A modified sgRNA and its application in gene expression regulation

By designing base complementary pairing regions between sgRNAs to form a stem loop structure, stably binding and guided to the DNA region, the problem of structural instability of sgRNA in gene expression regulation is solved, the stability of gene expression and the immediate adjacent effect between enhancer and promoter are achieved, and gene expression is significantly upregulated.

CN119530228BActive Publication Date: 2025-07-11FOURTH MILITARY MEDICAL UNIVERSITY
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202411746259.0
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2024-11-29
Publication Date
2025-07-11
Estimated Expiration
2044-11-29

AI Technical Summary

Technical Problem

The existing modified sgRNAs are structurally unstable in gene expression regulation, resulting in instability of mediated gene expression levels or poorer effects.

Method used

The design of a base complementary pairing region between the two sgRNAs is to enable them to bind stably and form a stem loop structure. It is directed to the DNA region targeting different sites through the CRISPR system, so that the enhancer and promoter are spatially close to each other and enhance gene expression.

Benefits of technology

It improves the stability of gene expression and the interaction between enhancer and promoter, significantly upregulates gene expression levels, and provides an effective means of regulating gene expression.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN119530228B_ABST
    Figure CN119530228B_ABST
Patent Text Reader

Abstract

The present invention provides a modified sgRNA and its application in gene expression regulation. The modified sgRNA includes a first sgRNA and a second sgRNA. The nucleotide sequence of the first sgRNA is shown as SEQ ID NO: 2, and the nucleotide sequence of the second sgRNA is shown as SEQ ID NO: 3. The present invention provides that by designing a sequence, there is a region of base complementary pairing between the two sgRNAs. This base complementary sequence can connect the two sgRNAs targeting different sites, and can keep the structures and functions of the two sgRNAs stable. In the modified sgRNA, the two sgRNAs targeting different sites (the first sgRNA and the second sgRNA) bring two gene sites (enhancer and promoter) close to each other spatially, thereby achieving the purpose of up-regulating gene expression.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to the field of biotechnology, and particularly to a modified sgRNA and its application in gene expression regulation. Background Art

[0002] The CRISPR / Cas system is an acquired immune system currently found in most bacteria and the vast majority of archaea. It can recognize and eliminate foreign plasmids or phages and leave foreign gene fragments in its own genome as immune memory. Naturally occurring CRISPR-Cas systems are divided into two major categories: the first category uses multi-protein complexes for nucleic acid cleavage, and the second category uses single-protein effector domains for cleavage. Due to the advantages provided by single-protein effector domains, the second category of CRISPR-Cas systems is the most widely used CRISPR tool for biological research and translational applications. It is further subdivided into three types: II, V, and VI, each of which uses a different type of Cas protein. Among the Cas proteins from the second category of CRISPR-Cas systems, certain type II Cas9 and type V Cas12 have RNA-guided DNA endonuclease activity, while type VI Cas13 seems to show preferential RNA targeting and cleavage activity.

[0003] The CRISPR-Cas9 technology has developed into an efficient genome editing tool and has been widely applied to many tissues and cells. The inactivated Cas9 (dCas9) and its related single-guide RNA (sgRNA) in the CRISPR-Cas9 system have been most widely used in recent years to regulate gene expression.

[0004] There are already related reports in the prior art on modifying sgRNA to activate gene expression. However, after the sgRNA is modified, the structural stability of the modified sgRNA is poor, resulting in unstable gene expression levels mediated by the modified sgRNA or poor effects in enhancing gene expression. Summary of the Invention

[0005] In order to solve the problem in the prior art that the gene expression level mediated by the modified sgRNA is unstable or the effect in enhancing gene expression is poor when modifying the sgRNA, the present invention provides a modified sgRNA and its application in gene expression regulation.

[0006] According to the first aspect of the present invention, there is provided a modified sgRNA, which includes a first sgRNA and a second sgRNA. The nucleotide sequence of the first sgRNA is as shown in SEQ ID NO: 2, and the nucleotide sequence of the second sgRNA is as shown in SEQ ID NO: 3.

[0007] Preferably, both the first sgRNA and the second sgRNA have a stem-loop structure.

[0008] Preferably, there is a complementary pairing region between the first sgRNA and the second sgRNA; the 23rd to 27th bases in the nucleotide sequence of the first sgRNA form a first complementary pairing region with the 184th to 188th bases in the nucleotide sequence of the second sgRNA; the 30th to 43rd bases in the nucleotide sequence of the first sgRNA form a second complementary pairing region with the 166th to 179th bases in the nucleotide sequence of the second sgRNA; the 66th to 98th bases in the nucleotide sequence of the first sgRNA form a third complementary pairing region with the 98th to 130th bases in the nucleotide sequence of the second sgRNA; the 99th to 112th bases in the nucleotide sequence of the first sgRNA form a fourth complementary pairing region with the 31st to 44th bases in the nucleotide sequence of the second sgRNA; the 117th to 121st bases in the nucleotide sequence of the first sgRNA form a fifth complementary pairing region with the 24th to 28th bases in the nucleotide sequence of the second sgRNA.

[0009] Preferably, in the nucleotide sequence of the first sgRNA, the 44th to 52nd bases form a sixth complementary pairing region with the 57th to 65th bases, the 124th to 126th bases form a seventh complementary pairing region with the 132nd to 134th bases, the 127th base forms an eighth complementary pairing region with the 130th base, the 141st to 144th bases form a ninth complementary pairing region with the 149th to 152nd bases, and the 154th to 159th bases form a tenth complementary pairing region with the 163rd to 168th bases.

[0010] Preferably, in the nucleotide sequence of the second sgRNA, the 45th to 53rd bases form an eleventh complementary pairing region with the 58th to 66th bases, the 67th to 77th bases form a twelfth complementary pairing region with the 86th to 97th bases, the 80th to 85th bases form a thirteenth complementary pairing region with the 146th to 151st bases, and the 131st to 143rd bases form a fourteenth complementary pairing region with the 153rd to 165th bases.

[0011] Preferably, in the first sgRNA, the 53rd to 56th bases form a first loop region, the 128th to 129th bases form a second loop region, the 146th to 147th bases form a third loop region, and the 160th to 136th bases form a fourth loop region.

[0012] Preferably, in the second sgRNA, the bases at positions 54 to 57 form a fifth loop region, the bases at positions 78 to 79 form a sixth loop region, the bases at positions 144 to 145 form a seventh loop region, the bases at positions 195 to 196 form an eighth loop region, the bases at positions 213 to 214 form a ninth loop region, and the bases at positions 227 to 229 form a tenth loop region.

[0013] Preferably, the secondary structure of the above-mentioned modified sgRNA is as follows:

[0014]

[0015] Preferably, the above-mentioned modified sgRNA is prepared by the following steps: the first sgRNA and the second sgRNA are synthesized separately, and after mixing the first sgRNA and the second sgRNA, they are incubated at 90 °C for 3 min to obtain the modified sgRNA.

[0016] According to the second aspect of the present invention, there is provided the application of the above-mentioned modified sgRNA in gene expression regulation.

[0017] According to the third aspect of the present invention, there is provided a method for upregulating gene expression, comprising the following steps: transferring the above-mentioned modified sgRNA and dCas9 protein into cells through the CRISPR system.

[0018] According to the fourth aspect of the present invention, there is provided a CRISPR system, which comprises the above-mentioned modified sgRNA.

[0019] Advantages of the present invention:

[0020] 1. Based on the sequence and structure of the sgRNA used in the existing CRISPR-Cas9 system, the present invention designs a sequence such that there is a region of base complementary pairing between two sgRNAs (the first sgRNA and the second sgRNA). This base complementary sequence can connect the two sgRNAs targeting different sites, and can keep the structures and functions of the two sgRNAs stable. The first sgRNA and the second sgRNA targeting different sites in the modified sgRNA can spontaneously bind and assemble, and finally the modified sgRNA provided by the present invention is obtained.

[0021] 2. When the modified sgRNA provided by the present invention is used in the CRISPR implementation reaction, the gNide regions on both sides will guide the binding of two targeted DNA regions. Since the two sgRNAs (the first sgRNA and the second sgRNA) targeting different sites in the modified sgRNA are bound together, the two gene loci (enhancer and promoter) can be brought close to each other in space, thereby achieving the purpose of upregulating gene expression. This is of great significance for gene expression regulation and provides certain guiding directions and ideas for the research on gene expression regulation.

[0022] 3. When the modified sgRNA provided by the present invention is applied to gene expression regulation or the CRISPR system, the sgRNA can bring the enhancer and promoter of the target gene close to each other in space, thereby enhancing the expression of the target gene. BRIEF DESCRIPTION OF THE DRAWINGS

[0023] Figure 1 It is a schematic diagram of the existing CRISPR-Cas9 system.

[0024] Figure 2 It is a schematic diagram of the structure of the sgRNA used in the existing CRISPR-Cas9 system.

[0025] Figure 3 It is the principle of action of the sgRNA, the targeted gene sequence, and the Cas protein in the existing CRISPR-Cas9 system.

[0026] Figure 4 It is a schematic diagram of the structure of the modified sgRNA provided in Example 1.

[0027] Figure 5 It is a labeled result diagram of the directions, complementary pairing regions, and stem-loop structures of the first sgRNA and the second sgRNA contained in the modified sgRNA provided in Example 1.

[0028] Figure 6 It is a schematic diagram of the specific binding mode of the first sgRNA and the second sgRNA targeting different sites respectively contained in the modified sgRNA provided in Example 2.

[0029] Figure 7 It is a schematic diagram of the experimental principle for verifying the role of the modified sgRNA provided in Example 1 in gene expression regulation in Example 3.

[0030] Figure 8 It is the original plasmid map used in the reporter gene plasmid during the verification experiment in Example 3.

[0031] Figure 9The step diagram for constructing a reporter gene plasmid by homologous recombination and detecting the expression level of the reporter gene in cells using the reporter gene plasmid during the verification experiment for Example 3.

[0032] Figure 10 The map of the Renilla luciferase reporter gene plasmid used during the experimental verification process for Example 3.

[0033] Figure 11 The fluorescence intensity result diagram for detecting the role of the modified sgRNA provided in Example 1 in gene expression regulation in Example 3.

[0034] Figure 12 The atomic force microscopy detection result diagram for detecting the role of the modified sgRNA provided in Example 1 in gene expression regulation in Example 3.

[0035] Figure 13 The structural schematic diagram of the modified sgRNA provided in Comparative Example 1.

[0036] Figure 14 The structural schematic diagram of the modified sgRNA provided in Comparative Example 2.

[0037] Figure 15 The electrophoresis result diagram for detecting the modified sgRNAs provided in Example 1, Comparative Example 1, and Comparative Example 2 using polyacrylamide gel electrophoresis.

[0038] Figure 16 The atomic force microscopy detection result diagram for detecting the role of the modified sgRNAs provided in Example 1, Comparative Example 1, and Comparative Example 2 in gene expression regulation. Detailed implementation manners

[0039] The following further clearly and completely describes the technical features in the technical solutions provided by the present invention in conjunction with the detailed implementation manners. Obviously, the described embodiments are only a part of the embodiments of the present invention, rather than all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative efforts fall within the scope of protection of the present invention.

[0040] Example 1

[0041] The existing CRISPR-Cas9 system such as Figure 1As shown, the CRISPR-Cas9 system contains three components: (1) the targeted gene sequence; (2) the RNA sequence called single guide RNA (abbreviated as sgRNA); (3) the effector protein called dCas9 protein, which is derived from Cas9 and is a variant of Cas9. It is obtained by mutating two active cleavage sites in Cas9. Therefore, the dCas9 protein does not have endonuclease activity and can only bind to the target gene and cannot cleave the target gene.

[0042] In the existing CRISPR-Cas9 system, the nucleotide sequence of the sgRNA (the original sgRNA) used is shown in SEQ ID NO: 1, and the structure is as Figure 2 shown.

[0043] SEQ ID NO: 1

[0044] NNNNNNNNNNNNNNNNGNNNCAGAGCNAGAAANAGCAAGNNGAAANAAGGCNAGNCCGNNANCAACNNGAAAAAGNGGCACCGAGNCGGNGCNN

[0045] Note: In SEQ ID NO: 1, except for the first 16 bases, the remaining base "N" represents the base U.

[0046] The working principles of sgRNA, the targeted gene sequence, and the Cas protein in the CRISPR-Cas9 system are as Figure 3 shown. The 5'-end of the original sgRNA and the targeted gene have a complementary pairing region with a length of 20 nt. This region is marked as "Target region" in the figure, and there is a sequence of NGG (PAM) downstream of this Target region, so that the Cas9 protein can recognize the sgRNA and the sgRNA can be complementary paired with the targeted gene (Target region).

[0047] Table 1 Nucleotide sequences of the first sgRNA and the second sgRNA contained in the modified sgRNA in Example 1

[0048]

[0049] Note: In SEQ ID NO: 2 and SEQ ID NO: 3, the base "N" represents the base U.

[0050] Based on the sequence and structure of the sgRNA in the above-mentioned existing CRISPR-Cas9 system, the original sgRNA is modified to obtain a modified sgRNA. The modified sgRNA includes a first sgRNA and a second sgRNA. The nucleotide sequences of the first sgRNA and the second sgRNA are shown in Table 1. Among them, the nucleotide sequence of the first sgRNA is shown in SEQ ID NO: 2, and the nucleotide sequence of the second sgRNA is shown in SEQ ID NO: 3.

[0051] Table 2 sgRNA Secondary Structure Assembly Reaction System

[0052] Component Concentration Volume First sgRNA 5 μM 5 μL Second sgRNA 5 μM 5 μL dCas9 Reaction Buffer 10× 5 μL H2O / 35 μL Total System / 50 μL

[0053] The above-mentioned modified sgRNA is prepared through the following steps: The first sgRNA and the second sgRNA are synthesized separately. According to the sgRNA secondary structure assembly reaction system shown in Table 2, the first sgRNA, the second sgRNA, and 10×dCas9 reaction Buffer (pH 6.5, containing 200 mM HEPES, 50 mM MgCl2, 1 M NaCl, 1 mM EDTA) are mixed and then placed in a 90°C metal bath and heated for 3 min. Subsequently, it is taken out and placed at room temperature for 5 min to obtain an RNA assembly molecule with a final concentration of 500 nM, which is the modified sgRNA provided by the present invention. Its sequence and secondary structure are as Figure 4 shown.

[0054] In the modified sgRNA, both the first sgRNA and the second sgRNA have stem-loop structures. In order to facilitate the analysis of the sequences and structures of the first sgRNA and the second sgRNA in the modified sgRNA, the directions, complementary pairing regions, and stem-loop structures of the first sgRNA and the second sgRNA in the modified sgRNA are marked. The results are as Figure 5 shown, where the blue arrow represents the direction of the first sgRNA, and the red arrow represents the direction of the second sgRNA.

[0055] From Figure 5It can be seen that there is a complementary pairing region between the first sgRNA and the second sgRNA contained in the modified sgRNA provided in this embodiment; the 23rd to 27th bases in the nucleotide sequence of the first sgRNA form a first complementary pairing region with the 184th to 188th bases in the nucleotide sequence of the second sgRNA; the 30th to 43rd bases in the nucleotide sequence of the first sgRNA form a second complementary pairing region with the 166th to 179th bases in the nucleotide sequence of the second sgRNA; the 66th to 98th bases in the nucleotide sequence of the first sgRNA form a third complementary pairing region with the 98th to 130th bases in the nucleotide sequence of the second sgRNA; the 99th to 112th bases in the nucleotide sequence of the first sgRNA form a fourth complementary pairing region with the 31st to 44th bases in the nucleotide sequence of the second sgRNA; the 117th to 121st bases in the nucleotide sequence of the first sgRNA form a fifth complementary pairing region with the 24th to 28th bases in the nucleotide sequence of the second sgRNA;

[0056] In the nucleotide sequence of the first sgRNA, the 44th to 52nd bases form a sixth complementary pairing region with the 57th to 65th bases, the 124th to 126th bases form a seventh complementary pairing region with the 132nd to 134th bases, the 127th base forms an eighth complementary pairing region with the 130th base, the 141st to 144th bases form a ninth complementary pairing region with the 149th to 152nd bases, and the 154th to 159th bases form a tenth complementary pairing region with the 163rd to 168th bases;

[0057] In the nucleotide sequence of the second sgRNA, the 45th to 53rd bases form an eleventh complementary pairing region with the 58th to 66th bases, the 67th to 77th bases form a twelfth complementary pairing region with the 86th to 97th bases, the 80th to 85th bases form a thirteenth complementary pairing region with the 146th to 151st bases, and the 131st to 143rd bases form a fourteenth complementary pairing region with the 153rd to 165th bases;

[0058] In the first sgRNA, the 53rd to 56th bases form a first loop region, the 128th to 129th bases form a second loop region, the 146th to 147th bases form a third loop region, and the 160th to 136th bases form a fourth loop region;

[0059] In the second sgRNA, the bases at positions 54 to 57 form the fifth loop region, the bases at positions 78 to 79 form the sixth loop region, the bases at positions 144 to 145 form the seventh loop region, the bases at positions 195 to 196 form the eighth loop region, the bases at positions 213 to 214 form the ninth loop region, and the bases at positions 227 to 229 form the tenth loop region.

[0060] Example 2

[0061] This example aims to clarify the principle of action of the modified sgRNA provided in Example 1 in gene expression regulation.

[0062] During the process of modifying the original sgRNA, based on the original sgRNA, a region with base complementary pairing is designed between the two sgRNAs through sequence design. This base complementary sequence can connect the two sgRNAs targeting different sites and can keep the structures and functions of the sgRNAs on both sides stable. The two sgRNAs targeting different sites in the modified sgRNA (i.e., the first sgRNA and the second sgRNA) will spontaneously bind and assemble under certain conditions (refer to the preparation steps of the modified sgRNA provided in Example 1), and the specific binding mode is as Figure 6 shown.

[0063] As Figure 6 can be seen, during the CRISPR implementation reaction of the modified sgRNA, the guide regions on both sides will guide the binding of two targeted DNA regions. Also, since the two sgRNAs targeting different sites in the modified sgRNA (i.e., the first sgRNA and the second sgRNA) are already bound together, the two gene sites (enhancer and promoter) can be brought close to each other spatially, thereby achieving the purpose of upregulating gene expression.

[0064] Example 3

[0065] This example aims to verify the role of the modified sgRNA provided in Example 1 in gene expression regulation.

[0066] Gene expression in chromatin is regulated by cis-regulatory sequences, including enhancers. Enhancers upregulate gene expression by approaching the promoter of the gene. Taking the gene expression in chromatin as an example, this example explains the experimental principle for the subsequent experiments to be carried out. The experimental principle is as Figure 7 shown, specifically as follows:

[0067] The curved black line represents the DNA sequence on chromatin. In the transcriptional regulation of chromatin, an enhancer may be located at a relatively far position from the promoter. Generally, the promoter is adjacent to the upstream of the gene. Existing studies suggest that the function of the enhancer is related to the three-dimensional structure of chromatin and chromatin looping. There are also studies that placed enhancers in regions at different distances from the promoter and found that as the distance increases, the transcriptional level decreases. Therefore, when the enhancer and the promoter are far apart, the transcriptional level of the corresponding gene is low (as shown in Figure 7 the left figure). If the distance between the enhancer and the promoter is shortened, the transcriptional level of the corresponding gene will increase. When the promoter region and the enhancer region are brought closer in space through the interaction between sgRNAs, the expression level of the gene will be upregulated (as shown in Figure 7 the right figure).

[0068] SEQ ID NO: 4

[0069] GTGTGGAAAGTCCCCAGGCTCCCCAGCAGGCAGAAGTATGCAAAGCATGCATCTCAATTAGTCAGCAACCAT

[0070] The experiment carried out in this example was tested in a reporter gene plasmid. The original plasmid map used in this reporter gene plasmid is as shown in Figure 8 . The original plasmid has a promoter with a relatively low transcriptional level, called the minP promoter. There is also a luciferase reporter gene behind the promoter, called the luciferase reporter gene. This plasmid can express a low level of luciferase. In this example, a reporter gene plasmid with an enhancer was constructed by plasmid recombination. The enhancer is derived from the core sequence of the SV40 virus enhancer, with a length of 72 bp. Its nucleotide sequence is as shown in SEQ ID NO: 4, and it was inserted immediately upstream of the promoter.

[0071] The firefly luciferase expressed by the luciferase reporter gene is a protein with a molecular weight of approximately 61 kD. In the presence of ATP, magnesium ions, and oxygen, it can catalyze the oxidation of luciferin to oxyluciferin. During the oxidation of luciferin, bioluminescence is emitted, which can be measured by a chemiluminescence instrument or a liquid scintillation counter. Through this bioluminescence system of luciferin and luciferase, the gene expression can be detected very sensitively and efficiently. Usually, the transcriptional regulatory element or 5' promoter region of the gene of interest is cloned upstream of luciferase, or the 3'-UTR region is cloned downstream of luciferase, etc., to construct a reporter gene plasmid. Then, the cells are transfected, and after treating the cells with appropriate drugs, etc., the cells are lysed, and the luciferase activity is measured. The transcriptional regulatory effect of drug treatment, etc., on the target gene is judged by the level of luciferase activity.

[0072] To further study the effect of the change in the distance between the enhancer and the promoter on the regulation of reporter gene expression, a reporter gene plasmid was constructed by plasmid homologous recombination. Then, a regulatory spacer region (a disordered non-coding gene sequence with a length of about 1 kb, and its nucleotide sequence is shown in SEQ ID NO: 6) was inserted between the inserted enhancer region and the promoter region. A cell line stably expressing dCas9 was constructed by lentiviral transfection. At the same time, the modified sgRNA (dual-sgRNA) that can target the inserted 1-kb sequence was constructed into the reporter gene plasmid system by homologous recombination. The steps involved above are as Figure 9 shown. The above reporter gene plasmid was transfected into the 293T cell line by Lipo2000. Among them, the amount of the original plasmid used was 1500 ng (taking the original plasmid as a reference. Since the molecular weight of the corresponding plasmid will increase after inserting additional sequences, in order to keep the number of plasmids added in each group basically the same, the amount of other plasmids inserted with other sequences added is greater than 1500 ng, and the corresponding mass of plasmids with the same number of molecules was added after calculation).

[0073] There are differences in the transfection efficiency of Lipo2000 in cells. Therefore, if it is necessary to compare the differences in the expression efficiency of the above reporter genes horizontally, it is necessary to compare with the control reporter gene. When transfecting the corresponding reporter gene plasmid, the Renilla luciferase reporter gene (i.e., the control reporter gene) plasmid was co-transfected synchronously. The map of the Renilla luciferase reporter gene plasmid is as Figure 10As shown (the nucleotide sequence of which is shown in SEQ ID NO: 5), Renilla luciferase is a variant of luciferase. The differences are, first, the difference in reaction substrates, and second, the different luminescence wavelengths it detects. At a wavelength of 480 nm, in the above transfection step, the same amount of Renilla luciferin was transfected into each well, and the dosage of the Renilla luciferase reporter gene plasmid was 250 ng for each well.

[0074] SEQ ID NO: 5

[0075] AGATCTGCGCAGCACCATGGCCTGAAATAACCTCTGAAAGAGGAACTTGG

[0076] TTAGGTACCTTCTGAGGCGGAAAGAACCAGCTGTGGAATGTGTGTCAGTTA

[0077] GGGTGTGGAAAGTCCCCAGGCTCCCCAGCAGGCAGAAGTATGCAAAGCAT

[0078] GCATCTCAATTAGTCAGCAACCAGGTGTGGAAAGTCCCCAGGCTCCCCAGC

[0079] AGGCAGAAGTATGCAAAGCATGCATCTCAATTAGTCAGCAACCATAGTCCC

[0080] GCCCCTAACTCCGCCCATCCCGCCCCTAACTCCGCCCAGTTCCGCCCATTCT

[0081] CCGCCCCATGGCTGACTAATTTTTTTTATTTATGCAGAGGCCGAGGCCGCCT

[0082] CGGCCTCTGAGCTATTCCAGAAGTAGTGAGGAGGCTTTTTTGGAGGCCTAG

[0083] GCTTTTGCAAAAAGCTCCTCGAGGAGCTCACGCGTAAGCTTGAATTCGATA

[0084] TCGTCGACACTAGTGGGCCCCAGCTTGATTCTTCTGACACAACAGTCTCGA

[0085] ACTTAAGCTGCAGAAGTTGGTCGTGAGGCACTGGGCAGGTAAGTATCAAG

[0086] GTTACAAGACAGGTTTAAGGAGACCAATAGAAACTGGGCTTGTCGAGACA

[0087] GAGAAGACTCTTGCGTTTCTGATAGGCACCTATTGGTCTTACTGACATCCAC

[0088] TTTGCCTTTCTCTCCACAGGTGTCCACTCCCAGTTCAATTACAGCTCTTAAG

[0089] GCTAGAGTACTTAATACGACTCACTATAGGCTAGCCACCATGACTTCGAAAG

[0090] TTTATGATCCAGAACAAAGGAAACGGATGATAACTGGTCCGCAGTGGTGGG

[0091] CCAGATGTAAACAAATGAATGTTCTTGATTCATTTATTAATTATTATGATTCA

[0092] GAAAAACATGCAGAAAATGCTGTTATTTTTTTACATGGTAACGCGGCCTCTT

[0093] CTTATTTATGGCGACATGTTGTGCCACATATTGAGCCAGTAGCGCGGTGTATT

[0094] ATACCAGACCTTATTGGTATGGGCAAATCAGGCAAATCTGGTAATGGTTCTT

[0095] ATAGGTTACTTGATCATTACAAATATCTTACTGCATGGTTTGAACTTCTTAAT

[0096] TTACCAAAGAAGATCATTTTTGTCGGCCATGATTGGGGTGCTTGTTTGGCAT

[0097] TTCATTATAGCTATGAGCATCAAGATAAGATCAAAGCAATAGTTCACGCTGA

[0098] AAGTGTAGTAGATGTGATTGAATCATGGGATGAATGGCCTGATATTGAAGAA

[0099] GATATTGCGTTGATCAAATCTGAAGAAGGAGAAAAAATGGTTTTGGAGAAT

[0100] AACTTCTTCGTGGAAACCATGTTGCCATCAAAAATCATGAGAAAGTTAGAA

[0101] CCAGAAGAATTTGCAGCATATCTTGAACCATTCAAAGAGAAAGGTGAAGTT

[0102] CGTCGTCCAACATTATCATGGCCTCGTGAAATCCCGTTAGTAAAAGGTGGTA

[0103] AACCTGACGTTGTACAAATTGTTAGGAATTATAATGCTTATCTACGTGCAAG

[0104] TGATGATTTACCAAAAATGTTTATTGAATCGGACCCAGGATTCTTTTCCAAT

[0105] GCTATTGTTGAAGGTGCCAAGAAGTTTCCTAATACTGAATTTGTCAAAGTA

[0106] AAAGGTCTTCATTTTTCGCAAGAAGATGCACCTGATGAAATGGGAAAATAT

[0107] ATCAAATCGTTCGTTGAGCGAGTTCTCAAAAATGAACAATAATTCTAGAGC

[0108] GGCCGCTTCGAGCAGACATGATAAGATACATTGATGAGTTTGGACAAACCA

[0109] CAACTAGAATGCAGTGAAAAAAATGCTTTATTTGTGAAATTTGTGATGCTAT

[0110] TGCTTTATTTGTAACCATTATAAGCTGCAATAAACAAGTTAACAACAACAAT

[0111] TGCATTCATTTTATGTTTCAGGTTCAGGGGGAGGTGTGGGAGGTTTTTTAAA

[0112] GCAAGTAAAACCTCTACAAATGTGGTAAAATCGATAAGGATCCAGGTGGCA

[0113] CTTTTCGGGGAAATGTGCGCGGAACCCCTATTTGTTTATTTTTCTAAATACAT

[0114] TCAAATATGTATCCGCTCATGAGACAATAACCCTGATAAATGCTTCAATAATA

[0115] TTGAAAAAGGAAGAGTATGAGTATTCAACATTTCCGTGTCGCCCTTATTCCC

[0116] TTTTTTGCGGCATTTTGCCTTCCTGTTTTTGCTCACCCAGAAACGCTGGTGA

[0117] AAGTAAAAGATGCTGAAGATCAGTTGGGTGCACGAGTGGGTTACATCGAA

[0118] CTGGATCTCAACAGCGGTAAGATCCTTGAGAGTTTTCGCCCCGAAGAACGT

[0119] TTTCCAATGATGAGCACTTTTAAAGTTCTGCTATGTGGCGCGGTATTATCCC

[0120] GTATTGACGCCGGGCAAGAGCAACTCGGTCGCCGCATACACTATTCTCAGA

[0121] ATGACTTGGTTGAGTACTCACCAGTCACAGAAAAGCATCTTACGGATGGCA

[0122] TGACAGTAAGAGAATTATGCAGTGCTGCCATAACCATGAGTGATAACACTG

[0123] CGGCCAACTTACTTCTGACAACGATCGGAGGACCGAAGGAGCTAACCGCT

[0124] TTTTTGCACAACATGGGGGATCATGTAACTCGCCTTGATCGTTGGGAACCG

[0125] GAGCTGAATGAAGCCATACCAAACGACGAGCGTGACACCACGATGCCTGT

[0126] AGCAATGGCAACAACGTTGCGCAAACTATTAACTGGCGAACTACTTACTCT

[0127] AGCTTCCCGGCAACAATTAATAGACTGGATGGAGGCGGATAAAGTTGCAGG

[0128] ACCACTTCTGCGCTCGGCCCTTCCGGCTGGCTGGTTTATTGCTGATAAATCT

[0129] GGAGCCGGTGAGCGTGGGTCTCGCGGTATCATTGCAGCACTGGGGCCAGA

[0130] TGGTAAGCCCTCCCGTATCGTAGTTATCTACACGACGGGGAGTCAGGCAAC

[0131] TATGGATGAACGAAATAGACAGATCGCTGAGATAGGTGCCTCACTGATTAA

[0132] GCATTGGTAACTGTCAGACCAAGTTTACTCATATATACTTTAGATTGATTTAA

[0133] AACTTCATTTTTAATTTAAAAGGATCTAGGTGAAGATCCTTTTTGATAATCTC

[0134] ATGACCAAAATCCCTTAACGTGAGTTTTCGTTCCACTGAGCGTCAGACCCC

[0135] GTAGAAAAGATCAAAGGATCTTCTTGAGATCCTTTTTTTCTGCGCGTAATCT

[0136] GCTGCTTGCAAACAAAAAAACCACCGCTACCAGCGGTGGTTTGTTTGCCG

[0137] GATCAAGAGCTACCAACTCTTTTTCCGAAGGTAACTGGCTTCAGCAGAGCG

[0138] CAGATACCAAATACTGTTCTTCTAGTGTAGCCGTAGTTAGGCCACCACTTCA

[0139] AGAACTCTGTAGCACCGCCTACATACCTCGCTCTGCTAATCCTGTTACCAGT

[0140] GGCTGCTGCCAGTGGCGATAAGTCGTGTCTTACCGGGTTGGACTCAAGACG

[0141] ATAGTTACCGGATAAGGCGCAGCGGTCGGGCTGAACGGGGGGTTCGTGCA

[0142] CACAGCCCAGCTTGGAGCGAACGACCTACACCGAACTGAGATACCTACAG

[0143] CGTGAGCTATGAGAAAGCGCCACGCTTCCCGAAGGGAGAAAGGCGGACA

[0144] GGTATCCGGTAAGCGGCAGGGTCGGAACAGGAGAGCGCACGAGGGAGCT

[0145] TCCAGGGGGAAACGCCTGGTATCTTTATAGTCCTGTCGGGTTTCGCCACCTC

[0146] TGACTTGAGCGTCGATTTTTGTGATGCTCGTCAGGGGGGCGGAGCCTATGG

[0147] AAAAACGCCAGCAACGCGGCCTTTTTACGGTTCCTGGCCTTTTGCTGGCCT

[0148] TTTGCTCACATGGCTCGAC

[0149] The above reporter gene plasmid and Renilla luciferase reporter gene plasmid were simultaneously transfected into the 293T cell line by Lipo2000. After 6 hours of transfection, the transfection was terminated by changing the medium. After 24 hours of transfection, the cells were collected and lysed, and then centrifuged at 15000g for 5 minutes to collect the supernatant. The luciferase reaction solution was first added to the supernatant, and the fluorescence intensity of the reaction system was detected at 560nm using a microplate reader. After the determination was completed, the Renilla luciferase reaction solution (which can quench the luciferase reaction) was added, and the luminescence was detected at 480nm. The fluorescence intensity luminescence value obtained was the expression level of the control gene Renilla luciferase, and the ratio of the luciferase luminescence value / the Renilla luciferase luminescence value was the expression level of the reporter gene. At the same time, Western blot was used to detect the expression of dCas9 in the 293T cell line. The final detection results are as follows: Figure 11 As shown in the figure, the upper right corner shows the Western blot detection result of dCas9 expression in 293T cell line. Since the 3' end of dCas9 has a flag tag, the flag-tagged antibody is used for detection. In the grouping of the horizontal axis, from left to right are:

[0150] (1) dCas9-NC represents the negative control (NC) group that overexpressed dCas9 but did not receive any treatment;

[0151] (2) dCas9-no spacer means that the 293T cell line used overexpressed dCas9, and there was no spacer sequence between the enhancer and the promoter in the reporter gene of the transfected plasmid (this is an extreme case set artificially. Generally, the enhancer in vivo is several kb or even more than ten kb away from the promoter, and the farthest is tens of kb). Therefore, its expression level was the highest among all groups.

[0152] (3) dCas9-1kb represents the 293T cell line used to overexpress dCas9, with a 1Kb unrelated sequence (nucleotide sequence as shown in SEQ ID NO: 6) inserted between the enhancer and the promoter as a spacer. As the distance between the enhancer and the promoter increases, its gene expression level is significantly reduced;

[0153] (4) dCas9-1kb contact represents 293T cell lines overexpressing dCas9, with a 1Kb irrelevant sequence (nucleotide sequence as shown in SEQ ID NO: 6) inserted between the enhancer and the promoter as a spacer, and the modified sgRNA provided in Example 1 was co-expressed in the cells. Because the distance between the enhancer and the promoter was shortened by the dCas9 loop mediated by the modified sgRNA, its gene expression level was increased compared with the dCas9-1kb group, p<0.05;

[0154] (5) con-no spacer indicates that the common 293T cell line is used, and there is no spacer sequence between the enhancer and the promoter in the reporter gene of the transfected plasmid. Since there is no spacer sequence in this experimental group, its expression level is significantly increased;

[0155] (6) con-1kb represents that the common 293T cell line is used, and 1Kb of irrelevant sequence (nucleotide sequence as shown in SEQ ID NO: 6) is inserted between the enhancer and the promoter as a spacer. Because the distance between the enhancer and the promoter increases, its gene expression level is significantly reduced;

[0156] (7) con-1kb-contact represents that the common 293T cell line is used, 1Kb of irrelevant sequence (nucleotide sequence as shown in SEQ ID NO: 6) is inserted between the enhancer and the promoter as a spacer, and the modified sgRNA provided in Example 1 is co-expressed in the cell. Since there is no overexpression of dCas9 in the cell line, even in the presence of the above-mentioned modified sgRNA, its gene expression level has no significant difference compared with the con-1kb group.

[0157] SEQ ID NO: 6

[0158] AAGCTTGACTGGGAAAACCCTGGCGTTACCCAACTTAATCGCCTTGCAGCA

[0159] CATCCCCCTTTCGCCAGCTGGCGTAATAGCGAAGAGGCCCGCACCGATCGC

[0160] CCTTCCCAACAGTTGCGCAGCCTGAATGGCGAATGGGACGCGCCCTGTAGC

[0161] GGCGCATTAAGCGCGGCGGGTGTGGTGGTTACGCGCAGCGTGACCGCTAC

[0162] ACTTGCCAGCGCCCTAGCGCCCGCTCCTTTCGCTTTCTTCCCTTCCTTTCTC

[0163] GCCACGTTCGCCGGCTTTCCCCGTCAAGCTCTAAATCGGGGGCTCCCTTTA

[0164] GGGTTCCGATTTAGTGCTTTACGGCACCTCGACCCCAAAAAACTTGATTAG

[0165] GGTGATGGTTCACGTAGTGGGCCATCGCCCTGATAGACGGTTTTTCGCCCTT

[0166] TGACGTTGGAGTCCACGTTCTTTAATAGTGGACTCTTGTTCCAAACTGGAA

[0167] CAACACTCAACCCTATCTCGGTCTATTCTTTTGATTTATAAGGGATTTTGCCG

[0168] ATTTCGGCCTATTGGTTAAAAAATGAGCTGATTTAACAAAAATTTAACGCGA

[0169] ATTTTAACAAAATATTAACGCTTACAATTTAGGTGGCACTTTTCGGGGAAAT

[0170] GTGCGCGGAACCCCTATTTGTTTATTTTTCTAAATACATTCAAATATGTATCC

[0171] GCTCATGAGACAATAACCCTGATAAATGCTTCAATAATATTGAAAAAGGAA

[0172] GAGTATGAGTATTCAACATTTCCGTGTCGCCCTTATTCCCTTTTTTGCGGCAT

[0173] TTTGCCTTCCTGTTTTTGCTCACCCAGAAACGCTGGTGAAAGTAAAAGATG

[0174] CTGAAGATCAGTTGGGTGCACGAGTGGGTTACATCGAACTGGATCTCAACA

[0175] GCGGTAAGATCCTTGAGAGTTTTCGCCCCGAAGAACGTTTTCCAATGATGA

[0176] GCACTTTTAAAGTTCTGCTATGTGGCGCGGTATTATCCCGTATTGACGCCGG

[0177] GCAAGAGCAACTCGGTCGCCGCATACAAGCTT

[0178] Meanwhile, in order to visualize the binding sites of the modified sgRNA to the enhancer and promoter in the reporter gene, the gene fragment + sgRNA assembly + dCas9 protein were mixed in vitro for reaction: DNA backbone chain (gene fragment), pre-assembled sgRNA molecules (i.e., the modified sgRNA provided in Example 1), and dCas9 protein were added to 1× dCas9 reaction Buffer (pH = 6.5, 20 mM HEPES, 5 mM MgCl2, 100 mM NaCl, 0.1 mM EDTA). After mixing evenly, the mixture was incubated in a metal bath at 37°C for 1 h, and then the morphology of the formed complex was observed using an atomic force microscope. The results are as Figure 12 shown, where the mass ratio of the DNA backbone chain, pre-assembled sgRNA molecules, and dCas9 protein is 1:5:5.

[0179] Combined with Figure 11 and Figure 12 it can be seen that due to the simultaneous transfection of dCas9 protein and the modified sgRNA provided in Example 1 into the cells, the expression level of the background reporter gene was significantly enhanced. This is mainly because after the simultaneous transfection of dCas9 protein and the modified sgRNA provided in Example 1 into the cells, the distance between the enhancer and the promoter was shortened, enhancing the expression level of the reporter gene.

[0180] Comparative Example 1

[0181] Table 3 Nucleotide sequences of the modified sgRNA in Comparative Example 1

[0182]

[0183] Note: In SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, the base "N" represents the base U.

[0184] This comparative example provides a modified sgRNA, whose sequence and secondary structure are as Figure 13 shown. The modified sgRNA provided in this comparative example consists of 5 strands, which are respectively labeled as strand A, strand B, strand C, strand D, and strand E. The preparation steps of the modified sgRNA provided in this comparative example refer to Example 1, that is, after synthesizing the above 5 strands respectively, the sgRNA secondary structure was assembled according to the reaction conditions in Example 1.

[0185] Comparative Example 2

[0186] Table 4 Nucleotide sequences of the modified sgRNAs in Comparative Example 1

[0187]

[0188] Note: In SEQ ID NO: 12 and SEQ ID NO: 13, the base "N" represents the base U.

[0189] This comparative example provides a modified sgRNA, which includes a third sgRNA and a fourth sgRNA. The nucleotide sequences of the third sgRNA and the fourth sgRNA are shown in Table 3. Among them, the nucleotide sequence of the third sgRNA is shown in SEQ ID NO: 12, and the nucleotide sequence of the fourth sgRNA is shown in SEQ ID NO: 13. The preparation steps of the modified sgRNA provided in this comparative example refer to Example 1, and its sequence and secondary structure are as Figure 14 shown.

[0190] At the same time, the modified sgRNAs provided in Example 1, Comparative Example 1, and Comparative Example 2 were verified. Specifically, 8% non-denaturing polyacrylamide gel electrophoresis was used to detect the modified sgRNAs. Electrophoresis was carried out at 250 V for 8 h at 4 °C, stained with sybr gold nucleic acid dye, and developed with a UV imager. The detection results Figure 15 are shown, where Figure 15 A shows the electrophoresis result diagram of the modified sgRNA provided in Example 1. Lanes 1-2 correspond to the addition of the first sgRNA and the second sgRNA respectively, and lane 3 corresponds to the addition of the modified sgRNA (i.e., the RNA molecule assembled from the first sgRNA and the second sgRNA); Figure 15 B shows the electrophoresis result diagram of the modified sgRNA provided in Comparative Example 1. Lanes 1-5 correspond to the addition of one of strands A-E alone, lanes 6-8 correspond to the addition of three strands (strand ABC, strand ABD, strand ABE), lane 9 corresponds to the addition of four strands (strand ABCD), and lane 10 corresponds to the addition of the modified sgRNA (i.e., the RNA molecule assembled from strands A-E); Figure 15 C shows the electrophoresis result diagram of the modified sgRNA provided in Comparative Example 2. Lanes 1-2 correspond to the addition of the third sgRNA and the fourth sgRNA respectively, and lane 3 corresponds to the addition of the modified sgRNA (i.e., the RNA molecule assembled from the third sgRNA and the fourth sgRNA); The reactions in the above lanes were all carried out in 1xCas9 buffer and underwent a step of heating at 90 °C for 3 min and then cooling to room temperature.

[0191] From Figure 15As can be seen from B, the results in lanes 1-5 indicate that when the five chains A-E exist alone, the RNA monomers may have multiple structures, and thus there may be multiple bands on polyacrylamide gel electrophoresis. Lanes 6-10 are for the formation of RNA assembly molecules by adding multiple chains, and there are many developed bands in these lanes, indicating that during the actual reaction process, these assemblies form a very large number of isomers, which cannot ensure the structural stability and maintenance of the function of sgRNA; From Figure 15 As can be seen from C, the developed image in lane 3 is a single band, indicating that a certain single structure is formed. However, there is obvious development in the gel well in this lane, indicating that a relatively large assembly is formed and thus it is difficult to electrophorese down in the gel well. This is mainly because the modified sgRNA provided in Comparative Example 2 forms separate monomers, which are stable and uniform. However, due to certain reasons, these monomers combine with each other and undergo a polymerization reaction, resulting in the formation of assemblies with a very large molecular weight, so there is obvious development in the gel well; From Figure 15 As can be seen from A, the developed image in lane 3 is a single band without obvious development. The above results can show that the modified sgRNA provided in Comparative Example 1 fails to form a stable RNA molecule, and the modified sgRNAs provided in Example 1 and Comparative Example 1 can form relatively stable RNA molecules. However, the electrophoresis detection of Comparative Example 2 shows that there are many aggregates in the gel well in the gel image, which means that there may be many aggregates formed in this RNA assembly molecule, so the molecular weight is relatively large, and thus they aggregate in the gel well and cannot migrate to the gel under the action of electrophoresis.

[0192] In addition, in order to visualize the ligation sites of the enhancer and promoter in the reporter gene by the modified sgRNAs provided in Example 1 and Comparative Example 2, the gene fragment + sgRNA assembly + dCas9 protein were mixed in vitro for reaction: DNA backbone chain (gene fragment), pre-assembled sgRNA molecules (modified sgRNAs), and dCas9 protein were added to 1× dCas9 reaction Buffer (pH = 6.5, containing 20 mM HEPES, 5 mM MgCl2, 100 mM NaCl, 0.1 mM EDTA). After mixing evenly, the mixture was incubated in a metal bath at 37 °C for 1 h, and then the morphology of the formed complex was observed using an atomic force microscope. The structural imaging of the in vitro system was performed using a Multimode Ⅷ atomic force microscope, and the mode was the liquid phase mode of ScanAsyst. The ScanAsyst fluid probe was used. When scanning the sample, the peak force setpoint was 0.01 N, the peak force frequency was 2 kHz, and the peak force amplitude was set to 50 nm. The atomic force imaging pictures were analyzed using NanoScope Analysis software 1.8. The results are as Figure 16 shown, where the mass ratio of the DNA backbone chain, pre-assembled sgRNA molecules, and dCas9 protein is 1:5:5. Figure 16 A and B show the observation results of the morphology of the complex formed by the modified sgRNA provided in Example 1 with the DNA backbone chain and dCas9 protein under an atomic force microscope. Figure 16 C and D show the observation results of the morphology of the complex formed by the modified sgRNA provided in Comparative Example 2 with the DNA backbone chain and dCas9 protein under an atomic force microscope.

[0193] It can be seen from Figure 16 that compared with Comparative Example 2, the complex formed by the modified sgRNA provided in Example 1 with the DNA backbone chain and dCas9 protein forms a circular structure, which can prove that the modified sgRNA provided in Example 1 enables two gene sites (enhancer and promoter) in the DNA backbone chain to be closely adjacent in space.

[0194] In summary, based on the sequence and structure of the sgRNA used in the existing CRISPR-Cas9 system, the present invention designs a sequence such that there is a region of base complementary pairing between two sgRNAs (the first sgRNA and the second sgRNA). This base complementary sequence can connect the two sgRNAs targeting different sites and can keep the structures and functions of the two sgRNAs stable. The first sgRNA and the second sgRNA targeting different sites in the modified sgRNA can spontaneously bind and assemble. Since the two sgRNAs (the first sgRNA and the second sgRNA) targeting different sites in the modified sgRNA are already bound together, the two gene sites (enhancer and promoter) can be brought close to each other spatially, thereby achieving the purpose of upregulating gene expression. This is of great significance for gene expression regulation and provides a certain guiding direction and idea for the research on gene expression regulation.

[0195] The above embodiments are only used to illustrate the technical solutions of the present invention rather than to limit the protection scope of the present invention. Although the present invention has been described in detail with reference to the above embodiments, those of ordinary skill in the art should understand that the technical solutions of the present invention can be modified or equivalently replaced, but these modifications or replacements are all within the protection scope of the present invention.

Claims

1. A modified sgRNA, characterized in that: The modified sgRNA includes a first sgRNA and a second sgRNA. The nucleotide sequence of the first sgRNA is as shown in SEQ ID NO: 2, and the nucleotide sequence of the second sgRNA is as shown in SEQ ID NO: 3; In SEQ ID NO: 2 and SEQ ID NO: 3, the base N represents the base U; The secondary structure of the modified sgRNA is as follows:

2. The modified sgRNA according to claim 1, wherein The modified sgRNA is prepared by the following steps: separately synthesize the first sgRNA and the second sgRNA, mix the first sgRNA and the second sgRNA, and incubate at 90 °C for 3 min to obtain the modified sgRNA.

3. Use of the modified sgRNA according to any one of claims 1 to 2 in gene expression regulation.

4. A method for upregulating gene expression, characterized in that, Comprising the following steps: Transfer the modified sgRNA according to any one of claims 1 to 2 and the dCas9 protein into cells through the CRISPR system.

5. A CRISPR system, characterized in that: The CRISPR system includes the modified sgRNA according to any one of claims 1 to 2.

Citation Information

Patent Citations

  • CRISPR / Cas9 apparent editing system and method of macrophages, edited macrophages and application

    CN113322275A

  • Tandem guide RNAS (TG-RNAS) and their use in genome editing

    WO2024020352A1