12000 rpm for 10 min, and finally pour out the supernatant.

[0119] (7) Add 500 μL of pre-cooled 70% ethanol, gently pipette to dissolve the precipitate completely, place it in a centrifuge at 4°C, centrifuge at a high speed of 10000 rpm for 5 min, and then pour out the supernatant.

[0120] (8) After standing, add 50 μL of enzyme-free water, dissolve it completely and stir thoroughly to mix the dsRNA evenly.

[0121] (9) Dilute 1 μL of the sample 10-fold with 9 μL of RNase-Free Water, and then use a multifunctional microplate reader to detect the concentration. The OD260 / OD230 value of the sample should be greater than 2, and the OD260 / OD280 value should be in the range of 1.8 - 2.0.

[0122] (10) Adjust the concentration of the purified dsRNA to 1000 ppm, 100 ppm, and 10 ppm with deionized water, and store it in an -80°C refrigerator.

[0123] 5.8 Injection Method RNAi Experiment

[0124] (1) Sterilize the washed sponge and petri dish in an autoclave. Add an appropriate amount of water to make them fully absorb the water and keep the water level at 2 / 3 of the petri dish. Then, cut a 1 / 4 filter paper and fix it on the sponge;

[0125] (2) Select complete leaves from healthy cowpea seedlings, cut them into 2×2 cm squares, and place them on the filter paper to ensure the surface is flat and undamaged;

[0126] (3) After obliquely cutting the 2% water agar gel to the width of the glass slide with a blade, take two pieces of gel as the upper slope and the lower bottom. Make the two pieces of gel stick together neatly (without gaps at the joint), then place them on the glass slide and cut off the excess gel;

[0127] (4) Select healthy adult female two-spotted spider mites at 3 - 5 days old, gently pick them with a No. 0 brush to the joint of the gel (pay attention not to stick the mite legs to the gel), make their ventral side face up, and their back stick tightly to the gap between the two pieces of gel for easy injection;

[0128] (5) Put the borosilicate glass capillary glass tube into the needle puller, measure the Ramp value as 487, and set the parameters as Heat 500, Pull 100, Velocity 100, Time 100, Pressure 100 for pulling the needle;

[0129] (6) Obliquely cut the pulled needle with a blade under the microscope. The size of the cut should be much smaller than the size of the mite (which can minimize the mechanical damage to the mite caused by injection), and the larger the oblique angle of the cut, the easier it is to inject;

[0130] (7) Use dsRNA-CHS1, dsRNA-VGSC, dsRNA-Glu-Cl1, dsRNA-Glu-Cl3, dsRNA-PSST, dsRNA-SdhB, dsRNA-GABA at a concentration of 10 ppm as the experimental groups, and use dsRNA-GFP and ddH2O at the corresponding concentrations as the control groups for injection. There are 5 biological replicates in each group experiment, and 50 adult female mites are injected in each replicate;

[0131] (8) Gently pick the injected mites onto the leaf discs, and examine them under the microscope. Pick off the mites that cannot move normally or are severely mechanically damaged by the injection from the leaf discs;

[0132] (9) Record the total number, survival number, and death number of mites at 6h, 12h, 24h, 48h, 96h, and 144h after injection, and perform data processing.

[0133] Second, Results and Analysis

[0134] 1 Gel Imaging Analysis of RNAi Fragments

[0135] By using 1% agarose gel, we can effectively extract the RNAi fragments of Tetranychus urticae. The success or failure of this step will directly affect the research results (such as Figure 1 and Figure 2 ). In addition, we can also evaluate the integrity of the fragment through gel imaging technology.

[0136] Figure 1 Except for the last band of Glu-Cl1 being darker, other visible clear DNA bands prove that the integrity of the RNAi fragment is good. A multifunctional microplate reader was used to detect the purity of the extracted RNAi fragment, and the ratio of OD260 / OD280 was between 1.8 and 2.0, indicating that the purity of the extracted RNAi fragment of Tetranychus urticae is good.

[0137] Figure 2 In, the second band without the target gene of Glu-Cl3 may be due to mistakes in the reverse transcription operation. The first band of SdhB without any band may be due to mistakes in the sample loading operation after total RNA extraction. The remaining bands are all clear and obvious, indicating that the integrity of its RNAi fragment is good. A multifunctional microplate reader was used to detect the purity of the extracted RNAi fragment, and the ratio of OD260 / OD280 was between 1.8 and 2.0, indicating that the purity of the extracted RNAi fragment of Tetranychus urticae is good.

[0138] 2 Data Analysis of RNAi Experiments by Injection Method

[0139] In this experiment, ddH2O and dsRNA-GFP (10 ppm) were used as the control groups, and dsRNA-CHS1, dsRNA-VGSC, dsRNA-Glu-Cl1, dsRNA-Glu-Cl3, dsRNA-PSST, dsRNA-SdhB, dsRNA-GABA at a concentration of 10 ppm were used as the experimental groups to conduct RNAi experiments by the injection method.

[0140] The following is the data analysis of the RNAi experiments corresponding to 7 targets:

[0141] Figure 3 In the experimental group of dsRNA-CHS1 (10 ppm), the overall survival rate was lower than that of the control group of dsRNA-GFP (10 ppm), but the survival rate was still about 40% at 144 h after injection. After SPSS analysis, it was found that the lethal effect was not significant. Based on the above data, it was found that the lethal effect of dsRNA-CHS1 on Tetranychus urticae was not significant. Therefore, it was judged that CHS1 could not be an ideal RNAi target.

[0142] Figure 4 In the experimental group, the overall survival rate of dsRNA-PSST (10 ppm) was higher than that of the control group dsRNA-GFP (10 ppm). The survival rate was still as high as about 70% at 144 h after injection, and the lethal effect was not ideal. However, after SPSS analysis, it was found that the lethal effect was not significant. Based on the above data, it was found that the lethal effect of dsRNA-PSST on Tetranychus urticae was not significant. Therefore, it was judged that PSST could not be an ideal RNAi target.

[0143] Figure 5 In the experimental group, the overall survival rate of dsRNA-VGSC (10 ppm) was significantly lower than that of the control group dsRNA-GFP (10 ppm). The survival rate was as low as about 20% at 144 h after injection. After SPSS analysis, it was found that the lethal effect was significant at all time periods except 24 h and 48 h after injection. Based on the above data, it was found that the lethal effect of 10 ppm dsRNA-VGSC on Tetranychus urticae was significant. Therefore, it was judged that 10 ppm VGSC had the potential for further development.

[0144] Figure 6 In the experimental group, the overall survival rate of dsRNA-GABA (10 ppm) was significantly lower than that of the control group dsRNA-GFP (10 ppm). The survival rate was as low as about 20% at 144 h after injection. After SPSS analysis, it was found that the lethal effect was significant at all time periods except 6 h after injection. Based on the above data, it was found that the lethal effect of 10 ppm dsRNA-GABA on Tetranychus urticae was significant. Therefore, it was judged that 10 ppm GABA had the potential for further development.

[0145] Figure 7 In the experimental group, the overall survival rate of dsRNA-Glu-Cl1 (10 ppm) was significantly lower than that of the control group dsRNA-GFP (10 ppm). The survival rate was as low as about 30% at 144 h after injection. After SPSS analysis, it was found that the lethal effect was significant at all time periods except 6 h after injection. Based on the above data, it was found that the lethal effect of 10 ppm dsRNA-Glu-Cl1 on Tetranychus urticae was significant. Therefore, it was judged that 10 ppm Glu-Cl1 had the potential for further development.

[0146] Figure 8 In the experimental group, although the overall survival rate of dsRNA-Glu-Cl3 (10 ppm) was lower than that of the control group dsRNA-GFP (10 ppm), the survival rate was about 35% at 144 h after injection. However, after SPSS analysis, it was found that its lethal effect was not significant. Therefore, it was judged that Glu-Cl3 could not be an ideal RNAi target.

[0147] Figure 9Although the overall survival rate of the experimental group dsRNA-SdhB (10 ppm) was lower than that of the control group dsRNA-GFP (10 ppm), the survival rate was about 40% at 144 h after injection. However, after SPSS analysis, it was found that its lethal effect was not significant. Therefore, it was determined that SdhB could not be an ideal RNAi target.

[0148] In summary, dsRNA-GABA had the highest lethal effect on Tetranychus urticae, and the difference was the most significant compared with the control, so it could be used for the final control of Tetranychus urticae.

[0149] The embodiment of the present application provides a dsRNA targeting the GABA gene of Tetranychus urticae as described in Example 1, its preparation method and application. By injection, the dsRNA fragment was injected into the abdomen of the mite, and it had a good silencing effect on the target GABA gene. The dsRNA specifically targeting GABA of Tetranychus urticae had an efficient effect of targeting and degrading the GABA gene.

[0150] The above shows and describes the basic principles, main features and advantages of the present invention. Those skilled in the art should understand that the present invention is not limited by the above embodiments. The above embodiments and the principles described in the specification are only the principles of the present invention. Without departing from the spirit and scope of the present invention, the present invention will have various changes and improvements, and these changes and improvements all fall within the scope of the present invention claimed. The scope of protection claimed by the present invention is defined by the appended claims and their equivalents.

Claims

1. A dsRNA targeting the GABA gene of Tetranychus urticae, characterized in that, The dsRNA is a double-stranded RNA composed of a nucleotide sequence shown in SEQ ID NO.1 as the sense RNA and its reverse complementary sequence as the antisense RNA.

2. Use of the dsRNA according to claim 1, characterized in that, The applications include at least one of the following: 1) Controlling Tetranychus urticae or preparing a product for controlling Tetranychus urticae; 2) Promoting the death of Tetranychus urticae or preparing a product for promoting the death of Tetranychus urticae; 3) Inhibiting the growth of Tetranychus urticae or preparing a product for inhibiting the growth of Tetranychus urticae.

3. A composition for preventing and controlling Tetranychus urticae, characterized in that, The composition includes the dsRNA as described in claim 1, and a miticide.

4. The preparation method of the dsRNA targeting the GABA gene of Tetranychus urticae, characterized in that, Comprising the following steps: S1. Extracting the total RNA of Tetranychus urticae; S2. Removing genomic DNA from the total RNA; S3. Reverse-transcribing to synthesize cDNA; S4. Synthesizing RNAi fragments; S5. Recovering the PCR product; S6. Synthesizing and purifying dsRNA.

5. The method according to claim 4, characterized in that Before step S1, the following steps are further included: Design RNAi primers. According to the target GABA gene of Tetranychus urticae and the gene sequence of green fluorescent protein GFP, design RNAi primers and add the T7 promoter sequence to the ends; the primers include RNAi-GABA-F and RNAi-GABA-R; The sequence of RNAi-GABA-F is: TAATACGACTCACTATAGGGAAGCACGTCACGGAATCTCA; The sequence of RNAi-GABA-R is: TAATACGACTCACTATAGGGGCCGGTGTTGCATTACGATG.

6. The method according to claim 4, characterized in that In the said S1, extracting the total RNA of Tetranychus urticae includes: Cleaning the fume hood in the laboratory with alcohol, and then lighting the alcohol lamp to ensure the disinfection and sterilization of the experimental operation table; Putting the collected Tetranychus urticae into an enzyme-free centrifuge tube, then adding Trizol, grinding with a tissue grinder treated with DEPC in liquid nitrogen, and then washing the residue on the grinding rod with Trizol, allowing it to dissolve fully and standing at room temperature; Pouring chloroform into the enzyme-free centrifuge tube and stirring vigorously to ensure that the liquid is completely uniform, and then storing it at room temperature; Centrifuging for 15 minutes using a low-temperature centrifuge, and transferring the supernatant to a new enzyme-free centrifuge tube; Pouring the same volume of isopropanol into the centrifuge tube, shaking it evenly, and then putting the liquid into the refrigerator and maintaining it; Centrifuging the sample in a low-temperature centrifuge, and then slowly pouring out the supernatant, retaining the precipitate; Pouring pre-cooled ethanol into the enzyme-free centrifuge tube, and then gently pipetting repeatedly with a pipette until the precipitate is completely dissolved; Putting the enzyme-free centrifuge tube into a low-temperature centrifuge for high-speed centrifugation, and then pouring out the supernatant; Letting the sample after high-speed centrifugation stand to dry it; Adding RNase-Free H2O after the ethanol has fully volatilized, gently pipetting to completely dissolve and mix the precipitate; Putting the RNA sample into a multi-functional microplate reader for detection; Adding 6×Buffer loading buffer to the RNA sample, mixing it thoroughly, and then performing electrophoresis using agar gel. After detecting and confirming that the integrity of the RNA meets the requirements, storing it in the refrigerator.

7. The method according to claim 4, characterized in that, In the said S5, recovering the PCR product includes: Sequentially cutting the single band containing the target DNA fragment from the gel and putting it into a centrifuge tube, weighing it with a precision balance and recording; According to the previously measured mass of the agarose gel blocks, add Binding Buffer in proportion, place them at a temperature of 40 - 60 °C, and let them melt completely. During this process, stir and mix evenly every 2 - 4 minutes; Put adsorption column C1 into the collection tube, then add equilibration buffer BL to it, then centrifuge, and finally drain the waste liquid in the collection tube; Put the melted agarose - DNA into the adsorption column, perform high - speed centrifugation, and finally drain the waste liquid in the collection tube; Add Binding Buffer and perform high - speed centrifugation, and finally drain the waste liquid in the collection tube; Add SPW Washing Buffer to the container, perform high - speed centrifugation, and then drain the collected waste liquid; Repeat the previous operation step; Centrifuge the empty column at high speed, then transfer the adsorption column to a new centrifuge tube and let it stand; Suspend and add Elution Buffer to the center of the adsorption column. After letting it stand at room temperature, centrifuge, and finally collect the DNA product; Measure the concentration of DNA with a multi - functional microplate reader, and then store it in the refrigerator for use at any time.

8. The method according to claim 4, characterized in that, In step S6, synthesize and purify dsRNA, including the synthesis of dsRNA. The synthesis of dsRNA includes the following steps: Sequentially add the following reaction system: 5xTranscript Aid Reaction Buffer, ATP / CTP / GTP / UTP, cDNA, Transcript Aid Enzyme Mix, RNase - Free Water; Mix well, centrifuge, and then incubate.

9. The method according to claim 4, characterized in that, In step S6, synthesize and purify dsRNA, including the purification of dsRNA. The purification of dsRNA includes the following steps: Add DNase I to the reaction system, mix it well, and then place it in a PCR instrument for reaction; Add EDTA to the reaction system, stir evenly, and then place it in a PCR instrument for reaction; In a DNase - free centrifuge tube, add RNase - Free Water and sodium acetate to ensure the complete balance of the reaction system; Mix the chloroform / phenol mixture with chloroform, and then place the mixture in a centrifuge for high - speed centrifugation; Pour the supernatant into a new DNase - free centrifuge tube, add absolute ethanol to it, mix them completely, and then place them in a refrigerator at - 20 °C for refrigeration for 1 h; Transfer the sample to the centrifuge for high - speed centrifugation, and finally pour off the supernatant; Add pre - cooled ethanol, slowly pipette and blow the precipitate to completely dissolve it, then place it in a centrifuge for high - speed centrifugation, and then pour off the supernatant; After it stands, add DNase - free water to completely dissolve it and stir thoroughly to make the dsRNA evenly mixed; Dilute the sample with RNase - Free Water, and then use a multi - functional microplate reader to detect the concentration; Adjust the concentration of the purified dsRNA with deionized water and store it in the refrigerator.

Citation Information

Patent Citations

  • Insecticidal and acaricidal composition, and application thereof

    CN105028441A

  • Tetranychus urticae feeding related gene SSGP2970 and application thereof

    CN118006621A