Method for realizing inverted editing of large fragment of genome based on guide editing system

Abstract

The invention discloses a method for realizing genome large fragment inversion editing based on a guide editing system. According to the method disclosed by the invention, by virtue of an efficient multi-gene guide editing protein construct ePPEplus in a plant, paired pegRNA (pegL and pegR) is designed, and then through the processes of reverse transcription, DNA double-chain annealing, DNA chain synthesis, repairing and the like, large-fragment inversion of the plant is realized. Wherein the pegL contains RTT-L, the pegR contains RTT-R, the nucleotide sequence of the RTT-L is the same as the nucleotide sequence of the A chain at the right tail end of the DNA double chain to be inverted, and the nucleotide sequence of the RTT-R is the same as the nucleotide sequence of the B chain at the left tail end of the DNA double chain to be inverted. Tests in monocotyledon wheat, dicotyledon native tobacco and tomato show that the method disclosed by the invention is an effective method for mediating accurate inversion of the large-fragment DNA of the plant.

Description

Technical Field

[0001] The present invention relates to the field of genetic engineering, and in particular to a method for realizing inversion editing of large genome fragments based on a guide editing system. Background Art

[0002] The improvement of agronomic traits relies on genetic variation in plants, including single nucleotide polymorphisms (SNPs) and large structural variations, such as large deletions, inversions, etc. These variations play a key role in genome evolution and the genetic control of plant agronomic traits. Although the efficiency and accuracy of current CRISPR / Cas-based genome editing technologies (such as CRISPR / Cas nucleases, base editors, and guide editors) have been greatly improved in plant genome editing, these technologies are still largely limited to making small changes, such as introducing small deletions or insertions or base substitutions. The manipulation of larger DNA sequences, such as kb and Mb-level fragment inversions, remains a huge challenge.

[0003] CRISPR / Cas nucleases, such as Cas9, induce double-strand breaks (DSBs) in target DNA, and paired guide RNAs (gRNAs) can induce genomic structural variations, including large chromosome deletions and inversions in plants. However, this approach mainly produces small insertions or deletions (indels), the frequency of more complex structural variations is much lower, and many undesirable results are often introduced, such as random small insertions or deletions (indels) or more complex chromosome rearrangements due to the presence of DSBs.

[0004] Prime Editing is a system based on CRISPR / Cas technology that can accurately modify the target site sequence. It consists of a fusion protein composed of Cas9 nuclease (Cas9-H840A) and reverse transcriptase (RT, reverse transcriptase) and a pegRNA with a RT template (RT template) and a free single-stranded binding region (PBS, Primer binding site) at the 3' end. The system guides the fusion protein to bind to the specified site through PBS combined with the free single strand produced by Cas9-H840A, and reversely transcribes a single-stranded DNA sequence containing a specified mutation according to the given RT template. After cell repair, the target mutation is introduced into the genome.

[0005] The Prime Editor (PE) system is a gene editing method developed by David R. Liu's team at the Broad Institute of the United States. This method can achieve insertion, deletion and all 12 types of point mutations at the target site without introducing double-strand breaks (DSBs) and donor DNA templates.

[0006] Prime editing is a genome editing method based on "search-and-replace". The search function of prime editing is based on the engineered guide RNA (the pegRNA), which contains single guide RNAs (sgRNAs) in gene editing. The difference is that there is also a primer binding site (PBS) and a transcription template sequence (RT template, RTT) at its 3′-end. The prime editor protein is a fusion of Cas9 nickase (Cas9 nickase is dead Cas9, which only has the function of cutting single strands, H840A) and reverse transcriptase (M-MLV RT).

[0007] When two pegRNAs are used, the plant genome can be manipulated to produce large-fragment variations by designing the sequences of the two pegRNAs. This avoids inducing double-strand breaks during the repair process and has higher safety and accuracy.

[0008] Although the genome editing toolbox has expanded rapidly in mammalian cells, there is still a lack of genome editing tools that can effectively and accurately design large genomic structural variations in plants. The guide editing system can generate chromosome fragments without generating DSBs, but with the help of cell repair pathways to achieve precise deletion, replacement and inversion of large fragments in plants, which is an effective way to achieve large DNA manipulation in plants. Summary of the invention

[0009] The technical problem to be solved by the present invention is how to achieve inversion editing of DNA (large) fragments in monocotyledons and dicotyledons and / or how to use a guide editing system to efficiently achieve inversion editing manipulation of DNA (large) fragments in monocotyledons and / or dicotyledons.

[0010] In order to solve the above technical problems, the present invention first provides a method for inverting a DNA fragment in a biological genome, which may include:

[0011] A1) providing a segment to be inverted of a to-be-edited organism, wherein the segment to be inverted is a double-stranded DNA fragment in the genomic DNA of the to-be-edited organism, wherein the double-stranded DNA fragment is formed by two complementary single-stranded DNAs named A chain and B chain complementary and bound in a double helix manner, wherein the direction of the A chain is 5′ to 3′ from the left end to the right end, and the direction of the B chain is 5′ to 3′ from the right end to the left end, and the two ends of the segment to be inverted are respectively called the left end and the right end, wherein the left end is located at the 5′ end of the A chain, and the right end is located at the 3′ end of the A chain, and both the left end and the right end contain PAM, and the name of the PAM in the left end is PAM A , the PAM A Located on the A strand but not on the B strand, the name of the PAM in the right terminus is PAM B , the PAM B Located on the B chain but not on the A chain, the PAM is a single-stranded DNA fragment with a nucleotide sequence of 5′-NGG-3′; the N is a deoxyribonucleotide A, G, C or T;

[0012] A2) providing two pegRNAs named pegL and pegR, wherein pegL contains RNA named 左末端 RTT-L, the pegR-containing RNA 右末端 RTT-R, the RNA 左末端 The nucleotide sequence of RTT-L is identical to the nucleotide sequence of the A chain at the right end, and the RNA 右末端 The RTT-R nucleotide sequence is identical to the nucleotide sequence of the B chain at the left end;

[0013] A3) providing a prime editor protein, wherein the prime editor protein is a protein having reverse transcriptase activity and nicking activity on double-stranded DNA;

[0014] A4) contacting the two pegRNAs and the prime editor protein with the genomic DNA of the organism to be edited, thereby inverting the segment to be inverted in the genome of the organism to be edited.

[0015] In the above method, the length of the left end and / or the right end may be equal to the length of the RTT-L and / or the RTT-R.

[0016] In the above method, the inversion refers to the phenomenon that the segment between two nicks caused by the prime editor protein in the chromosome segment is inverted by 180°. The length of the DNA segment can be 700 bp-252 kb.

[0017] The length of the RTT may be 18-50 nt, such as 30 nt.

[0018] In the above method, the organism may be a plant; the plant may be a monocotyledon and / or a dicotyledon.

[0019] The monocotyledonous plant may be wheat; the dicotyledonous plant may be tobacco or tomato.

[0020] In order to solve the above technical problems, the present invention also provides DNA, wherein the DNA may be at least one of the following:

[0021] B1) two pegRNA genes, wherein the two pegRNA genes are DNAs capable of transcribing the pegL and pegR described above,

[0022] B2) DNA for inverting a DNA fragment in an organism's genome, the DNA containing the gene encoding the primeeditor protein described above and the two pegRNA genes described in B1),

[0023] B3) a recombinant vector containing the DNA described in B1),

[0024] B4) A recombinant vector containing the DNA described in B2).

[0025] In the above DNA, the organism may be a plant; the plant may be a monocot and / or a dicot.

[0026] The monocotyledonous plant may be wheat; the dicotyledonous plant may be tobacco or tomato.

[0027] In order to solve the above technical problems, the present invention also provides the use of a recombinant microorganism containing the DNA described above in preparing a product causing inversion of a DNA fragment in a biological genome.

[0028] The product may be a reagent or a kit.

[0029] In the above application, the organism may be a plant; the plant may be a monocotyledon and / or a dicotyledon.

[0030] The monocotyledonous plant may be wheat; the dicotyledonous plant may be tobacco or tomato.

[0031] In order to solve the above technical problems, the present invention also provides a composition, which may contain the two pegRNAs mentioned above and the prime editor protein mentioned above.

[0032] In the above composition, the coding sequence of the prime editor protein may be sequence 1 in the sequence list or nucleotides 628-6810 of sequence 1.

[0033] The present invention relates to a method for realizing large plant fragment editing without relying on DSB. More specifically, the present invention relates to a method for realizing large plant fragment inversion by a dual-pegRNA-based guide editing system through reverse transcription, DNA double-strand annealing, DNA strand synthesis, repair and other processes; and genetically modified biological individuals and their offspring produced by the method.

[0034] The present invention uses the efficient multi-gene guide editing protein construct ePPEplus in plants to directly specify the editing results by designing paired pegRNA (pegL and pegR) to achieve the purpose of precise large-fragment editing. This system is called DualPE. Through testing in monocotyledonous wheat, dicotyledonous tobacco and tomato, it is shown that the method of the present invention is an effective method for mediating precise inversion of large DNA fragments in plants.

[0035] The present invention uses a fusion protein DualPE containing Csy4 nuclease, reverse transcriptase-nCas9, or a fusion protein WT-DualPE containing Csy4 nuclease, reverse transcriptase-wild-type Cas9, or Cas9 containing only wild-type Cas9 protein for comparative testing in wheat protoplasts; a construct pB-DualPE that can achieve Agrobacterium transformation-mediated inversion of a large wheat fragment; a construct pH-2×35s-DualPE that can achieve efficient editing in tobacco; and a construct pH-EF1α-DualPE that can achieve efficient editing in tomatoes. BRIEF DESCRIPTION OF THE DRAWINGS

[0036] Figure 1 Schematic diagram of different protein carrier constructs related to DualPE in the method of the present invention.

[0037] Figure 2 Schematic diagram of DualPE-mediated inversion of large genomic fragments according to the method of the present invention.

[0038] Figure 3 The efficiency and accuracy of large DNA inversion in wheat protoplasts. a is the inversion efficiency of five endogenous genomic fragments induced by DualPE, WT-DualPE and Cas9 determined by digital PCR (dPCR). b is the percentage of accurate or inaccurate inversions obtained by second-generation sequencing for all endogenous genomic fragment sites shown in (a); Junction-L represents the left end of the inversion segment; Junction-R represents the right end of the inversion segment.

[0039] Figure 4The method of the present invention is used to mediate the inversion of large fragments of wheat mutants mediated by DualPE. a is a summary of the inversion mutations of 7.4kb, 19.2kb, 82.8kb and 205.4kb in wheat plants mediated by DualPE; b is the Sanger sequencing map of a representative mutant of the 7.4kb inversion of wheat mediated by DualPE. T0-2 is a mutant with completely accurate junctions at the left and right ends of the inversion target sequence. In contrast, T0-5 and T0-28 are not completely accurate at the junctions of the left and right ends of the inversion target sequence, and there are single nucleotide polymorphisms (SNPs) or small insertions and deletions (indels), which may be due to the presence of byproducts or microhomologous sequences derived from the transcription of the pegRNA scaffold; c is the agarose gel electrophoresis result of the wheat T0 plant with a representative 19.2kb inversion for genotyping. The bands of 325bp and 730bp are the expected bands for the amplification of the left and right ends of the inversion target sequence, respectively, while the bands of 695bp and 360bp are the expected bands for the amplification of the wild-type sequence; d is the Sanger sequencing map of the representative mutant of the 19.2kb inversion of wheat mediated by DualPE. T0-7 is a mutant with completely accurate junctions at the left and right ends of the inversion target sequence, and T0-10 is not completely accurate at the left border junction of the inversion target sequence, which may be due to the presence of byproducts derived from the transcription of the pegRNA scaffold; e is the Sanger sequencing map of the representative mutant of the 82.8kb inversion of wheat mediated by DualPE, and T0-42 is a mutant with completely accurate junctions at the left and right ends of the inversion target sequence.

[0040] Figure 5 The results of the detection of gene promoter exchange in wheat mutants mediated by DualPE. a is a schematic diagram of the promoter exchange and primer detection of GASR7 and SOG1 on chromosome 7B. The wild-type sequence was amplified and identified using L_pF+L_pR and R_pF+R_pR primers. The primer pairs (L_pF+R_pF and L_pR+R_pR) were used to identify events with inversion; b is the agarose gel electrophoresis result of the 205.4kb mutant for genotyping. The 576bp and 489bp bands are the bands of sequence amplification near the left and right ends of the inversion target sequence, respectively, while the 706bp and 359bp bands are the expected bands of wild-type sequence amplification; c is the Sanger sequencing peak diagram of the 205.4kb fragment inversion between GASR7 and SOG1 in the wheat mutant T0-3 mediated by DualPE; T0-3 is a mutant with completely accurate junctions at the left and right ends of the inversion target sequence. d qRT-PCR analysis of the relative expression levels of GASR7 and SOG1 in wild-type (WT) and mutant plants (T0-3 and T0-27).

[0041] Figure 6The efficiency and accuracy of large-fragment DNA editing in tobacco leaves are measured. a is the efficiency of DualPE-mediated inversion of five endogenous genomic fragments measured by digital PCR (dPCR); b is the percentage of accurate or incomplete accurate editing obtained by amplicon second-generation sequencing of the left and right ends of the inversion target sequence of all endogenous genomic sites shown in (a); -L represents the left end of the inversion segment; -R represents the right end of the inversion segment.

[0042] Figure 7 The inversion editing of large fragments in tomato mutants mediated by DualPE. a is a summary of the inversion of 725bp fragments in tomato plants mediated by DualPE; b is the agarose gel electrophoresis results of genotype identification of representative tomato mutants with 725bp inversion mediated by DualPE. The 378bp and 330bp bands are the bands of sequence amplification near the left and right ends of the inversion target sequence, while the 353bp and 355bp bands are the expected sizes of wild-type sequences; c is a schematic diagram of the 725bp inversion mediated by DualPE and primer detection, as well as the Sanger sequencing results of the amplified sequences near the left and right ends of the target sequence of T0-1 after inversion. DETAILED DESCRIPTION

[0043] The present invention is further described in detail below in conjunction with specific embodiments, and the examples provided are only for illustrating the present invention, rather than for limiting the scope of the present invention. The examples provided below can be used as a guide for further improvements by those of ordinary skill in the art, and do not constitute a limitation of the present invention in any way.

[0044] The experimental methods in the following examples, unless otherwise specified, are all conventional methods, and are performed according to the techniques or conditions described in the literature in the field or according to the product instructions. The materials, reagents, etc. used in the following examples, unless otherwise specified, can all be obtained from commercial channels.

[0045] The following examples used GraphPad Prism 9 statistical software to process the data, and the experimental results were expressed as mean ± standard error. Two-tailed Student's t-tests were used for the analysis. P < 0.05 (*) indicated a significant difference, P < 0.01 (**) indicated a very significant difference, and P < 0.001 (***) indicated a very significant difference.

[0046] The protoplasts used in the present invention are derived from the common wheat (Triticum aestivum) variety Spring wheat Fielder.

[0047] The wheat protoplast separation, transformation and DNA extraction methods used in the embodiments of the present invention are as follows:

[0048] (1) Wheat seedling culture

[0049] The seeds are first soaked in 1% sodium hypochlorite for 15 minutes and washed with sterile water for more than 5 times. Plant wheat in the culture room, choose soil culture, and control the temperature of the culture room at 23-25℃. The wheat seedlings are cultured for 8-10 days under the conditions of 1000Lx light intensity and 16h / d light for later use;

[0050] (2) Protoplast isolation

[0051] 1) Take young wheat leaves, discard about 0.8-1 cm of the stem, and cut the middle part into 0.5-1 mm filaments with a blade; immerse all the filaments in 0.6M Mannitol solution, protect from light for 10 minutes, and then filter with 75μM magic filter cloth, put the soaked filaments into 25mL of enzymatic solution, vacuum pump for 15-30 minutes, the pressure is about 400pa, and then put them on a shaker at room temperature to protect from light for 4-4.5 hours (slowly shake at 20rmp).

[0052] 2) Add W5 (containing 154 mM NaCl, 125 mM CaCl2, 5 mM KCl, 2 mM MES, and the rest is water, pH = 5.7) with an equal volume to the enzymatic hydrolysate to dilute the enzymatic hydrolysate, shake gently to mix, and filter the enzymatic hydrolysate through a 75 μM magic filter cloth into a round-bottom centrifuge tube.

[0053] 3) Centrifuge for 3 min at 23°C, 100 g, speed up 3 down 3, and discard the supernatant;

[0054] 4) Gently suspend the precipitate with 10 mL of W5 and place on ice for 30 min. Allow the protoplasts to settle naturally and discard the supernatant. Add an appropriate amount of MMG to suspend and wait for transformation.

[0055] 5) Add an appropriate amount of MMG solution (containing 0.4M Mannitol, 15mM MgCl2, 4mM MES, the rest is water, pH = 5.7) to suspend, place on ice, and wait for transformation. Determine the concentration of protoplasts by microscopic examination (×100), the number of protoplasts is about 2×10 5 / mL~1×10 6 / mL.

[0056] (3) Protoplast transformation

[0057] 1) Add 5 μg of each desired transformation vector to a 2 mL centrifuge tube, mix well, then use a sharpened pipette tip to draw 200 μL of protoplasts, flick to mix, add 250 μL of PEG4000 solution, flick to mix, and induce transformation at room temperature in the dark for 15-20 min;

[0058] 2) Add 800 μL of W5 to the centrifuge tube and gently invert to mix. Centrifuge at 100 g for 3 min, up 3 times and down 3 times, and discard the supernatant.

[0059] 3) Add 1 mL of W5 solution to resuspend, mix thoroughly by inversion, place in a 2 mL centrifuge tube, and culture at room temperature in the dark for 48 hours. Place GFP in a 24-well cell culture plate, and observe the protoplast transformation efficiency under a fluorescence microscope after about 16 hours.

[0060] The protoplast DNA extraction method in the embodiment of the present invention is as follows:

[0061] The protoplasts were collected in 2 mL centrifuge tubes, and the protoplast DNA was extracted using the CTAB method (~30 μL). The concentration (30-60 ng / μL) was determined using a NanoDrop ultra-micro spectrophotometer and stored at -20°C.

[0062] The tobacco mesophyll cell injection and DNA extraction method in the embodiment of the present invention is as follows:

[0063] Tobacco mesophyll cell injection:

[0064] (1) Select full tobacco seeds, soak them in water at 4°C for 48 hours, sow them in soil, and culture them in an incubator at (26±1)°C and 16h / d light intensity. After about 25 days, when the seeds are at the five-leaf or six-leaf stage, take the wider and flatter leaves from the plants for the experiment.

[0065] (2) Agrobacterium transformed with the editing vector (GV3101::pMP90 strain) was cultured overnight for 6-8 h in LB medium containing 100 mg / L kanamycin and 30 mg / L rifampicin. Agrobacterium cells were collected by centrifugation and resuspended in a buffer containing 10 mM MgCl2, 10 mM MES (pH 5.7) and 200 μM acetosyringone (AS) to an OD of 1. 600nm =0.8, and injection was performed after incubation for 2-3 h.

[0066] (3) Take a sterilized 1 ml syringe and remove the needle. Use a needleless syringe to inject the leaves, and use pressure to inject the bacterial solution between the veins of the leaves. After the injection, place it in a 23°C artificial culture room and culture it for 2-3 days.

[0067] DNA extraction from tobacco mesophyll cells:

[0068] The leaves in the injection area were cut and placed in a 2 mL centrifuge tube. The protoplast DNA was extracted using the CTAB method (~100 μL), and its concentration was measured using a NanoDrop ultra-micro spectrophotometer (30-60 ng / μL) and stored at -20°C.

[0069] The method for determining the efficiency using digital PCR (dPCR) in the embodiment of the present invention is as follows:

[0070] (1) Design corresponding primers and TaqMan probes based on the sequence of each target site. The endogenous control probe is detected using the HEX fluorescence channel, and the target site is detected using the FAM fluorescence channel.

[0071] (2) The reaction mixture contained 200 ng of wheat genomic DNA; 0.8 μM of each primer; 0.4 μM of each probe; 10 μl of 4x Probe PCR Master Mix for Probes (QIAGEN); and water was added to 40 μL. The reaction mixture was transferred to a QIAcuity Nanoplate 26k 24-well plate (QIAGEN) and then covered with a membrane.

[0072] (3) dPCR was performed under the following conditions: 95°C for 2 min, 40 cycles of 95°C for 15 s and 59°C for 30 s. Digital signals were read on a QIAcuity One instrument (QIAGEN, 5 channels), and data were analyzed using the QIAcuity Software Suite (version 2.5.0.1).

[0073] The DNA amplicon sequencing analysis method in the embodiment of the present invention is as follows:

[0074] (1) PCR amplification of protoplast DNA template was performed using genomic primers. For each inversion target site, the two boundaries of the left and right ends of the inversion segment were amplified respectively. The 10 μL amplification system contained 4 μL 2×Phanta Max Master Mix (DyePlus), 0.5 μL Forward primer (10 μM), 0.5 μL Reverse primer (10 μM), 1 μL DNA template (~30 ng), and 3 μL ddH2O. Amplification conditions: denaturation at 95°C for 3 minutes; denaturation at 95°C for 15 seconds, annealing at 62°C for 15 seconds, extension at 72°C for 40 seconds, amplification for 35 cycles; incubation at 72°C for 5 minutes; storage at 12 degrees.

[0075] (2) The above amplified product was diluted 20 times, and the diluted PCR product of the first round was used as a template for the second round of amplification. The second round of sequencing primers contained the corresponding barcode. The 30μL amplification system contained 15μL 2×Phanta Max Master Mix (DyePlus), 1μL Forward primer (10μM), 1μL Reverse primer (10μM), 1μL DNA template (~30ng), and 12μL ddH2O. Amplification conditions: denaturation at 95℃ for 3 minutes; denaturation at 95℃ for 15 seconds, annealing at 58℃ for 15 seconds, extension at 72℃ for 20 seconds, amplification for 35 cycles; incubation at 72℃ for 5 minutes; storage at 12 degrees.

[0076] (3) The above products were subjected to agarose gel detection for band size, 10uL of the second round amplification products were taken for each sample, vortexed and mixed, 200uL was taken for PCR product purification, and sent to Suzhou Genewise Biotechnology Co., Ltd. for amplicon sequencing library construction and amplicon sequencing analysis.

[0077] (4) After sequencing is completed, the original data is split according to the sequencing primers. After three repeated experiments, the sequence accuracy of the products at different gene targeting sites is compared and analyzed.

[0078] The ePPEplus system and related vectors in the embodiments of the present invention are preserved in this laboratory and are available to the public from the applicant for only use in repeating the present invention (related literature: Ni, P. et al. Efficient and versatile multiplexprime editing in hexaploid wheat. Genome Biol. 24, 156 (2023)).

[0079] Example 1. Using the Guided Editing System to Perform Large-Segment DNA Inversion Editing in Wheat Protoplasts and Determine the Efficiency and Precision of Inversion Editing

[0080] 1. Process of large-fragment DNA inversion editing based on plant-guided editing system

[0081] 1.1 Modification of different prime editor proteins for comparison of editing efficiency

[0082] The present invention uses the highly efficient multi-gene guided editing protein construct ePPEplus system in plants to achieve inversion editing of DNA fragments in plant genomes. The ePPEplus system (coding sequence is sequence 1 in the sequence list) can express prime editor protein (composed of nCas9 and reverse transcriptase fused, the coding sequence corresponds to nucleotides 628-6810 of sequence 1, and nucleotides 1-561 of sequence 1 are the coding sequence of Csy4 nuclease), and the structural schematic corresponds to Figure 1 The DualPE system (as the experimental group) does not include the UBI sequence and the Term sequence.

[0083] Sequence 1 (5'-3'):

[0084]

[0085] The present invention also modified the prime editor protein of the ePPEplus system to obtain the WT-DualPE system as the experimental control group of the DualPE system. Specifically, the nCas9 protein (nCas9-H840A, which only cuts single-stranded DNA to produce free single strands) in the prime editor protein of the ePPEplus system was mutated into the Cas9 protein, that is, the nucleotides at positions 3232-3234 of sequence 1 were mutated from GCC to CAT (corresponding to the back mutation of alanine A in the protein sequence to histidine H), and the other sequences in the ePPEplus system were kept unchanged (the structural schematic diagram corresponds to Figure 1 The UBI sequence and Term sequence of the WT-DualPE system (as the experimental control group) remained unchanged). The PCR primers for generating point mutations by PCR amplification were: F1: 5′-taacaggctcagcgattacgacgtcgatCATatcgttccacagtcattc-3′; R1: 5′-caccgcgttcaggtacgcgtca-3′. The CMPE-ePPEplus vector (related literature: Ni, P. et al. Efficient and versatile multiplex prime editing in hexaploidwheat. Genome Biol. 24, 156 (2023)) was digested with restriction endonucleases AatII and MluI, and the product fragment amplified by the above F1 / R1 was constructed into the digested vector using the Gibson seamless cloning method to obtain the WT-DualPE vector.

[0086] The present invention also modified the prime editor protein of the ePPEplus system to obtain the Cas9 system as the control group of the DualPE system. Specifically, the ePPEplus system was replaced with the coding sequence of the Cas9 protein, that is, sequence 1 was replaced with sequence 2 to obtain the Cas9 system as the control group (the structural schematic diagram corresponds to Figure 1The Cas9 system in the plant was used, and the UBI sequence and Term sequence remained unchanged). The transformation steps were as follows: pBUE411 vector (related literature: Xing, HLetal. A CRISPR / Cas9 toolkit for multiplex genome editing in plants. BMC Plant Biol. 14, 327 (2014)) was used as a template for PCR amplification, and the PCR primers were as follows: F2: 5′-tttggtgttacttctgcaaagcttatggattacaaggaccacgacg-3′; R2: 5′-agagagactggtgatttcagcgtaccGCGGgagctcacttcttcttc-3′. The CMPE-ePPEplus vector (related literature: Ni, P. et al. Efficient and versatile multiplex prime editing in hexaploid wheat. Genome Biol. 24, 156 (2023)) was digested with restriction endonucleases HindIII and SacII, and the product fragment amplified by the above F2 / R2 was constructed into the digested vector using the Gibson seamless cloning method to obtain the Cas9 vector.

[0087] Sequence 2 (5'-3'):

[0088]

[0089] 1.2 Design of dual pegRNAs for large DNA inversion

[0090] In the present invention, for each inversion sequence targeted, a pair of pegRNAs needs to be designed to specify the editing result. The specific design rules are as follows: For the inversion segment of the organism to be edited, the inversion segment is defined as a double-stranded DNA fragment in the genomic DNA of the organism to be edited, and the double-stranded DNA fragment is formed by two complementary single-stranded DNAs in the direction of 5′ to 3′, named A chain and named B chain, which are complementary and combined in a double helix. The two ends of the inversion segment are respectively called the left end and the right end: the left end is located at the 5′ end of the A chain, and the right end is located at the 3′ end of the A chain; both the left end and the right end contain a PAM sequence, and the PAM in the left end is named PAM A , PAM A The name of the PAM in the right end that is located on the A strand but not on the B strand is PAM B , PAM B Located on the B chain but not on the A chain, PAM is a single-stranded DNA fragment with the nucleotide sequence of 5′-NGG-3′; N is the deoxyribonucleotide A, G, C or T.

[0091] For each inversion sequence to be targeted, a pair of pegRNAs (pegRNA-L targeting the left end of the target sequence to be inverted and pegRNA-R targeting the right end of the target sequence to be inverted, hereinafter referred to as pegL and pegR) need to be designed. pegL contains RTT-L named as the left end of RNA, pegR contains RTT-R named as the right end of RNA, the nucleotide sequence of RTT-L at the left end of RNA is the same as the nucleotide sequence of the A chain at the right end, and the nucleotide sequence of RTT-R at the right end of RNA is the same as the nucleotide sequence of the B chain at the left end.

[0092] When pegL, pegR and the corresponding prime editor protein come into contact with the genomic DNA of the organism to be edited, reverse transcription will be initiated. Subsequently, with the help of DNA double-strand annealing, synthesis, and repair processes, precise inversion of chromosome fragments (such as Figure 2 shown).

[0093] A pair of pegRNA vector sequences used in the present invention is composed of: CmYLCV promoter + Csy4RS sequence + pegL sequence (consisting of spacer sequence + sgRNA scaffold + RTT sequence + PBS sequence + etevopreQ1 motif) + Csy4RS sequence + pegR sequence (consisting of spacer sequence + sgRNA scaffold + RTT sequence + PBS sequence + etevopreQ1 motif) + Csy4RS sequence + terminator sequence (such as Figure 1 ). The paired sgRNA vector sequence is composed of: TaU3 promoter + esgRNA-L sequence (consisting of spacer sequence + sgRNA scaffold) + terminator sequence + TaU3 promoter + esgRNA-R sequence (consisting of spacer sequence + sgRNA scaffold) + terminator sequence (such as Figure 1 ).

[0094] Taking a pair of pegRNAs targeting the target sequence 1 to be inverted as an example, the pegRNA sequence = CmYLCV promoter + Csy4RS sequence + pegL sequence (composed of spacer sequence + sgRNA scaffold + RTT sequence + PBS sequence + etevopreQ1motif) + Csy4RS sequence + pegR sequence (composed of spacer sequence + sgRNA scaffold + RTT sequence + PBS sequence + etevopreQ1motif) + Csy4RS sequence + terminator sequence. The pegRNA sequence is constructed into the pUC57-CmYLCV vector (related literature: Ni, P. et al. Efficient and versatile multiplex prime editing in hexaploidwheat. Genome Biol. 24, 156 (2023)) to achieve the expression of the pegRNA sequence.

[0095] Among them, the CmYLCV promoter sequence (5’-3’): tggcagacatactgtcccacaaatgaagatggaatctgtaaaagaaaacgcgtgaaataatgcgtctgacaaaggttaggtcggctgcctttaatcaataccaaagtggtccctaccacgatggaaaaactgtgcagtcggtttggctttttctgacgaacaaataagattcgtggccgacaggtgggggtccaccatgtgaaggcatcttcagactccaataatggagcaatgacgtaagggcttacgaaataagtaagggtagtttgggaaatgtccactcacccgtcagtctataaatacttagcccctccctcattgttaagggagcaaaatctcagagagatagtcctagagagagaaagagagcaagtagcctagaagtagtcaaggcggcgaagtattcaggcacgtggccaggaagaagaaaagccaagacgacgaaaacaggtaagagctaagctt。

[0096] The Csy4RS sequence (5’-3’): gttcactgccgtataggcag。

[0097] The pegL sequence: GCACTTGGGGCCTCCCTCCTgtttaagagctatgctggaaacagcatagcaagtttaaataaggctagtccgttatcaactt gaaaaagtggcaccgagtcggtgcCAGCGTGCACATTATCTTAACAAGCCCAGCagggaggccCGCGG TTCTATCTAGTTACGCGTTAAACCAACTAGAA。

[0098] The pegR sequence (5’-3’): GATGCATCGGATGAACGGCTgtttaagagctatgctggaaacagcatagcaagtttaaataaggctagtccgttatcaactt gaaaaagtggcaccgagtcggtgcGCCCCTGCTACAACAACTGGAAGACCAAGGcgttcatccgCGCGG TTCTATCTAGTTACGCGTTAAACCAACTAGAA。

[0099] sgRNA scaffold sequence (5'-3') in pegL or pegR: gtttaagagctatgctggaaacagcatagcaagtttaaataaggctagtccgttatcaacttgaaaaagtggcaccgagtcggtgc.

[0100] etevopreQ1 motif sequence in pegL or pegR (5'-3'): CGCGGTTCTATCTAGTTACGCGTTAAACCAACTAGAA.

[0101] Terminator sequence (5'-3'): tttctccataataatgtgtgagtagttcccagataagggaattagggttcctatagggtttcgctcatgtgttgagcatataagaaacccttagta tgtatttgtatttgtaaaatacttctatcaataaaatttctaattcctaaaaccaaaatccagtactaaaatccagatc.

[0102] The paired sgRNA vector sequence consists of: TaU3 promoter + esgRNA-L sequence (consisting of spacer sequence + sgRNA scaffold) + terminator sequence + TaU3 promoter + esgRNA-R sequence (consisting of spacer sequence + sgRNA scaffold) + terminator sequence.

[0103] Among them, the TaU3 promoter sequence (5’-3’): CATGAATCCAAACCACACGGAGTTCAAATTCCCACAGATTAAGGCTCGTCCGTCGCACAAGGTAATGTGTGAATATTATATCTGTCGTGCAAAATTGCCTGGCCTGCACAATTGCTGTTATAGTTGGCGGCAGGGAGAGTTTTAACATTGACTAGCGTGCTGATAATTTGTGAGAAATAATAATTGACAAGTAGATACTGACATTTGAGAAGAGCTTCTGAACTGTTATTAGTAACAAAAATGGAAAGCTGATGCACGGAAAAAGGAAAGAAAAAGCCATACTTTTTTTTAGGTAGGAAAAGAAAAAGCCATACGAGACTGATGTCTCTCAGATGGGCCGGGATCTGTCTATCTAGCAGGCAGCAGCCCACCAACCTCACGGGCCAGCAATTACGAGTCCTTCTAAAAGCTCCCGCCGAGGGGCGCTGGCGCTGCTGTGCAGCAGCACGTCTAACATTAGTCCCACCTCGCCAGTTTACAGGGAGCAGAACCAGCTTATAAGCGGAGGCGCGGCACCAAGAAGCG。

[0104] The esgRNA-L sequence (5’-3’): GCACTTGGGGCCTCCCTCCTgtttaagagctatgctggaaacagcatagcaagtttaaataaggctagtccgttatcaactt gaaaaagtggcaccgagtcggtgc。

[0105] The esgRNA-R sequence (5’-3’): GATGCATCGGATGAACGGCTgtttaagagctatgctggaaacagcatagcaagtttaaataaggctagtccgttatcaactt gaaaaagtggcaccgagtcggtgc。

[0106] The terminator sequence (5’-3’): tttttttgttttttatgtct。

[0107] For other target sequences, it is only necessary to design for the target sequence and replace the spacer sequence, RTT sequence and PBS sequence in the vector to achieve the targeting of different target sequences. The spacer sequence in each pegRNA (i.e., the same as the spacer sequence in the control group sgRNA), RTT sequence, and PBS sequence are shown in Table 1.

[0108] Table 1. pegRNA and sgRNA sequences used in the experiment

[0109]

[0110]

[0111] Note: All sequences are in the 5' to 3' direction. For the same target site, the spacer sequence used in the paired sgRNA is the same as the spacer sequence used in the pegRNA. In the table, inv means inversion.

[0112] 2. Detection of the efficiency and precision of large DNA inversion in wheat protoplasts

[0113] In order to test the effect of the DualPE-guided editing system-related protein construct of the present invention on the inversion editing of large fragments of the wheat genome, the present invention sets three experimental groups, respectively using DualPE and paired pegRNA design (experimental group), WT-DualPE and paired pegRNA (experimental control group), Cas9 and paired sgRNA (control group), and the inversion editing effect of 5 endogenous large fragments of wheat (713bp, 1.5kb, 2.6kb, 74.4kb, 252.6kb) to be inverted target sequences is compared and tested. The sequence information of spacer, PBS, and RTT on pegRNA is shown in Table 1. The present invention co-transforms these constructs into wheat protoplast cells and performs efficiency determination by using digital PCR. The primers and probe sequences used for digital PCR are shown in Table 2.

[0114] Table 2. Primers used for digital PCR determination of wheat protoplast inversion efficiency

[0115]

[0116] The results showed that DualPE can effectively achieve the inversion of five target sequence sites of different lengths on the wheat genome (target sequence 1 is 713bp, target sequence 2 is 1.1kb, target sequence 3 is 2.6kb, target sequence 4 is 74.4kb, and target sequence 5 is 252.6kb), with efficiencies of 8.4%, 0.4%, 1.5%, 0.2% and 0.2% respectively. The present invention amplified the left and right ends of the target inversion target sequence and performed DNA amplicon second generation sequencing analysis ( Figure 3 ). The results showed that DualPE-induced inversions had extremely high accuracy at all tested targets, with completely accurate sequences accounting for 98.8% and 95.2% at the left and right ends of the inversion segments, respectively. The proportion of byproducts at the left and right boundaries of the edited segments mediated by WT-DualPE and Cas9 was generally higher than that of DualPE.

[0117] Example 2. DualPE-mediated large inversion in wheat mutants

[0118] 1. Obtaining wheat large fragment inversion mutants mediated by Agrobacterium transformation

[0119] In order to test the potential of DualPE in the stable transformation of wheat to mediate large DNA inversion in mutant genomes, the present invention selected three wheat target sites, designed corresponding dual pegRNAs, and constructed them into the pB-DualPE vector (schematic diagram is Figure 1 In pB-DualPE, the target sequence 6 was 7.4 kb, the target sequence 7 was 19.2 kb, and the target sequence 8 was 82.8 kb (the sequence information of spacer, PBS, and RTT on pegRNA is shown in Table 1). The above vector was transformed by Agrobacterium-mediated wheat genetic transformation, and the transformation recipient was the wheat variety Fielder.

[0120] The primers in Table 3 were used to amplify the left and right ends of the inversion segment of the obtained wheat T0 plants (the target bands amplified by L_pF+R_pF and L_pR+R_pR proved the occurrence of inversion) and wild type amplification identification (the target bands amplified by L_pF+L_pR and R_pF+R_pR indicated that the non-inverted chromosome fragments still existed, that is, the mutant plants were not homozygous inversion mutants). The results showed that a total of 85 (7.4kb inversion, mutation efficiency 51.5%, precise mutation rate 68.2%), 19 (19.2kb inversion, mutation efficiency 31.7%, precise mutation rate 68.2%) and 23 (82.8kb inversion, mutation efficiency 57.9%, precise mutation rate 100%) wheat mutants with inversion of the target sequence were obtained. Figure 4 ). In the wheat mutants with 7.4kb (T0-5) and 19.2kb (T0-10) target sequence inversions mediated by DualPE, there were byproducts derived from the transcription of the pegRNA scaffold. In addition, in the 7.4kb inversion mutant (T0-28) mediated by DualPE, there was a single nucleotide variation (SNP) caused by the microhomology sequence at the end of the inversion segment. These results indicate the ability of DualPE-mediated wheat mutants to efficiently generate the expected target sequence inversion.

[0121] 2. DualPE-mediated promoter exchange in wheat inversion mutants

[0122] One potential use of DualPE-mediated inversion is to exchange promoters and change gene expression patterns. The present invention selects SOG1 and GASR7 genes with different expression patterns on the short arm of wheat chromosome 7B, designs pegL between the promoter and coding region of GASR7, and designs pegR between the promoter and coding region of SOG1 to exchange the promoters of GASR7 and SOG1 ( Figure 5 The sequence information of sgRNA, PBS, and RTT on pegRNA is shown in Table 1). The entire inversion segment is approximately 205.4 kb. Inversion-specific primers were used at the left and right ends of the target inversion segment for amplification and identification and Sanger sequencing ( Figure 5 b and c, amplification primers are shown in Table 3), 32 wheat plants with 205.4 kb inversion were identified among 116 regenerated plants, with a mutation efficiency of 27.6%, and the left and right ends of the inversion target sequences of the 32 mutants were completely accurate ( Figure 4 In addition, the expression levels of the two genes were determined by qRT-PCR in the T0 mutants (T0-3, T0-27) (primers are shown in Table 3). The results showed that after the target sequence was inverted, the expression level of GASR7, whose promoter was expected to be exchanged, was significantly reduced to 3.7 to 4.9 times that of the wild-type plants, while the expression level of SOG1 increased to about 2.0 times that of the wild-type plants ( Figure 5 (d)

[0123] Example 3. Determination of the efficiency and accuracy of large DNA inversion editing in tobacco leaves

[0124] In order to test the effect of DualPE in mediating large fragment inversion in tobacco, the present invention uses DualPE and paired pegRNA to test five endogenous targets in tobacco. Target sequence 1 is an inversion of 829bp, target sequence 2 is an inversion of 3.6kb, target sequence 3 is an inversion of 3.9kb, target sequence 4 is an inversion of 4.2kb, and target sequence 5 is an inversion of 20.1kb. The sequence information of spacer, PBS, and RTT on pegRNA is shown in Table 1. The corresponding dual pegRNA was constructed on pH-2×35s-DualPE and transformed with Agrobacterium. After Agrobacterium injection and infection of tobacco leaves, DNA extraction, dPCR was used for efficiency determination (dPCR primers are shown in Table 2), and the left and right ends were subjected to amplicon second-generation sequencing for analysis of its accuracy (amplification primers are shown in Table 3). Figure 6As shown, the results show that DualPE can effectively achieve inversion of 829bp, 3.6kb, 3.9kb, 4.2kb, and 20.1kb fragments at different endogenous target sites in the genome of this tobacco leaf, with an efficiency of up to 4.2%. After DNA extraction and DNA amplicon second-generation sequencing analysis, the results showed that the target sequence inversion induced by DualPE at all target sites was extremely accurate, and the proportion of completely accurate sequences at the left and right ends exceeded 75%.

[0125] Example 4. DualPE-mediated editing of large inversion fragments in tomato mutants

[0126] In order to test the effect of DualPE on large-fragment editing in tomatoes, the present invention designed a pair of dual pegRNAs, constructed them into the pH-EF1α-DualPE vector, and performed inversion of the target sequence 1 of 725 bp (the sequence information of spacer, PBS, and RTT on the pegRNA is shown in Table 1). The above-mentioned vector was transformed by Agrobacterium-mediated genetic transformation of tomato, and the transformation recipient was the tomato variety Ailsa Craig. The 23 mutants obtained were amplified and identified by amplification of the left and right ends of the inversion segment (the target bands amplified by L_pF+R_pF and L_pR+R_pR proved the occurrence of inversion, and the primer sequences are shown in Table 3) and wild-type amplification identification (the target bands amplified by L_pF+L_pR and R_pF+R_pR indicated that the non-inverted chromosome fragments still existed, that is, the mutant plants were not homozygous inversion mutants, and the primer sequences were shown in Table 3). Figure 7 As shown, the results showed that the 725bp target fragment inversion was successfully achieved in mutants T0-1, T0-2, T0-4, T0-7, T0-8, T0-11, T0-14, T0-15, T0-17 and T0-22, with an efficiency of 43.5%, and Sanger sequencing showed that the inversion segment was completely accurate at the left and right ends.

[0127] Table 3. Primer sequences used in the present invention

[0128]

[0129]

[0130]

[0131] The present invention has been described in detail above. For those skilled in the art, without departing from the purpose and scope of the present invention, and without the need to carry out unnecessary experimental conditions, the present invention can be implemented in a wide range under equivalent parameters, concentrations and conditions. Although the present invention provides specific embodiments, it should be understood that the present invention can be further improved. In a word, according to the principles of the present invention, the application is intended to include any changes, uses or improvements to the present invention, including departure from the disclosed scope in the application, and changes made with conventional techniques known in the art.

Claims

1. A method for causing inversion of a DNA fragment in a biological genome, characterized in that: The method comprises: A1) providing a segment to be inverted of a to-be-edited organism, wherein the segment to be inverted is a double-stranded DNA fragment in the genomic DNA of the to-be-edited organism, wherein the double-stranded DNA fragment is formed by two complementary single-stranded DNAs named A chain and B chain complementary and bound in a double helix manner, wherein the direction of the A chain is 5′ to 3′ from the left end to the right end, and the direction of the B chain is 5′ to 3′ from the right end to the left end, and the two ends of the segment to be inverted are respectively called the left end and the right end, wherein the left end is located at the 5′ end of the A chain, and the right end is located at the 3′ end of the A chain, and both the left end and the right end contain PAM, and the name of the PAM in the left end is PAM A , the PAM A Located on the A strand but not on the B strand, the name of the PAM in the right terminus is PAM B , the PAM B Located on the B chain but not on the A chain, the PAM is a single-stranded DNA fragment with a nucleotide sequence of 5′-NGG-3′; the N is a deoxyribonucleotide A, G, C or T; A2) providing two pegRNAs named pegL and pegR, wherein pegL contains RNA named 左末端 RTT-L, the pegR-containing RNA 右末端 RTT-R, the RNA 左末端 The nucleotide sequence of RTT-L is identical to the nucleotide sequence of the A chain at the right end, and the RNA 右末端 The RTT-R nucleotide sequence is identical to the nucleotide sequence of the B chain at the left end; A3) providing a prime editor protein, wherein the prime editor protein is a protein having reverse transcriptase activity and nicking activity on double-stranded DNA; A4) contacting the two pegRNAs and the prime editor protein with the genomic DNA of the organism to be edited, thereby inverting the segment to be inverted in the genome of the organism to be edited.

2. The method according to claim 1, characterized in that: The length of the left end and / or the right end is equal to the length of the RTT-L and / or the RTT-R.

3. The method according to claim 1 or 2, characterized in that: The organism is a plant; the plant is a monocot and / or a dicot.

4. DNA, characterized in that: The DNA is at least one of the following: B1) two pegRNA genes, wherein the two pegRNA genes are DNAs capable of transcribing the pegL and pegR described in claim 1, B2) DNA for inverting a DNA fragment in an organism's genome, the DNA comprising a gene encoding the primeeditor protein of claim 1 and the two pegRNA genes of B1), B3) a recombinant vector containing the DNA described in B1), B4) A recombinant vector containing the DNA described in B2).

5. The DNA according to claim 4, characterized in that: The organism is a plant; the plant is a monocot and / or a dicot.

6. Use of a recombinant microorganism containing the DNA of claim 4 or 5 in preparing a product causing inversion of a DNA fragment in an organism's genome.

7. The use according to claim 6, characterized in that: The organism is a plant; the plant is a monocot and / or a dicot.

8. A composition, characterized in that: The composition contains the two pegRNAs described in claim 1 and the prime editor protein described in claim 1.

9. The composition according to claim 8, characterized in that: The coding sequence of the prime editor protein is sequence 1 or nucleotides 628-6810 of sequence 1 in the sequence list.

Images