Array for detecting spatial information of nucleic acid and detection method

Abstract

Methods of detecting spatial information of nucleic acids in a sample are provided, as well as nucleic acid arrays for use in the methods and methods of generating the nucleic acid arrays.

Description

[0001] This divisional application is based on the original Chinese patent application with application number CN 202080036185.5, application date May 14, 2020, entitled "Array and Detection Method for Detecting Spatial Information of Nucleic Acids". Technical Field

[0002] This invention relates to the field of spatial detection of biomolecules. Specifically, this invention provides a method for detecting the spatial information of nucleic acids in a sample, as well as a nucleic acid array for the method and a method for generating the nucleic acid array. Background Art

[0003] The spatial location of cells within a tissue significantly influences their function. To explore this spatial heterogeneity, it is necessary to quantify and analyze the cellular genome or transcriptome with known spatial coordinates. However, collecting small tissue regions or even single cells for genomic or transcriptomic analysis is extremely laborious, expensive, and lacks precision. Therefore, it is essential to develop a method that can achieve high-throughput detection of the spatial information (e.g., localization, distribution, and / or expression of nucleic acids) at the single-cell or even subcellular level. Summary of the Invention

[0004] To achieve spatial detection of nucleic acids, existing technologies combine array technology with high-throughput DNA sequencing to capture and locate labeled nucleic acids in tissue samples, followed by sequencing and analysis. To obtain chips capable of achieving this purpose, existing technologies immobilize nucleic acid-capturing probes onto the chip using spotting or microbead-mediated methods. However, chips obtained using droplet-based spotting systems have active areas up to 200 micrometers in size, with a cell observation precision of only 20 cells; chips obtained using microbeads with positioning markers for planar spreading have active areas up to 10 micrometers in size, with cell observation precision limited to single cells, failing to achieve subcellular localization. This invention provides a novel nucleic acid array for spatial detection, its preparation method, and a nucleic acid spatial detection method based on this array, which can simultaneously achieve high-precision subcellular localization and high-throughput tissue localization, possessing significant application value.

[0005] Preparation of nucleic acid arrays

[0006] In a first aspect, the present invention provides a method for generating a nucleic acid array for detecting spatial information of nucleic acids in biological samples, the method comprising the following steps:

[0007] (1) Provides multiple vector sequences, each containing multiple copies of the vector sequence, wherein the vector sequence includes, from 5' to 3', a positioning sequence and a first fixed sequence.

[0008] The positioning sequence has a unique nucleotide sequence that corresponds to the position of the vector sequence on the array;

[0009] The first fixed sequence allows the complementary nucleotide sequence to anneal and initiate an extension reaction;

[0010] (2) Connect the various carrier sequences to the surface of a solid support (e.g., a chip);

[0011] (3) Provide a first primer and use the vector sequence as a template to perform a primer extension reaction, so that the first fixed sequence and the localization sequence region of the vector sequence form a double strand, wherein the strand that hybridizes with the vector sequence is the first nucleic acid molecule, and the first nucleic acid molecule contains complementary sequences of the first fixed sequence and the localization sequence from the 5' to the 3' direction; wherein the first primer contains a complementary region of the first fixed sequence at its 3' end, the first fixed sequence complementary region contains the complementary sequence of the first fixed sequence or a fragment thereof, and has a 3' free end.

[0012] In some embodiments, the vector sequence and the first nucleic acid molecule are single-stranded nucleic acid sequences. In some embodiments, the vector sequence and the first nucleic acid molecule are single-stranded DNA sequences.

[0013] In some implementations, in step (3), the vector sequence is sequenced while the extension reaction is being performed, thereby obtaining sequence information of the positioning sequence contained in the vector sequence.

[0014] In some implementations, multiple vector sequences are provided in step (1) through the following steps:

[0015] (i) Provides multiple vector template sequences, wherein the vector template sequence includes a complementary sequence to the vector sequence;

[0016] (ii) Using each vector template sequence as a template, a nucleic acid amplification reaction is performed to obtain an amplification product for each vector template sequence, wherein the amplification product contains multiple copies of the vector sequence.

[0017] In some implementations, the amplification is selected from rolling circle replication (RCA), bridged PCR amplification, multiple strand displacement amplification (MDA), or emulsion PCR amplification.

[0018] In some embodiments, rolling circle replication is performed to obtain a DNB formed from multiples of the vector sequence. In such embodiments, a circular template sequence is provided in step (i). Methods for preparing circular nucleic acid molecules are conventional in the art and can be selected as needed by those skilled in the art; for example, a linear nucleic acid template can be obtained first, and then circularized using a ligase (e.g., DNA ligase).

[0019] In some implementations, bridging PCR amplification, emulsion PCR amplification, or multiple strand displacement amplification is performed to obtain DNA clusters in the form of clonal groups of the vector sequence.

[0020] In some implementations, the method further includes the following steps:

[0021] (4) Provide a second nucleic acid molecule containing a capture sequence;

[0022] The capture sequence is capable of hybridizing with all or part of the nucleic acid to be captured, and includes: (a) an oligonucleotide sequence capable of capturing mRNA; and / or, (b) a random or degenerate oligonucleotide sequence; or, (c) a specific sequence targeting a particular nucleic acid; and the capture sequence has a 3' free end so that the second nucleic acid molecule can be used as an extension primer.

[0023] (5) Link the second nucleic acid molecule to the first nucleic acid molecule (e.g., using a ligase to link the second nucleic acid molecule to the first nucleic acid molecule).

[0024] In some embodiments, the second nucleic acid molecule is a single-stranded nucleic acid sequence. In some embodiments, the second nucleic acid molecule is a single-stranded DNA sequence. In some embodiments, the second nucleic acid molecule is a single-stranded RNA sequence.

[0025] In some embodiments, the second nucleic acid molecule includes a fixation region and a capture sequence from the 5' to 3' direction, wherein the fixation region contains a double-stranded nucleic acid sequence, such as a double-stranded DNA sequence. In some embodiments, the capture sequence included in the second nucleic acid molecule is a single-stranded nucleic acid sequence, such as a single-stranded DNA sequence or a single-stranded RNA sequence. It is readily understood that in such embodiments, the second nucleic acid molecule has a partially double-stranded structure, that is, its fixation region has a double-stranded structure and its capture sequence has a single-stranded structure.

[0026] In some implementations, the length of the double-stranded nucleic acid sequence is 1bp-50bp, for example 10bp-50bp, 10bp-40bp, or 10bp-30bp.

[0027] In some other embodiments, the method further includes the following steps:

[0028] (4) Provide a second nucleic acid molecule, wherein the second nucleic acid molecule contains a second fixed sequence complementary sequence and a capture sequence in the 5' to 3' direction;

[0029] The complementary sequence of the second fixed sequence allows hybridization with its complementary nucleotide sequence;

[0030] The capture sequence is capable of hybridizing with all or part of the nucleic acid to be captured, and includes: (a) an oligonucleotide sequence capable of capturing mRNA; and / or, (b) a random or degenerate oligonucleotide sequence; or, (c) a specific sequence for a particular target nucleic acid; and the capture sequence has a 3' free end so that the second nucleic acid molecule can be used as an extension primer;

[0031] (5) Under conditions that allow annealing, the complementary sequence of the second fixed sequence is hybridized with the second fixed sequence, thereby linking the second nucleic acid molecule to the vector sequence;

[0032] (6) Optionally, the first nucleic acid molecule and the second nucleic acid molecule, which are hybridized to the vector sequence respectively, are ligated (e.g., the second nucleic acid molecule is ligated to the first nucleic acid molecule using a ligase).

[0033] In such embodiments, each vector sequence further includes a second fixed sequence at its 5' end, which allows annealing of its complementary nucleotide sequence. In some embodiments, the second fixed sequence allows annealing of its complementary nucleotide sequence and initiates an extension reaction (e.g., it can serve as a binding site for bridging PCR primers).

[0034] In some embodiments, the second nucleic acid molecule is a single-stranded nucleic acid sequence. In some embodiments, the second nucleic acid molecule is a single-stranded DNA sequence. In some embodiments, the second nucleic acid molecule is a single-stranded RNA sequence.

[0035] In some implementations, the second fixed sequence is adjacent to the positioning sequence.

[0036] In some implementations, the length of the second fixed sequence is 1bp-50bp, for example 10bp-50bp, 10bp-40bp, 10bp-30bp, or 10bp-20bp.

[0037] In some embodiments, in step (3), the first primer further includes a unique molecular identifier (UMI) sequence at the 5' end of its first fixed sequence complementary region, such that the first nucleic acid molecule includes the UMI sequence at the 5' end of its first fixed sequence complementary region; or, in step (4), the second nucleic acid molecule further includes a UMI sequence located at the 5' end of the capture sequence;

[0038] The UMI sequence is a nucleotide sequence consisting of at least one (e.g., at least two, at least three, at least four, or at least five; e.g., 5-100, 5-50, 5-20, e.g., 10) N, each N being independently any one of A, C, G, and T.

[0039] In some embodiments, when the first primer contains a unique molecular identifier (UMI) sequence at the 5' end of its first fixed sequence complementary region, the first primer may further contain an additional sequence at the 5' end of the UMI sequence.

[0040] In some embodiments, the oligonucleotide sequence capable of capturing mRNA includes a sequence capable of hybridizing to the poly-A tail of mRNA. In some embodiments, the oligonucleotide sequence capable of capturing mRNA includes a poly-T oligonucleotide sequence. In some embodiments, the poly-T oligonucleotide sequence includes at least 10 (e.g., at least 20) deoxythymidine residues.

[0041] In some embodiments, the solid support is a microarray. In some embodiments, the solid support can be used as a sequencing platform, such as a sequencing microarray. In some embodiments, the solid support is a high-throughput sequencing microarray, such as a high-throughput sequencing microarray used in Illumina, MGI, or Thermo Fisher sequencing platforms.

[0042] In a second aspect, the present invention provides a method for generating a nucleic acid array for detecting spatial information of nucleic acids in biological samples, the method comprising the following steps:

[0043] (1) Provides multiple vector sequences, each containing multiple copies of the vector sequence, wherein the vector sequence comprises, from 5' to 3', a capture template sequence, a positioning sequence, and a first fixation sequence.

[0044] The capture template sequence includes a complementary sequence to the capture sequence, which is capable of hybridizing with all or part of the nucleic acid to be captured, including: (a) an oligonucleotide sequence capable of capturing mRNA; and / or, (b) a random or degenerate oligonucleotide sequence; or, (c) a specific sequence for a particular target nucleic acid;

[0045] The positioning sequence has a unique nucleotide sequence that corresponds to the position of the vector sequence on the array;

[0046] The first fixed sequence allows annealing of its complementary nucleotide sequence and initiates an extension reaction; and the first fixed sequence also includes a cleavage site, the cleavage of which may be selected from nicking enzyme cleavage, USER cleavage, optical excision, chemical excision or CRISPR excision.

[0047] (2) Connect the various carrier sequences to the surface of a solid support (e.g., a chip);

[0048] (3) Provide a first primer (or probe primer), the first primer comprising a binding region, a cleavage region and a first fixed sequence complementary region in the 5' to 3' direction, the first fixed sequence complementary region comprising a complementary sequence of the first fixed sequence or a fragment thereof, and having a 3' free end; the binding region comprising a linker capable of connecting to the surface of the solid support; the cleavage region comprising a cleavage site;

[0049] Using the first primer as a primer and the vector sequence as a template, a primer extension reaction is performed, causing the first fixed sequence, the localization sequence, and the capture template sequence region of the vector sequence to form a double strand. The strand that hybridizes with the vector sequence is the first nucleic acid molecule. The first nucleic acid molecule contains a first fixed sequence complementary sequence, a localization sequence complementary sequence, and a capture sequence from the 5' to 3' direction. The first nucleic acid molecule can also be called a capture probe.

[0050] (4) Connect the first primer to the surface of the solid support; wherein steps (3) and (4) are performed in any order;

[0051] (5) Optionally, the first fixed sequence of the vector sequence is cleaved at the cleavage site to digest the vector sequence, so that the extension product in step (3) is separated from the template (i.e. the vector sequence) that forms the extension product, thereby connecting the first nucleic acid molecule (capture probe) to the surface of a solid support (e.g., a chip).

[0052] Since the capture probe (i.e., the first nucleic acid molecule) is obtained by extending the vector sequence using primers, the capture probe contains a unique localization complementary sequence corresponding to the position of the capture probe (vector sequence) on the array, as well as a capture sequence capable of hybridizing with all or part of the nucleic acid molecule to be captured. The position of the capture probe on the array can be determined by analyzing the localization complementary sequence.

[0053] In this paper, the term "each vector sequence" refers to a vector sequence that contains the same localization sequence.

[0054] In some implementations, multiple vector sequences are provided in step (1) through the following steps:

[0055] (i) Provides multiple vector template sequences, wherein the vector template sequence includes a complementary sequence to the vector sequence;

[0056] (ii) Using each vector template sequence as a template, a nucleic acid amplification reaction is performed to obtain an amplification product for each vector template sequence, wherein the amplification product contains multiple copies of the vector sequence.

[0057] In some implementations, the amplification is selected from rolling circle replication (RCA), bridged PCR amplification, multiple strand displacement amplification (MDA), or emulsion PCR amplification.

[0058] In some embodiments, rolling circle replication is performed to obtain a DNB formed from multiples of the vector sequence. In such embodiments, a circular template sequence is provided in step (i). Methods for preparing circular nucleic acid molecules are conventional in the art and can be selected as needed by those skilled in the art; for example, a linear nucleic acid template can be obtained first, and then circularized using a ligase (e.g., DNA ligase).

[0059] In some implementations, each vector sequence is a DNB formed by multiple copies of the vector sequence.

[0060] In some implementations, step (1) includes the following steps:

[0061] (1a) A circular nucleic acid template is provided, the circular nucleic acid template comprising a vector template sequence, the vector template sequence comprising a complementary sequence of the vector sequence, that is, the vector template sequence comprising a first fixed sequence complementary sequence, a positioning sequence complementary sequence and a capture sequence in the 5' to 3' direction;

[0062] (1b) Using the circular nucleic acid template as a template, rolling circle amplification (RCA) is performed to obtain nanospheres (DNB) formed by multiples of the vector sequence.

[0063] In some implementations, bridging PCR amplification, emulsion PCR amplification, or multiple strand displacement amplification is performed to obtain DNA clusters in the form of clonal groups of the vector sequence.

[0064] In some embodiments, the first fixed sequence includes a cleavage site that is a nicking enzyme cleavage site. In some embodiments, the nicking enzyme is selected from USER, BamHI, BmtI, etc. In some exemplary embodiments, the cleavage site is as shown in SEQ ID NO:14.

[0065] In some embodiments, the first fixed sequence further includes a sequencing primer hybridization region and / or an amplification primer hybridization region; wherein the sequencing primer hybridization region allows the sequencing primers to anneal and initiate the sequencing reaction, and the amplification primer hybridization region allows the amplification primers to anneal and initiate the extension and amplification reactions.

[0066] In some embodiments, the length of the first fixed sequence is greater than 1 bp, for example, greater than 10 bp, or greater than 20 bp. In some embodiments, the length of the first fixed sequence is 20-100 bp, for example, 20-80 bp.

[0067] In some embodiments, the length of the positioning sequence is greater than 1 bp, for example, greater than 10 bp. In some embodiments, the length of the positioning sequence is 10-100 bp, for example, 10-50 bp, for example, 10-30 bp, for example, 20 bp.

[0068] In some embodiments, the oligonucleotide sequence capable of capturing mRNA includes a sequence capable of hybridizing to the poly-A tail of mRNA. In some embodiments, the oligonucleotide sequence capable of capturing mRNA includes a poly-T oligonucleotide sequence. In some embodiments, the poly-T oligonucleotide sequence includes at least 10 (e.g., at least 20) deoxythymidine residues.

[0069] In some embodiments, the length of the capture sequence is greater than 1 bp. In some embodiments, the length of the capture sequence is 1-100 bp, for example 10-50 bp, for example 10-30 bp.

[0070] In some embodiments, the vector sequence further includes a UMI complementary sequence (also referred to as a probe tag region) located downstream of the capture template sequence and upstream of the first immobilized sequence, which is complementary to the UMI sequence. The UMI sequence is a nucleotide sequence consisting of at least one (e.g., at least two, at least three, at least four, or at least five; e.g., 5-100, 5-50, 5-20, e.g., 10) N nucleotide sequence, each N being independently any of A, C, G, and T. In some embodiments, the UMI complementary sequence is located between the positioning sequence and the capture template sequence. In other embodiments, the UMI complementary sequence is located between the first immobilized sequence and the positioning sequence. In such embodiments, in step (3), when a primer extension reaction is performed using the vector sequence as a template, the first nucleic acid molecule / capture probe hybridizing with the vector sequence will accordingly include the UMI sequence (also referred to as a probe tag).

[0071] In some embodiments, to obtain the aforementioned UMI sequence or its complementary sequence, the template sequence of the vector sequence (i.e., the vector template sequence) includes a UMI template sequence at a corresponding position. The UMI template sequence is a sequence composed of modified bases capable of forming hydrogen bonds with various major bases (e.g., C, G, A, T, U), such as inosine, which can pair complementaryly with bases A, C, and U. Without being theoretically constrained, it is assumed that when the vector template sequence includes the UMI template sequence, during rolling circle replication, bases complementary to the UMI template sequence randomly bind with each replication, resulting in each replication product carrying a unique, randomly formed UMI sequence. This distinguishes each replication product, allowing for the capture of different nucleic acid molecules and copy number quantification. In some embodiments, the UMI template sequence includes multiple inosines (e.g., at least 10, e.g., 10-100). In some embodiments, the length of the UMI template sequence is greater than 1 bp. In some embodiments, the length of the UMI template sequence is greater than 5 bp. In some implementations, the length of the UMI template sequence is 5-100 bp, for example 5-50 bp, for example 5-20 bp, for example 5-15 bp, for example 10 bp.

[0072] In some embodiments, the solid support is a chip. In some embodiments, the solid support can be used as a sequencing platform. In some embodiments, the solid support is a sequencing chip (manufactured by BGI Genomics), such as the sequencing chip of the BGISEQ-500 platform. In some embodiments, the solid support is a high-density array chip, for example, which can be obtained by the method described in patent CN103180496B.

[0073] The vector sequence (e.g., DNB) can be attached to the surface of a solid support by any suitable method known in the art. In some embodiments, non-limiting examples of such methods include nucleic acid hybridization, biotin-streptavidin binding, thiol binding, photoactivated binding, covalent binding, antibody-antigen, physical confinement via hydrogels or other porous polymers, or any combination thereof.

[0074] In some embodiments, the solid support is selected from the following materials: glass, silicon, polylysine coating materials, nitrocellulose, polystyrene, cyclic olefin copolymers (COCs), cyclic olefin polymers (COPs), polypropylene, polyethylene, or polycarbonate, etc.

[0075] In some implementations, in step (3), the vector sequence (e.g., the positioning sequence contained therein) is sequenced while the primer extension reaction is being performed, thereby obtaining the sequence information of the positioning sequence contained in the vector sequence.

[0076] In some embodiments, prior to step (3), a step of sequencing the vector sequence (e.g., the localization sequence it contains) is included. In some embodiments, after sequencing is completed, dNTPs added to the synthetic strand during sequencing are removed by washing.

[0077] In some embodiments, the linker is a linker group capable of coupling with an activating group (e.g., NH2). In such embodiments, the solid support surface is modified with an activating group (e.g., NH2). In some embodiments, the linker includes -SH, -DBCO, or -NHS, etc. In some exemplary embodiments, the linker is DBCO, and the solid support surface is connected with... 8-NHS ester.

[0078]

[0079] In some embodiments, the cleavage region of the first primer includes a cleavage site that can be controlled by chemical, enzymatic, or photochemical methods. In some embodiments, the cleavage site is an enzyme cleavage site. In some embodiments, the cleavage site is the USER enzyme cleavage site (UUU).

[0080] In some implementations, the cleavage region of the first primer is different from the cleavage site contained in the first fixed sequence of the vector sequence.

[0081] In some implementations, the amplification includes PCR.

[0082] Nucleic acid arrays and kits

[0083] In a third aspect, the present invention provides a nucleic acid array for detecting spatial information of nucleic acids in a sample, comprising a solid support (e.g., a chip) with multiple carrier sequences attached to its surface, each carrier sequence occupying a different position in the array, each carrier sequence comprising multiple copies of the carrier sequence, wherein the carrier sequence comprises, from 5' to 3', a positioning sequence and a first fixed sequence.

[0084] The positioning sequence has a unique nucleotide sequence that corresponds to the position of the vector sequence on the array;

[0085] The first fixed sequence allows the complementary nucleotide sequence to anneal and initiate an extension reaction.

[0086] In some embodiments, the area (i.e., the active region) occupied by each carrier sequence (i.e., carrier sequences containing the same positioning sequence) on the surface of the solid support has a diameter of less than 1 micrometer, for example, about 900 nanometers, about 800 nanometers, about 700 nanometers, about 600 nanometers, or about 500 nanometers.

[0087] In some embodiments, the nucleic acid array further comprises a first nucleic acid molecule containing, from 5' to 3', a first fixed sequence complementary sequence and a localization sequence complementary sequence, and hybridizing with the first fixed sequence and localization sequence of the vector sequence to form a double strand. It is readily understood that only the first fixed sequence complementary sequence and the localization sequence complementary sequence in the first nucleic acid molecule are complementary to the corresponding sequences of the vector sequence to form a double strand; therefore, the double strand formed by the first fixed sequence and the vector sequence is an incomplete double strand, i.e., a partially double-stranded structure.

[0088] In some implementations, each copy of the vector sequence in each vector sequence contains a first nucleic acid molecule that it hybridizes with.

[0089] In some embodiments, the vector sequence and the first nucleic acid molecule are single-stranded nucleic acid sequences. In some embodiments, the vector sequence and the first nucleic acid molecule are single-stranded DNA sequences.

[0090] In some embodiments, the nucleic acid array further includes a second nucleic acid molecule linked to the first nucleic acid molecule to be immobilized to the nucleic acid array, the second nucleic acid molecule including a capture sequence;

[0091] The capture sequence is capable of hybridizing with all or part of the nucleic acid to be captured, and includes: (a) an oligonucleotide sequence capable of capturing mRNA; and / or, (b) a random or degenerate oligonucleotide sequence; or, (c) a specific sequence for a particular target nucleic acid; and the capture sequence has a 3' free end so that the second nucleic acid molecule can be used as an extension primer.

[0092] In some implementations, each first nucleic acid molecule is linked to a second nucleic acid molecule.

[0093] In some implementations, the 5' end of the second nucleic acid molecule is connected to the 3' end of the first nucleic acid molecule.

[0094] In other embodiments, the nucleic acid array further includes a second nucleic acid molecule that hybridizes with a vector sequence to immobilize the nucleic acid array.

[0095] In such embodiments, each vector sequence further includes a second fixed sequence at its 5' end, the second fixed sequence allowing annealing of its complementary nucleotide sequence; and,

[0096] The second nucleic acid molecule contains a second fixed sequence complementary sequence and a capture sequence from the 5' to 3' direction; the second fixed sequence complementary sequence hybridizes with the second fixed sequence of the vector sequence to form a double strand;

[0097] The capture sequence is capable of hybridizing with all or part of the nucleic acid to be captured, and includes: (a) an oligonucleotide sequence capable of capturing mRNA; and / or, (b) a random or degenerate oligonucleotide sequence; or, (c) a specific sequence for a particular target nucleic acid; and the capture sequence has a 3' free end so that the second nucleic acid molecule can be used as an extension primer.

[0098] In some implementations, each copy of the vector sequence in each vector sequence contains a second nucleic acid molecule that it hybridizes with.

[0099] In some implementations, the second fixed sequence allows annealing of its complementary nucleotide sequence and initiation of an extension reaction (e.g., it can serve as a binding site for bridging PCR primers).

[0100] In some implementations, the second fixed sequence is adjacent to the positioning sequence.

[0101] In some embodiments, the second nucleic acid molecule has a 5' end modification. In some embodiments, the modification is phosphorylation or biotinylation.

[0102] In some embodiments, the second nucleic acid molecule is a single-stranded nucleic acid sequence. In some embodiments, the second nucleic acid molecule is a single-stranded DNA sequence. In some embodiments, the second nucleic acid molecule is a single-stranded RNA sequence.

[0103] In some embodiments, the plurality of copies of the vector sequence are amplification products formed by amplifying a complementary sequence of the vector sequence as a template, wherein the amplification is selected from rolling circle replication (RCA), bridge PCR amplification, multiple strand displacement amplification (MDA), or emulsion PCR amplification.

[0104] In some embodiments, the plurality of copies of the vector sequence are DNBs formed by multiple copies of the vector sequence. In some embodiments, the plurality of copies of the vector sequence are DNBs formed by rolling circle replication using a complementary sequence of the vector sequence as a template.

[0105] In some implementations, the plurality of copies of the vector sequence are DNA clusters formed by clonal groups of the vector sequence.

[0106] In some implementations, the plurality of copies of the vector sequence are DNA clusters formed by bridge PCR amplification using a complementary sequence of the vector sequence as a template.

[0107] In some implementations, the plurality of copies of the vector sequence are DNA clusters formed by emulsion PCR amplification using a complementary sequence of the vector sequence as a template.

[0108] In some implementations, the multiple copies of the vector sequence are DNA clusters formed by multistrand displacement amplification using the complementary sequence of the vector sequence as a template.

[0109] In some embodiments, the first nucleic acid molecule further includes a unique molecular identifier (UMI) sequence located at the 5' end of the complementary sequence to the first fixed sequence; or, the second nucleic acid molecule further includes a UMI sequence located at the 5' end of the capture sequence.

[0110] The UMI sequence is a nucleotide sequence consisting of at least one (e.g., at least two, at least three, at least four, or at least five; e.g., 5-100, 5-50, 5-20, e.g., 10) N, each N being independently any one of A, C, G, and T.

[0111] In some implementations, the UMI sequences contained in each first nucleic acid molecule are different from each other.

[0112] In some implementations, the UMI sequences contained in each second nucleic acid molecule are different from each other.

[0113] In some embodiments, the solid support is a microarray. In some embodiments, the solid support can be used as a sequencing platform, such as a sequencing microarray. In some embodiments, the solid support is a high-throughput sequencing microarray, such as a high-throughput sequencing microarray used in Illumina, MGI, or Thermo Fisher sequencing platforms.

[0114] In some embodiments, the oligonucleotide sequence capable of capturing mRNA includes a sequence capable of hybridizing to the poly-A tail of mRNA. In some embodiments, the oligonucleotide sequence capable of capturing mRNA includes a poly-T oligonucleotide sequence. In some embodiments, the poly-T oligonucleotide sequence includes at least 10 (e.g., at least 20) deoxythymidine residues.

[0115] In some embodiments, the length of the positioning sequence is greater than 1 nt, for example, greater than 5 nt. In some embodiments, the length of the positioning sequence is 5-50 nt, for example, 10-50 nt, 10-30 nt, or 20-30 nt. In some embodiments, the lengths of the positioning sequences contained in different vector sequences may be the same or different.

[0116] In some embodiments, the length of the capture sequence is greater than 1 nt. In some embodiments, the length of the capture sequence is 1-100 nt, for example 1-50 nt, for example 10-30 nt.

[0117] In some embodiments, the length of the first fixed sequence is greater than 1 nt, for example, greater than 10 nt. In some embodiments, the length of the first fixed sequence is 10-200 nt. In some embodiments, the length of the first fixed sequence is 20-100 nt, for example, 20-50 nt.

[0118] In some embodiments, the length of the second fixed sequence is greater than 1 nt, for example, greater than 10 nt. In some embodiments, the length of the second fixed sequence is 10-200 nt, for example, 10-100 nt, 10-50 nt, 10-30 nt, or 10-20 nt.

[0119] In a fourth aspect, the present invention provides a kit for detecting spatial information of nucleic acids in a sample, comprising: (i) the nucleic acid array described in the third aspect, wherein the nucleic acid array does not contain a second nucleic acid molecule; and (ii) a second nucleic acid molecule comprising a fixed region and a capture sequence in the 5' to 3' direction;

[0120] The capture sequence is capable of hybridizing with all or part of the nucleic acid to be captured, and includes: (a) an oligonucleotide sequence capable of capturing mRNA; and / or, (b) a random or degenerate oligonucleotide sequence; or, (c) a specific sequence for a particular target nucleic acid; and the capture sequence has a 3' free end so that the second nucleic acid molecule can be used as an extension primer.

[0121] In some embodiments, the kit comprises: (i) a nucleic acid array including a solid support (e.g., a chip) with multiple vector sequences attached to its surface, each vector sequence occupying a different position in the array, each vector sequence comprising multiple copies of the vector sequence, the vector sequences comprising, from 5' to 3', a positioning sequence and a first fixed sequence.

[0122] The positioning sequence has a unique nucleotide sequence that corresponds to the position of the vector sequence on the array;

[0123] The first fixed sequence allows the complementary nucleotide sequence to anneal and initiate an extension reaction;

[0124] The nucleic acid array further comprises a first nucleic acid molecule, which includes, from 5' to 3', a first fixed sequence complementary sequence and a localization sequence complementary sequence, and hybridizes with the first fixed sequence and localization sequence of the vector sequence to form a double strand;

[0125] And, (ii) a second nucleic acid molecule, wherein the fixed region of the second nucleic acid molecule contains a double-stranded DNA sequence.

[0126] It is readily understood that a ligase can be used to ligate the second nucleic acid molecule described in (ii) to the first nucleic acid molecule contained in the nucleic acid array described in (i). Therefore, in some embodiments, the kit further comprises a ligase.

[0127] In other embodiments, the kit comprises: (i) a nucleic acid array including a solid support (e.g., a chip) with multiple vector sequences attached to its surface, each vector sequence occupying a different position in the array, each vector sequence comprising multiple copies of the vector sequence, the vector sequences comprising, from 5' to 3': a second fixed sequence, a positioning sequence, and a first fixed sequence.

[0128] The second fixed sequence allows annealing of its complementary nucleotide sequence;

[0129] The positioning sequence has a unique nucleotide sequence that corresponds to the position of the vector sequence on the array;

[0130] The first fixed sequence allows the complementary nucleotide sequence to anneal and initiate an extension reaction;

[0131] The nucleic acid array further comprises a first nucleic acid molecule, which includes, from 5' to 3', a first fixed sequence complementary sequence and a localization sequence complementary sequence, and hybridizes with the first fixed sequence and localization sequence of the vector sequence to form a double strand;

[0132] And, (ii) a second nucleic acid molecule, wherein the fixed region of the second nucleic acid molecule contains a second fixed sequence complementary sequence.

[0133] In some implementations, the second fixed sequence is adjacent to the positioning sequence.

[0134] It is readily understood that, under conditions allowing annealing, the second nucleic acid molecule described in (ii) can hybridize with the complementary region of the vector sequence contained in the nucleic acid array described in (i), and subsequently, a ligase can be used to ligate the second nucleic acid molecule to the first nucleic acid molecule. Therefore, in some embodiments, the kit further comprises a ligase.

[0135] In another aspect, the present invention also relates to the use of the nucleic acid array described in the third aspect or the kit described in the fourth aspect for detecting spatial information of nucleic acids in a sample, or for use in the preparation of detection reagents for detecting spatial information of nucleic acids in a sample.

[0136] In some implementations, the spatial information of the nucleic acid includes the location, distribution, and / or expression of the nucleic acid.

[0137] In some embodiments, the sample is a tissue sample, such as a tissue sample containing cells. In some embodiments, the sample is a tissue section. In some embodiments, the tissue section is prepared from fixed tissue, such as formalin-fixed paraffin-embedded (FFPE) tissue or deep-frozen tissue.

[0138] In a fifth aspect, the present invention also relates to a nucleic acid array for detecting spatial information of nucleic acids in a sample, comprising a solid support (e.g., a chip) with multiple carrier sequences attached to its surface, each carrier sequence occupying a different position in the array, each carrier sequence comprising multiple copies of the carrier sequence, wherein the carrier sequence comprises, from 5' to 3', a capture template sequence, a positioning sequence, and a first immobilization sequence, wherein,

[0139] The capture template sequence includes a complementary sequence to the capture sequence, which is capable of hybridizing with all or part of the nucleic acid to be captured, including: (a) an oligonucleotide sequence capable of capturing mRNA; and / or, (b) a random or degenerate oligonucleotide sequence; or, (c) a specific sequence for a particular target nucleic acid;

[0140] The positioning sequence has a unique nucleotide sequence that corresponds to the position of the vector sequence on the array;

[0141] The first fixed sequence allows annealing of its complementary nucleotide sequence and initiates an extension reaction, and the first fixed sequence also contains a cleavage site, the cleavage of which may be selected from nicking enzyme cleavage, USER cleavage, optical excision, chemical excision or CRISPR excision.

[0142] The nucleic acid array also includes a first nucleic acid molecule (also known as a capture probe), which includes, from 5' to 3', a binding region, a cleavage region, and a vector sequence complementary region.

[0143] The bonding region includes connectors capable of being connected to the surface of the solid support;

[0144] The excision area includes the cutting site;

[0145] The vector sequence complementary region includes a sequence that is complementary to the vector sequence, which includes, from 5' to 3': a first fixed sequence complementary sequence, a localization sequence complementary sequence, and a capture sequence; and the capture sequence has a 3' free end so that the first nucleic acid molecule can be used as an extension primer;

[0146] Furthermore, the complementary region of the vector sequence of the first nucleic acid molecule hybridizes with the vector sequence to form a double strand.

[0147] In some embodiments, the vector sequence and the first nucleic acid molecule are single-stranded nucleic acid sequences. In some embodiments, the vector sequence and the first nucleic acid molecule are single-stranded DNA sequences.

[0148] In some implementations, each copy of the vector sequence in each vector sequence contains the aforementioned first nucleic acid molecule that has hybridized with it.

[0149] In some embodiments, the linker of the first nucleic acid molecule is a linker group capable of coupling with an activating group (e.g., NH2), and the surface of the solid support is modified with an activating group (e.g., NH2). In some embodiments, the linker includes -SH, -DBCO, or -NHS. In some embodiments, the linker is... (DBCO), the surface of the solid support is connected with ( 8-NHSester).

[0150] In some embodiments, the first fixed sequence includes a cleavage site that is a nicking enzyme cleavage site. In some embodiments, the nicking enzyme is selected from USER, BamHI, BmtI, etc. In some exemplary embodiments, the cleavage site is as shown in SEQ ID NO:14.

[0151] In some embodiments, the cleavage site included in the excision region of the first nucleic acid molecule is a site that can be cleaved in a controlled manner by chemical, enzymatic, or photochemical methods. In some embodiments, the cleavage site is an enzyme cleavage site. In some embodiments, the cleavage site is the USER enzyme cleavage site (UUU).

[0152] In some implementations, the cleavage region of the first nucleic acid molecule is different from the cleavage site contained in the first fixed sequence of the vector sequence.

[0153] In some embodiments, the nucleic acid array is prepared by the method described in the second aspect.

[0154] In some embodiments, the plurality of copies of the vector sequence are amplification products formed by amplifying a complementary sequence of the vector sequence as a template, wherein the amplification is selected from rolling circle replication (RCA), bridge PCR amplification, multiple strand displacement amplification (MDA), or emulsion PCR amplification.

[0155] In some embodiments, the plurality of copies of the vector sequence are DNBs formed by multiple copies of the vector sequence. In some embodiments, the plurality of copies of the vector sequence are DNBs formed by rolling circle replication using a complementary sequence of the vector sequence as a template.

[0156] In some implementations, the plurality of copies of the vector sequence are DNA clusters formed by clonal groups of the vector sequence.

[0157] In some implementations, the plurality of copies of the vector sequence are DNA clusters formed by bridge PCR amplification using a complementary sequence of the vector sequence as a template.

[0158] In some implementations, the plurality of copies of the vector sequence are DNA clusters formed by emulsion PCR amplification using a complementary sequence of the vector sequence as a template.

[0159] In some implementations, the multiple copies of the vector sequence are DNA clusters formed by multistrand displacement amplification using the complementary sequence of the vector sequence as a template.

[0160] In some embodiments, the vector sequence further comprises a UMI complementary sequence located downstream of the capture template sequence and upstream of the first immobilization sequence, which is complementary to the UMI sequence, the UMI sequence being a nucleotide sequence consisting of at least one (e.g., at least two, at least three, at least four, or at least five; e.g., 5-100, 5-50, 5-20, e.g., 10) N nucleotide sequence, each N being independently any one of A, C, G, and T;

[0161] Furthermore, the vector sequence complementary region of the first nucleic acid molecule further includes a UMI sequence located upstream of the capture sequence and downstream of the complementary sequence of the first fixed sequence.

[0162] In some implementations, the UMI complementary sequence is located between the positioning sequence and the capture template sequence, or between the first fixed sequence and the positioning sequence.

[0163] In some implementations, each copy of the vector sequence (i.e., vector sequences containing the same localization sequence) has a distinct UMI complementary sequence. Accordingly, the first nucleic acid molecule (capture probe) hybridizing with each copy of the vector sequence also has a distinct UMI sequence.

[0164] In some embodiments, the vector sequence is removed from the nucleic acid array via a cleavage site contained in a first fixed sequence of the vector sequence. In such embodiments, the nucleic acid array includes a solid support (e.g., a chip) with a variety of capture probes (first nucleic acid molecules) attached to its surface. Each capture probe (first nucleic acid molecule) occupies a different position in the array and is oriented with a 3' free end so that it can act as an extension primer. Each capture probe (first nucleic acid molecule) includes, from 5' to 3', a binding region, a cleavage region, a localization sequence complement, and a capture sequence.

[0165] The bonding region includes connectors capable of being connected to the surface of the solid support;

[0166] The excision area includes the cutting site;

[0167] The positioning sequence corresponds to the position of the capture probe on the array;

[0168] The capture sequence is capable of hybridizing with all or part of the nucleic acid to be captured, including: (1a) an oligonucleotide sequence capable of capturing mRNA; and / or, (1b) a random or degenerate oligonucleotide sequence; or, (c) a specific sequence for a particular target nucleic acid.

[0169] In some embodiments, each of the capture probes (i.e., capture probes containing the same localization sequence / localization sequence complement) has a distinct UMI sequence, the UMI sequence being upstream of the capture sequence and downstream of the excision region. In some embodiments, the UMI sequence is located at the 5' end of the capture sequence, for example, between the capture sequence and the localization sequence complement. In other embodiments, the UMI sequence is located at the 5' end of the localization sequence complement, for example, between the excision region and the localization sequence complement.

[0170] In some embodiments, the diameter of the area (i.e., the active region) occupied by each carrier sequence (i.e., a carrier sequence containing the same targeting sequence) or each capture probe (i.e., a capture probe containing the same targeting sequence / complementary targeting sequence) on the surface of the solid support is less than 1 micrometer, for example, about 900 nanometers, about 800 nanometers, about 700 nanometers, about 600 nanometers, or about 500 nanometers. In some embodiments, the diameter of the active region of each carrier sequence or each capture probe is about 500 nanometers.

[0171] In some embodiments, the solid support is a chip. In some embodiments, the solid support can be used as a sequencing platform. In some embodiments, the solid support is a sequencing chip (manufactured by BGI Genomics), such as the BGISEQ-500 platform. In some embodiments, the solid support is a high-density array chip, which can be obtained, for example, by the method described in patent CN103180496B.

[0172] In some embodiments, the length of the first fixed sequence is greater than 1 bp, for example, greater than 10 bp, or greater than 20 bp. In some embodiments, the length of the first fixed sequence is 20-100 bp, for example, 20-80 bp.

[0173] In some embodiments, the length of the positioning sequence is greater than 1 bp, for example, greater than 10 bp. In some embodiments, the length of the positioning sequence is 10-100 bp, for example, 10-50 bp, for example, 10-30 bp, for example, 20 bp.

[0174] In some embodiments, the oligonucleotide sequence capable of capturing mRNA includes a sequence capable of hybridizing to the poly-A tail of mRNA. In some embodiments, the oligonucleotide sequence capable of capturing mRNA includes a poly-T oligonucleotide sequence. In some embodiments, the poly-T oligonucleotide sequence includes at least 10 (e.g., at least 20) deoxythymidine residues.

[0175] In some embodiments, the length of the capture sequence is greater than 1 bp. In some embodiments, the length of the capture sequence is 1-100 bp, for example 10-50 bp, for example 10-30 bp.

[0176] Detection method

[0177] In a sixth aspect, the present invention provides a method for detecting the spatial information of nucleic acids in a sample, comprising the following steps:

[0178] (1) Providing the nucleic acid array as described in the third aspect, or obtaining the nucleic acid array by the method described in the first aspect; wherein,

[0179] The nucleic acid array comprises multiple vector sequences attached to the surface of a solid support (e.g., a chip), each vector sequence occupying a different position in the array, and each vector sequence comprising multiple copies of the vector sequence;

[0180] Each vector sequence contains a first nucleic acid molecule and a second nucleic acid molecule that it hybridizes with, and the first nucleic acid molecule and the second nucleic acid molecule are not connected to each other;

[0181] The first nucleic acid molecule contains a complementary sequence to the localization sequence corresponding to the position of the vector sequence on the array.

[0182] The second nucleic acid molecule contains a capture sequence capable of capturing nucleic acids in the sample;

[0183] (2) The nucleic acid array is brought into contact with the sample to be tested under annealing conditions so that the nucleic acid in the sample to be tested anneals with the capture sequence of the second nucleic acid molecule, thereby making the position of the nucleic acid correspond to the position of the vector sequence on the nucleic acid array;

[0184] (3)(i) When the first nucleic acid molecule and the second nucleic acid molecule are not ligated to each other, the first nucleic acid molecule and the second nucleic acid molecule hybridized to each vector sequence are ligated (e.g., using a ligase);

[0185] Under conditions allowing primer extension, using the first and second connected nucleic acid molecules as primers and the captured nucleic acid molecule as a template, a primer extension reaction is performed to generate an extension product. The strand hybridizing with the captured nucleic acid molecule has a complementary sequence to the positioning sequence contained in the first nucleic acid molecule as a spatial information marker; and / or,

[0186] Using the captured nucleic acid molecule as a primer and the first and second nucleic acid molecules connected as templates, a primer extension reaction is performed to generate an extended captured nucleic acid molecule, wherein the extended captured nucleic acid molecule has the positioning sequence as a spatial information marker.

[0187] Alternatively, (ii) when the first and second nucleic acid molecules are not ligated to each other, under conditions allowing primer extension, the second nucleic acid molecule is used as a primer and the captured nucleic acid molecule is used as a template to perform a primer extension reaction to generate an extended second nucleic acid molecule, the extended second nucleic acid molecule containing a complementary sequence to the captured nucleic acid; the first nucleic acid molecule hybridized to each vector sequence and the extended second nucleic acid molecule are ligated (e.g., using a ligase), the extended second nucleic acid molecule ligated to the first nucleic acid molecule having a complementary sequence to the positioning sequence contained in the first nucleic acid molecule as a spatial information marker;

[0188] Alternatively, (iii) when the first and second nucleic acid molecules are linked together, under conditions allowing primer extension, a primer extension reaction is performed using the linked first and second nucleic acid molecules as primers and the captured nucleic acid molecule as a template to produce an extension product, wherein the strand hybridizing with the captured nucleic acid molecule has a complementary sequence to the positioning sequence contained in the first nucleic acid molecule as a spatial information marker; and / or,

[0189] Using the captured nucleic acid molecule as a primer and the first and second nucleic acid molecules connected as templates, a primer extension reaction is performed to generate an extended captured nucleic acid molecule, wherein the extended captured nucleic acid molecule has the positioning sequence as a spatial information marker.

[0190] (4) Releasing at least a portion of spatially labeled nucleic acid molecules from the array surface, wherein the portion includes a positioning sequence or its complementary strand, and a captured nucleic acid molecule or its complementary strand; and

[0191] (5) Analyze the sequence of the nucleic acid molecules released in step (4) directly or indirectly.

[0192] In such implementations, the first and second nucleic acid molecules on the nucleic acid array are not connected before the target nucleic acid is captured in step (2).

[0193] In a seventh aspect, the present invention provides a method for detecting the spatial information of nucleic acids in a sample, comprising the following steps:

[0194] (1) Providing the nucleic acid array as described in the first aspect, or obtaining the nucleic acid array by the method described in the third aspect; wherein,

[0195] The nucleic acid array comprises multiple vector sequences attached to the surface of a solid support (e.g., a chip), each vector sequence occupying a different position in the array, and each vector sequence comprising multiple copies of the vector sequence;

[0196] Each vector sequence contains a first nucleic acid molecule that it hybridizes with, and the first nucleic acid molecule is linked to a second nucleic acid molecule;

[0197] The first nucleic acid molecule contains a complementary sequence to the localization sequence corresponding to the position of the vector sequence on the array.

[0198] The second nucleic acid molecule contains a capture sequence capable of capturing nucleic acids in the sample;

[0199] (2) The nucleic acid array is brought into contact with the sample to be tested under annealing conditions so that the nucleic acid in the sample to be tested anneals with the capture sequence of the second nucleic acid molecule, thereby making the position of the nucleic acid correspond to the position of the vector sequence on the nucleic acid array;

[0200] (3)(iii) Under conditions allowing primer extension, using the first and second connected nucleic acid molecules as primers and the captured nucleic acid molecule as a template, a primer extension reaction is performed to generate an extension product, wherein the strand hybridizing with the captured nucleic acid molecule has a complementary sequence to the positioning sequence contained in the first nucleic acid molecule as a spatial information marker; and / or,

[0201] Using the captured nucleic acid molecule as a primer and the first and second nucleic acid molecules connected as templates, a primer extension reaction is performed to generate an extended captured nucleic acid molecule, wherein the extended captured nucleic acid molecule has the positioning sequence as a spatial information marker.

[0202] (4) Releasing at least a portion of spatially labeled nucleic acid molecules from the array surface, wherein the portion includes a positioning sequence or its complementary strand, and a captured nucleic acid molecule or its complementary strand; and

[0203] (5) Analyze the sequence of the nucleic acid molecules released in step (4) directly or indirectly.

[0204] In such implementations, the first nucleic acid molecule on the nucleic acid array is linked to the second nucleic acid molecule before the target nucleic acid is captured in step (2).

[0205] In some embodiments of the method described in the sixth or seventh aspect, the plurality of copies of the vector sequence are DNBs formed by polymers of the vector sequence, or the plurality of copies of the vector sequence are DNA clusters in the form of clonal groups of the vector sequence.

[0206] In some embodiments of the method described in the sixth or seventh aspect, the vector sequence, the first nucleic acid molecule, is single-stranded DNA. In some embodiments, the second nucleic acid molecule is single-stranded DNA or single-stranded RNA.

[0207] In an eighth aspect, the present invention provides a method for detecting the spatial information of nucleic acids in a sample, comprising the following steps:

[0208] (1) Provide the nucleic acid array as described in the fifth aspect, or obtain the nucleic acid array by the method of the second aspect; wherein the nucleic acid array comprises a plurality of carrier sequences attached to the surface of a solid support (e.g., a chip), each carrier sequence occupying a different position in the array, and each carrier sequence comprising multiple copies of the carrier sequence;

[0209] Each vector sequence contains a first nucleic acid molecule that it hybridizes with, the first nucleic acid molecule containing a positioning sequence complementary to the position of the vector sequence on the array and a capture sequence capable of capturing nucleic acids in the sample;

[0210] (2) The nucleic acid array is brought into contact with the sample to be tested under annealing conditions so that the nucleic acid in the sample to be tested anneals with the capture sequence of the first nucleic acid molecule, thereby making the position of the nucleic acid correspond to the position of the first nucleic acid molecule on the nucleic acid array;

[0211] (3) Under the condition that primer extension is allowed, the first nucleic acid molecule is used as a primer and the captured nucleic acid molecule is used as a template to carry out a primer extension reaction to generate an extension product. The strand that hybridizes with the captured nucleic acid molecule has a spatial information marker that is complementary to the positioning sequence contained in the first nucleic acid molecule.

[0212] (4) Releasing at least a portion of spatially labeled nucleic acid molecules from the array surface, wherein the portion includes a positioning sequence or its complementary strand, and a captured nucleic acid molecule or its complementary strand; and

[0213] (5) Analyze the sequence of the nucleic acid molecules released in step (4) directly or indirectly.

[0214] In some embodiments, prior to step (2), the method further includes cleaving the vector sequence at cleavage sites contained in a first fixed sequence to digest the vector sequence, while simultaneously attaching the first nucleic acid molecule (capture probe) to the surface of a solid support (e.g., a chip). In such embodiments, the nucleic acid array includes multiple capture probes attached to the surface of the solid support (e.g., a chip), each capture probe occupying a different position in the array, and the capture probe includes a localization sequence complementary to the position of that capture probe on the array and a capture sequence capable of capturing nucleic acids in a sample;

[0215] (2) The nucleic acid array is brought into contact with the sample to be tested under annealing conditions so that the nucleic acid in the sample to be tested anneals with the capture sequence of the capture probe, thereby making the position of the nucleic acid correspond to the position of the capture probe on the nucleic acid array.

[0216] (3) Under the condition that primer extension is allowed, the capture probe is used as a primer and the captured nucleic acid molecule is used as a template to perform a primer extension reaction. The resulting extension product contains the complementary sequence of the positioning sequence as a spatial information marker and the complementary sequence of the captured nucleic acid molecule, thereby generating a spatially marked DNA molecule; optionally, the complementary strand of the spatially marked DNA molecule is generated, and / or optionally, the spatially marked DNA molecule is amplified.

[0217] (4) Releasing at least a portion of spatially labeled DNA molecules and / or their complementary strands or amplicones from the array surface, wherein said portion includes a spatially labeled sequence or its complementary strand; and

[0218] (5) Analyze the sequence of the nucleic acid molecules released in step (4) directly or indirectly.

[0219] In some embodiments of the method described in the eighth aspect, the first nucleic acid molecule, the capture probe, is a DNA molecule, such as single-stranded DNA.

[0220] In some embodiments of the method described in any of the sixth to eighth aspects, the spatial information of the nucleic acid includes the location, distribution, and / or expression of the nucleic acid.

[0221] In some embodiments of the method described in any of the sixth to eighth aspects, the sample is a tissue sample, such as a tissue section. In some embodiments, the tissue section is prepared from fixed tissue, such as formalin-fixed paraffin-embedded (FFPE) tissue or deep-frozen tissue.

[0222] In some embodiments of the method described in any of the sixth to eighth aspects, the method is used for non-diagnostic purposes.

[0223] In some embodiments of the method described in any of the sixth to eighth aspects, any nucleic acid analysis method may be used in step (5). In some embodiments, this step may include sequencing. In some embodiments, sequence-specific analysis methods may be used. For example, a sequence-specific amplification reaction may be performed, such as by using primers that are specific to the positioning domain and / or a specific target sequence (e.g., a specific target DNA to be tested). Therefore, in some embodiments, this step may include a sequence-specific PCR reaction.

[0224] In some embodiments of the method described in any of the sixth to eighth aspects, the sequence analysis information obtained in step (5) can be used to obtain spatial information (i.e., location information) of nucleic acids in the sample. In some embodiments, this spatial information can be inferred from the nature of the measured sequence analysis information, for example, it can reveal the presence of a specific nucleic acid that may itself have spatial information significance in the environment of the sample being tested, and / or the spatial information can be inferred by combining the location of the sample on the array with sequencing information (e.g., spatial localization). Therefore, the method may only include the step of associating the sequence analysis information with a certain location on the sample, for example, by using a localization marker and its association with a certain location on the sample. In some embodiments, spatial information can be conveniently obtained by associating sequence analysis data and sample images. Therefore, in such embodiments, the method described in any of the sixth to eighth aspects further includes step (6): associating the sequence analysis information obtained in step (5) with an image of the sample, wherein the sample is imaged before or after step (3). In some embodiments, the imaging of the sample is performed using light, bright field, dark field, phase difference, fluorescence, mirror, interference, or confocal microscopy, or a combination thereof.

[0225] In some embodiments of the method described in the sixth aspect, the method is used to detect the transcriptome in a sample. In such embodiments, in step (3)(i), a cDNA molecule is synthesized from a captured RNA molecule using first and second ligated nucleic acid molecules as reverse transcription primers, the cDNA molecule having a spatial information marker complementary to the positioning sequence contained in the first nucleic acid molecule, and optionally, the cDNA molecule is amplified; or, in step (3)(ii), a cDNA molecule is synthesized from a captured RNA molecule using a second nucleic acid molecule as a reverse transcription primer, and the first nucleic acid molecule and the cDNA molecule hybridized to each vector sequence are ligated (e.g., using a ligase) to produce a cDNA molecule having a spatial information marker complementary to the positioning sequence contained in the first nucleic acid molecule, and optionally, the cDNA molecule is amplified; and, in step (4), at least a portion of the cDNA molecule and / or its amplicon is released from the array surface, wherein the released nucleic acid molecule may be the first and / or second strand of the cDNA molecule or its amplicon, and wherein the portion contains the spatial information sequence or its complementary strand. In some embodiments, in step (1), the capture sequence comprises an oligonucleotide sequence capable of capturing mRNA.

[0226] In some embodiments of the method described in the seventh aspect, the method is used to detect the transcriptome in a sample. In such embodiments, in step (3)(iii), a cDNA molecule is synthesized from a captured RNA molecule using first and second connected nucleic acid molecules as reverse transcription primers, the cDNA molecule having a spatial information marker complementary to the positioning sequence contained in the first nucleic acid molecule, and optionally, the cDNA molecule is amplified; and in step (4), at least a portion of the cDNA molecule and / or its amplicons is released from the array surface, wherein the released nucleic acid molecule may be the first and / or second strand of the cDNA molecule or its amplicons, and wherein the portion contains the spatial information sequence or its complementary strand. In some embodiments, in step (1), the capture sequence comprises an oligonucleotide sequence capable of capturing mRNA.

[0227] In some embodiments of the method described in aspect eight, the method is used to detect the transcriptome in a sample. In such embodiments, in step (3), a cDNA molecule is synthesized from a captured RNA molecule using the capture probe as an RT primer, the cDNA molecule having a spatial information marker, and optionally, the cDNA molecule is amplified; in such embodiments, in step (3), a cDNA molecule is synthesized from a captured RNA molecule using the first nucleic acid molecule as an RT primer, the cDNA molecule having a spatial information marker complementary to the positioning sequence contained in the first nucleic acid molecule, and optionally, the cDNA molecule is amplified. In step (4), at least a portion of the cDNA molecule and / or its amplicon is released from the array surface, wherein the released nucleic acid molecule may be the first and / or second strand of the cDNA molecule or its amplicon, and wherein the portion contains the spatial information marker sequence or its complementary strand. In some embodiments, in step (1), the capture sequence comprises an oligonucleotide sequence capable of capturing mRNA.

[0228] In certain embodiments of the method described in any of the sixth to eighth aspects, the complementary strand or the second strand of the cDNA is generated before or after the spatially labeled nucleic acid molecule (e.g., DNA molecule) or the spatially labeled cDNA molecule is released from the array surface.

[0229] The synthesis of second-strand DNA (e.g., cDNA) can be performed in situ on the array, either as a standalone second-strand synthesis step or as the initial step in an amplification reaction. Alternatively, the first strand of DNA (e.g., cDNA) (i.e., the strand generated using the captured nucleic acid molecule as a template) can be released from the array before second-strand synthesis, for example, by reacting in solution, either as a standalone step or as a step in an amplification reaction.

[0230] When second-strand synthesis is performed on the array (i.e., in situ), the method may include an optional step of removing captured nucleic acid molecules (such as RNA) prior to second-strand synthesis, for example using an RNA nitrase (RNase), such as RNase H. The procedure for this step is well known and documented in the art. However, this step is generally unnecessary, and in most cases, the RNA will degrade naturally. The step of removing the sample from the array also typically removes the RNA from the array.

[0231] In some embodiments, the second strand of DNA (e.g., cDNA) is generated in a single reaction, and the second strand synthesis can be achieved by any suitable method known in the art. For example, the first strand of cDNA released from an array is then used as a template for DNA synthesis using random primers (e.g., hexametic primers) and a DNA polymerase (e.g., strand displacement polymerase). Thus, in some embodiments, the synthesis of the complementary strand or second strand uses random primers and a strand displacement polymerase.

[0232] In some embodiments of the method described in any of the sixth to eighth aspects, a further step of amplifying the spatially labeled nucleic acid molecule (e.g., DNA molecule) or cDNA molecule is included prior to sequence analysis. In some embodiments, the amplification step is performed after the spatially labeled nucleic acid molecule (e.g., DNA molecule) or cDNA molecule is released from the array, or the amplification step is performed in situ on the array (i.e., while the first nucleic acid molecule and / or vector sequence and / or capture probe are still attached to the surface of the solid support). In some embodiments, the amplification step includes PCR.

[0233] In some embodiments of the method described in any of the sixth to eighth aspects, in step (4), the molecules are released from the array surface by: (i) nucleic acid cleavage; (ii) denaturation; and / or (iii) physical methods. In some embodiments, the molecules are released by applying hot water or a buffer solution to the solid support.

[0234] In some implementations, a further step of purifying the released molecules is included before sequencing.

[0235] In some implementations, after the sample comes into contact with the array and before step (3), a step of replenishing the sample with water is further included.

[0236] In some embodiments, prior to step (4), the method further includes a step of washing the array to remove residual sample (e.g., tissue).

[0237] In some implementations, the array includes at least one orientation marker to orient the samples on the array.

[0238] In some embodiments, the sequence analysis step in step (5) includes a sequencing step. In some embodiments, the sequencing step includes a sequencing reaction based on a reversible staining terminator.

[0239] The method for detecting nucleic acid spatial information described in any of the sixth to eighth aspects of this invention can be used for RNA detection, transcriptome analysis, DNA detection, and genome analysis. Spatial information is of great significance to transcriptomics and genomics research, especially useful in the study of transcriptome or genome variations in different cells or regions of tissues, such as comparing normal and diseased cells or tissues, or studying transcriptome or genome changes in disease progression.

[0240] For example, pathophysiological analysis of Alzheimer's disease shows that its pathogenesis involves the interaction between neurons and glial cells, while related transcriptomic and epigenomic studies have also found that neuronal function is severely impaired and innate immune responses are abnormal in the brains of Alzheimer's patients. However, population-level studies cannot reveal the complexity of changes between cells and within cell populations, especially for rare cell types. Ordinary single-cell level studies also cannot distinguish the characteristics of specific cell types in different tissue regions at the same time from changes in cellular composition during neurodegenerative diseases. Therefore, to further elucidate the pathogenic mechanisms and development patterns of the disease, it is urgently necessary to obtain single-cell transcriptomic information with a spatial dimension.

[0241] The method for detecting nucleic acid spatial information according to any one of the sixth to eighth aspects of the present invention can immobilize nucleic acid molecules from different regions of a brain tissue sample onto a chip via a capture sequence with location markers, and then perform sequencing to obtain transcriptome results containing accurate location information, thereby enabling the detection of changes in specific cell types in different regions during Alzheimer's disease lesions. In particular, because the active regions of DNB or DNA clusters on the chip of the present invention are down to the nanometer scale, while the cell diameter is approximately 12 μm, the chip of the present invention can achieve subcellular resolution spatial localization information.

[0242] The present invention also includes the following exemplary embodiments:

[0243] Project 1. A method for generating a nucleic acid array, said nucleic acid array being used to detect spatial information of biomolecules (e.g., nucleic acids) in a sample, said method comprising the following steps:

[0244] (1) A circular nucleic acid template is provided, the circular nucleic acid template comprising a template sequence of a capture probe, the template sequence comprising an adapter region, a spatial tag region, and a capture region in the 5' to 3' direction; wherein,

[0245] The connector region contains cleavage sites, and the cleavage can be selected from nicking enzyme cleavage, USER cleavage, optical excision, chemical excision, or CRISPR excision.

[0246] The spatial tag region contains a spatial tag sequence, which corresponds to the position of the capture probe on the array;

[0247] The capture region contains a capture sequence capable of capturing biomolecules (e.g., nucleic acids) in a sample; wherein the capture sequence includes: (1a) an oligonucleotide sequence capable of capturing mRNA; and / or, (1b) a random or degenerate oligonucleotide sequence; or, (c) a specific sequence for a particular target molecule (e.g., a target nucleic acid);

[0248] (2) Using the circular nucleic acid template as a template, rolling circle amplification (RCA) is performed to obtain nanospheres (DNB) formed by multiples of the complementary sequence of the template sequence (i.e., the template complementary sequence);

[0249] (3) Connect the DNB to the surface of a solid support (e.g., a chip);

[0250] (4) Probe primers are provided, and a primer extension reaction is performed using the template complementary sequence contained in the DNB as a template to generate an extension product, wherein the strand hybridizing with the template complementary sequence is the capture probe; optionally, the extension product is amplified; the probe primers include a binding region, a cleavage region, and a primer adapter region in the 5' to 3' direction; wherein...

[0251] The bonding region includes connectors capable of being connected to the surface of the solid support;

[0252] The excision area includes the cutting site;

[0253] The primer adapter region is wholly or partially complementary to the adapter region sequence of the template complementary sequence contained in the DNB (i.e., the complementary sequence of the template sequence adapter region), and has a 3' free end, so that the probe primer can be used as a primer to initiate an extension reaction; preferably, the primer adapter region contains the sequence of the adapter region of the template sequence or a fragment thereof.

[0254] (5) Connect the probe primer to the surface of the solid support; wherein steps (4) and (5) are performed in any order;

[0255] (6) Cut the cutting sites contained in the connector region to digest the DNB, so that the extension product in step (4) is separated from the template DNB that forms the extension product, thereby attaching the capture probe to the surface of the solid support (e.g., chip).

[0256] Preferably, the circular nucleic acid template, DNB, and capture probe are DNA;

[0257] Preferably, in step (1), a variety of circular nucleic acid templates are provided, each containing a different template sequence of a capture probe, thereby obtaining a solid-phase carrier (e.g., a chip) with a variety of capture probes attached to its surface.

[0258] Project 2. The method of Project 1, wherein the cleavage site contained in the adapter region is a cleavage site of a nicking enzyme;

[0259] Preferably, the nicking enzyme is selected from USER, BamHI, and BmtI.

[0260] Project 3. The method of Project 1 or 2, wherein the adapter region further comprises a sequencing primer hybridization region and / or an amplification primer hybridization region; wherein the sequencing primer hybridization region allows the sequencing primer to anneal and initiate the sequencing reaction, and the amplification primer hybridization region allows the amplification primer to anneal and initiate the extension and amplification reaction.

[0261] Project 4. The method of any one of Projects 1-3, wherein the oligonucleotide sequence capable of capturing mRNA includes a sequence capable of hybridizing with the poly-A tail of mRNA;

[0262] Preferably, the oligonucleotide sequence capable of capturing mRNA includes a poly-T oligonucleotide sequence;

[0263] Preferably, the poly-T oligonucleotide sequence comprises at least 10 (e.g., at least 20) deoxythymidine residues.

[0264] Project 5. The method of any one of Projects 1-4, wherein the template sequence further comprises a probe tag region located upstream of the capture region and downstream of the adapter region, the probe tag region comprising a probe tag complementary sequence composed of modified bases, the modified bases being capable of forming hydrogen bond complementary pairing with a variety of major bases (e.g., C, G, A, T, U);

[0265] Preferably, the probe tag area is located between the space tag area and the capture area, or between the connector area and the space tag area;

[0266] Preferably, the complementary sequence of the probe tag contains multiple (e.g., at least 10) inosines.

[0267] Item 6. The method of any one of Items 1-5 has one or more of the following characteristics:

[0268] (i) The length of the connector region is greater than 1 bp, for example, greater than 10 bp, or greater than 20 bp; preferably, the length of the connector region is 20-100 bp;

[0269] (ii) The length of the spatial tag region is greater than 1 bp, for example, greater than 10 bp; preferably, the length of the spatial tag region is 10-100 bp;

[0270] (iii) The length of the capture region is greater than 1 bp; preferably, the length of the capture region is 1-100 bp;

[0271] (iv) The length of the probe tag region is greater than 1 bp, for example, greater than 5 bp; preferably, the length of the probe tag region is 5-100 bp.

[0272] Project 7. The method of any one of Projects 1-6, wherein the solid-phase carrier is a chip;

[0273] Preferably, the solid support can be used as a sequencing platform, such as a sequencing chip.

[0274] Project 8. The method of any one of Projects 1-7, wherein, in step (4), while performing primer extension reaction, the complementary sequence of the spatial tag sequence is sequenced to obtain the sequence information of the spatial tag sequence contained in the corresponding capture probe.

[0275] Project 9. The method of any one of Projects 1-7, wherein, prior to step (4), it further includes a step of sequencing the complementary sequence of the spatial tag sequence contained in the DNB;

[0276] Preferably, after sequencing is completed, the dNTPs added to the synthetic strand during sequencing are removed by washing.

[0277] Item 10. The method of any one of Items 1-9, wherein the linker is a linker group capable of coupling with an activating group (e.g., NH2), and the surface of the solid support is modified with an activating group (e.g., NH2);

[0278] Preferably, the connector includes -SH, -DBCO, or -NHS;

[0279]

[0280] Item 11. The method of any one of items 1-10, wherein the cutting site included in the excision region is a site that can be controlled to be cut by chemical, enzymatic or photochemical methods;

[0281] Preferably, the cleavage site is an enzyme cleavage site;

[0282] Preferably, the cutting site contained in the excision area is different from that contained in the joint area.

[0283] Item 12. The method of any one of Items 1-11, wherein the amplification includes PCR.

[0284] Project 13. Nucleic acid arrays prepared by any one of the methods in Projects 1-12.

[0285] Project 14. A nucleic acid array for detecting spatial information of biomolecules (e.g., nucleic acids) in a sample, comprising a solid-phase carrier (e.g., a chip) with a variety of capture probes attached to its surface, each capture probe occupying a different position in the array and oriented with a 3' free end so that the capture probe can serve as an extension primer, wherein each capture probe includes, from 5' to 3', a binding region, a cleavage region, a spatial tag sequence, and a capture sequence, wherein,

[0286] The bonding region includes connectors capable of being connected to the surface of the solid support;

[0287] The excision area includes the cutting site;

[0288] The spatial tag sequence corresponds to the position of the capture probe on the array;

[0289] The capture sequence is capable of hybridizing with all or part of the biomolecule to be captured (e.g., nucleic acid), and includes: (1a) an oligonucleotide sequence capable of capturing mRNA; and / or, (1b) a random or degenerate oligonucleotide sequence; or, (c) a specific sequence for a particular target molecule (e.g., target nucleic acid).

[0290] Project 15. The nucleic acid array of Project 14, wherein each capture probe (i.e., capture probes containing the same spatial tag sequence) has a probe tag sequence that is different from each other, the probe tag sequence being located upstream of the capture sequence and downstream of the cleavage region;

[0291] Preferably, the probe tag sequence is located between the capture sequence and the spatial tag sequence, or between the cutting region and the spatial tag sequence.

[0292] Item 16. Nucleic acid arrays of Item 14 or 15, wherein the diameter of the area (i.e., active region) occupied by each capture probe (i.e., capture probes containing the same spatial tag sequence) on the surface of the solid support is less than 1 micrometer.

[0293] Preferably, the diameter of the active region of each capture probe is about 500 nanometers.

[0294] Project 17. A nucleic acid array of any one of Projects 14-16, wherein the solid-phase support is a chip;

[0295] Preferably, the solid support can be used as a sequencing platform, such as a sequencing chip.

[0296] Item 18. A nucleic acid array of any one of Items 14-17, wherein the nucleic acid array is prepared by any one of Items 1-12.

[0297] Project 19. A method for detecting spatial information of biomolecules in a sample, comprising the following steps:

[0298] (1) Provide a nucleic acid array of any one of items 13-18, or obtain a nucleic acid array by any one of items 1-12; the nucleic acid array includes a variety of capture probes attached to the surface of a solid support (e.g., a chip), each capture probe occupying a different position in the array, and the capture probe includes a spatial tag sequence corresponding to the position of the capture probe on the array and a capture sequence capable of capturing biomolecules in a sample.

[0299] (2) The nucleic acid array is brought into contact with the sample to be tested so that the capture sequence of the capture probe binds to the biomolecule in the sample to be tested, thereby making the position of the biomolecule correspond to the position of the capture probe on the nucleic acid array and generating a spatially labeled biomolecule.

[0300] (3) Release spatially tagged biomolecules from the array surface; and

[0301] (4) Analyze the sequences of the biomolecules released in step (3) directly or indirectly.

[0302] Project 20. A method for detecting the spatial information of nucleic acids in a sample, comprising the following steps:

[0303] (1) Provide a nucleic acid array as described in any one of items 13-18, or obtain a nucleic acid array by any one of items 1-12; the nucleic acid array includes a variety of capture probes attached to the surface of a solid support (e.g., a chip), each capture probe occupying a different position in the array, and the capture probe includes a spatial tag sequence corresponding to the position of the capture probe on the array and a capture sequence capable of capturing nucleic acids in a sample;

[0304] (2) The nucleic acid array is brought into contact with the sample to be tested under annealing conditions so that the nucleic acid in the sample to be tested anneals with the capture sequence of the capture probe, thereby making the position of the nucleic acid correspond to the position of the capture probe on the nucleic acid array.

[0305] (3) Under the condition that primer extension is allowed, the capture probe is used as a primer and the captured nucleic acid molecule is used as a template to perform a primer extension reaction. The resulting extension product contains a spatial tag sequence and a complementary sequence of the captured nucleic acid molecule, thereby generating a spatial tag-tagged DNA molecule; optionally, the complementary strand of the spatial tag-tagged DNA molecule is generated, and / or optionally, the spatial tag-tagged DNA molecule is amplified.

[0306] (4) Releasing at least a portion of space-tagged DNA molecules and / or their complementary strands or amplicon from the array surface, wherein said portion includes the space-tagged sequence or its complementary strand; and

[0307] (5) Analyze the sequence of the nucleic acid molecules released in step (4) directly or indirectly;

[0308] Preferably, the spatial information of the nucleic acid includes the location, distribution, and / or expression of the nucleic acid;

[0309] Preferably, the capture probe is a DNA molecule;

[0310] Preferably, the sample is a tissue sample, such as a tissue section;

[0311] Preferably, the tissue sections are prepared from fixed tissues, such as formalin-fixed paraffin-embedded (FFPE) tissues or deep-frozen tissues.

[0312] Item 21. The method of Item 20, in step (5), the sequence analysis includes sequencing or a sequence-specific PCR reaction.

[0313] Item 22. The method of Item 20 or 21, the method further comprising step (6): associating the sequence analysis information obtained in step (5) with an image of the sample, wherein the sample was imaged before or after step (3).

[0314] Item 23. The method of any one of Items 20-22, said method for detecting the transcriptome in a sample, wherein:

[0315] In step (3), the capture probe is used as an RT primer to synthesize a cDNA molecule from the captured RNA molecule. The cDNA molecule has a spatial tag, and optionally, the cDNA molecule is amplified.

[0316] In step (4), at least a portion of the cDNA molecule and / or its amplicon is released from the array surface, wherein the released nucleic acid molecule may be the first and / or second strand of the cDNA molecule or its amplicon, and wherein the portion contains a spatial tag sequence or its complementary strand;

[0317] Preferably, in step (1), the capture sequence comprises an oligonucleotide sequence capable of capturing mRNA.

[0318] Item 24. The method of any one of items 20-23, wherein the complementary strand or the second strand of the cDNA is generated before or after the spatially tagged DNA molecule or the spatially tagged cDNA molecule is released from the array surface;

[0319] Preferably, the synthesis of the complementary strand or the second strand uses random primers and a strand displacement polymerase.

[0320] Item 25. The method of any one of items 20-24, wherein, prior to sequence analysis, it further comprises the step of amplifying the spatially tagged DNA molecule or cDNA molecule;

[0321] Preferably, the amplification step is performed after the space-tagged DNA or cDNA molecules are released from the array, or the amplification step is performed in situ on the array.

[0322] Preferably, the amplification step includes PCR.

[0323] Item 26. The method of any one of items 20-25, wherein the step of purifying the released molecule (e.g., a nucleic acid molecule) is further included prior to sequence analysis.

[0324] Item 27. The method of any one of items 20-26, prior to step (4), the method further includes a step of washing the array to remove residual sample (e.g., tissue).

[0325] Item 28. The method of any one of Items 20-27, wherein in step (4), the molecule is released from the array surface by: (i) nucleic acid cleavage; (ii) denaturation; and / or (iii) physical methods;

[0326] Preferably, the molecule is released from the excision region of the capture probe by enzymatic cleavage.

[0327] Item 29. The method of any one of Items 20-28, wherein in step (6), the image of the sample is formed using a light, bright field, dark field, phase difference, fluorescence, mirror, interference or confocal microscope or a combination thereof.

[0328] Beneficial effects

[0329] This invention provides a novel array for detecting nucleic acid spatial information and its preparation method. When applied to nucleic acid spatial information detection, this nucleic acid array can simultaneously achieve high-precision subcellular localization and high-throughput tissue localization. The array and detection method based on this array have significant application value in cell localization, subcellular localization, organelle localization, cell interactions, organelle interactions, molecular pathway research, and disease diagnosis. Attached Figure Description

[0330] Figure 1 A schematic diagram of the structure for cDNA synthesis after capturing mRNA in Example 2 is shown.

[0331] Figure 2 A schematic diagram of the structure of the molecules released from the chip in Example 2 is shown.

[0332] Figure 3 The results of cDNA fragment distribution detection in Example 2 are shown.

[0333] Figure 4 The matching results of the 25bp single-strand sequence obtained by cDNA sequencing in Example 3 and the fq of the localization sequence on the capture chip are shown.

[0334] Figure 5 The graph shows the expression of mRNA in tissue sections from Example 3.

[0335] Figure 6 A schematic diagram of the probe primers and the vector sequence structure contained in the DNB is shown in an exemplary embodiment of Example 4.

[0336] Figure 7 A schematic diagram of the probe structure connected to the chip in Example 4 is shown.

[0337] Figure 8 This shows a schematic diagram of the structure of the captured nucleic acid molecule after cDNA synthesis in Example 5.

[0338] Figure 9 A schematic diagram of the structure of the molecules released from the chip in Example 5 is shown.

[0339] Figure 10 The results of cDNA fragment distribution detection in Example 5 are shown.

[0340] Figure 11 The matching results of the 20bp single-strand sequence obtained by cDNA sequencing in Example 6 and the fq of the localization sequence on the capture chip are shown.

[0341] Figure 12 The graph shows the expression of mRNA in tissue sections from Example 6. Detailed Implementation

[0342] The invention will now be described with reference to the following embodiments, which are intended to illustrate the invention (and not limit it).

[0343] Unless otherwise specified, the experiments and methods described in the examples are generally performed according to conventional methods well known in the art and described in various references. Furthermore, where specific conditions are not specified in the examples, conventional conditions or conditions recommended by the manufacturer are followed. Reagents or instruments whose manufacturers are not specified are all commercially available conventional products. Those skilled in the art will understand that the examples describe the invention by way of illustration and are not intended to limit the scope of protection claimed by the invention. All disclosures and other references mentioned herein are incorporated herein by reference in their entirety.

[0344] Example 1. Fabrication of the capture chip - 1

[0345] 1. Design and synthesize the following DNA library sequences. The sequence synthesis was commissioned to BGI Genomics.

[0346] 5' Phosphorylation -AAGTCGGAGGCCAAGCGGTCTTAGGAAGACAA (Linker A, SEQ ID NO:1)NNNNNNNNNNNNNNNNNNNNNNNNNN (Location sequence complement, N represents any base, such as C, G, A or T)CTGATAAGGTCGCCA (Second fixed sequence complement, SEQ ID NO:2)CAACTCCTTGGCTCACAGAACGACATGGCTACGATCCGACTT (Linker B, SEQ ID NO:3)-3'. Linker A contains a portion of the first fixed sequence complement and a circularization site, while linker B contains another portion of the first fixed sequence complement, a cleavage site, and a circularization site.

[0347] 2. In situ amplification of the library

[0348] DNA nanospheres (DNB) preparation: 40 μL of the reaction system was prepared and 80 fmol of the above DNA library was added. The DNB primer sequence was GGCCTCCGACTTAAGTCGGATCGT (SEQ ID NO:4), which was synthesized by BGI Genomics.

[0349] Element Volume (ul) Final concentration DNA library sequence 80 fmol(X) 10×phi29 buffer (BGI in-house manufactured) 4 1X DNB primer sequence 10uM 4 1uM Molecular water 32-x

[0350] The above reaction volume was placed in a PCR instrument for reaction under the following conditions: 95℃ for 3 min, 40℃ for 3 min. After the reaction, the mixture was placed on ice, and 40 μL of mixed enzyme I, 2 μL of mixed enzyme II, 1 μL of ATP (100 mM stock solution, Thermo Fisher), and 0.1 μL of T4 ligase (BGI's own product) were added to the DNB sequencing kit. After mixing, the reaction system was placed in a PCR instrument at 30℃ for 20 min to form DNB. The DNB was then loaded onto a BGISEQ500 sequencing chip according to the method described in the BGISEQ500 SE50 kit.

[0351] 3. Sequencing and decoding of the localized sequence: Decode and sequence the localized sequence according to the BGISEQ500 SE50 sequencing kit instructions, setting the sequencing length to 25 bp. Store the generated fq file for later use.

[0352] 4. Capture Sequence Fixation: The following DNA sequence was synthesized by BGI Genomics: 5' phosphorylated -CTGATAAGGTCGCCA (complementary sequence to the second fixation sequence, SEQ ID NO: 5)NNNNNNNNNN(UMI)TTTTTTTTTTTTTTTTTTTVN (capture sequence, SEQ ID NO: 6)-3', where N represents any base (e.g., C, G, A, or T). Remove the sequencing chip from the sequencer and pump the excision reagent from well 7 of the BGISEQ500 SE50 kit into the chip (ensuring the reagent covers the entire chip without air bubbles). Incubate the chip at 60°C for 10 min. After the reaction, pump an appropriate amount of 5×SSC (purchased from Shanghai Sangon Biotech) into the sequencing chip to fully replace the previous reagent. Dilute the capture sequence to 1 μM with 5×SSC, and add an appropriate amount of the diluted capture sequence to the chip to fill it completely. Incubate the chip at room temperature for approximately 30 min to allow the capture sequence to fully hybridize to the DNA.

[0353] 5. Chip cutting: Cut the prepared chip into several small pieces. The size of the pieces can be adjusted according to the experimental needs. Soak the chip in 50mM pH8.0 Tris buffer and prepare at 4℃ for later use.

[0354] Example 2. Tissue mRNA capture and cDNA synthesis

[0355] 1. Frozen tissue sections. Prepare mouse cerebellar tissue sections according to the standard frozen section procedure.

[0356] 2. mRNA capture. Based on the size of the tissue section, take an appropriate size of the chip prepared in Example 1 and place it at room temperature until the liquid on the chip evaporates. Then, using the temperature difference between the tissue section and the chip, attach the tissue section to the capture chip in a microtome. Place the attached tissue section at room temperature, add 5×SSC reaction solution to the chip (fully covering the area where the tissue is attached), and react at 30°C for 30 minutes to allow the mRNA in the tissue to fully hybridize with the capture area on the chip.

[0357] 3. cDNA Synthesis. The chip was washed twice with 5×SSC at room temperature. A 200 μL reverse transcriptase reaction mixture was prepared and added to the chip, ensuring complete coverage. The reaction was incubated at 42°C for 90-180 min. The mRNA was used as a polyT primer for cDNA synthesis. The 3' end of the mRNA was tagged with a TSO tag (AAGTCGGAGGCCAAGCGGTC / rG / / rG / / iXNA_G / ) (SEQ ID NO:7) for the synthesis of the cDNA complementary strand. A schematic diagram of the above process is shown below. Figure 1 As shown.

[0358]

[0359] 4. Ligation of the spatial localization region and the capture region. After cDNA synthesis, wash the chip twice with 5×SSC. Prepare a 1ml reaction mixture as follows, and pump an appropriate volume into the chip to ensure it is filled with the ligation reaction solution. Figure 1 Complete the nick symbol as shown. React at room temperature for 30 minutes. After the reaction, clean the chip using 5×SSC at 55°C, 3 times, 5 minutes each time.

[0360] Element Volume (ul) concentration 10× T4 ligase buffer (BGI in-house manufactured) 100 1× T4 ligase (600U / ul, BGI's own product) 100 60u / ul Glycerin (Aladdin) 10 10％ Molecular water 790

[0361] 5. cDNA Release. After the cDNA first strand is synthesized on the chip, an appropriate amount of formamide solution is added to the chip, and the reaction is carried out at 55°C for 10 min to release the cDNA strand from the chip. The released molecule has the following properties: Figure 2 The structure is shown. The reaction solution released from the chip was collected, and the first strand of cDNA was purified using 2×XP magnetic beads. The product was then recovered using 45 μL TE buffer (Thermofisher). The single-stranded cDNA was quantified using the qubit ssDNA detection kit.

[0362] 6. cDNA amplification. Prepare a 100 μL reaction mixture as follows:

[0363]

[0364] The above reaction system was placed in a PCR instrument, and the following reaction program was set: 95℃ for 3 min, 11 cycles (98℃ for 20 s, 58℃ for 20 s, 72℃ for 3 min), 72℃ for 5 min, 4℃ to infinity. After the reaction, the DNA was purified and recovered using XP beads. The dsDNA concentration was quantified using a qubit kit, and the cDNA fragment distribution was detected using a 2100 nm detector. The 2100 nm detection results are shown below. Figure 3 As shown, the cDNA length is normal.

[0365] Example 3. cDNA library construction and sequencing

[0366] 1. Tn5 fragmentation. Based on the cDNA concentration, take 20 ng of cDNA, add 0.5 uM Tn5 fragmentation enzyme and the corresponding buffer (the Tn5 fragmentation enzyme coating method is performed according to the stLFR library construction kit), mix well to prepare a 20 μL reaction system, react at 55℃ for 10 min, then add 5 μL of 0.1% SDS, mix well, and let stand at room temperature for 5 min to complete the Tn5 fragmentation step.

[0367] 2. PCR amplification. Prepare the following reaction mixture in 100 μL:

[0368]

[0369] After mixing, the mixture was placed in a PCR instrument and programmed as follows: 95℃ for 3 min, 11 cycles (98℃ for 20 s, 58℃ for 20 s, 72℃ for 3 min), 72℃ for 5 min, 4℃ at infinity. After the reaction, the DNA was purified and recovered using XP beads. The dsDNA concentration was quantified using the qubit kit.

[0370] 3. Sequencing. Take 80 fmol of the fragmented amplification product and prepare DNB. Prepare a 40 μL reaction system as follows:

[0371]

[0372] The above reaction volume was placed in a PCR instrument for reaction under the following conditions: 95℃ for 3 min, 40℃ for 3 min. After the reaction, the mixture was placed on ice, and 40 μL of mixed enzyme I, 2 μL of mixed enzyme II, 1 μL of ATP (100 mM stock solution, Thermo Fisher), and 0.1 μL of T4 ligase (BGI self-produced) were added to the DNB preparation kit. After mixing, the reaction system was placed in the PCR instrument at 30℃ for 20 min to form DNB. The DNB was then loaded onto the MGISEQ2000 sequencing chip according to the method described in the PE50 kit on the MGISEQ2000, and sequencing was performed according to the relevant instructions. The PE50 sequencing model was selected, in which the first strand was divided into two 25 bp segments, followed by 15 cycles of dark reaction, and then a 10 bp UMI sequence was sequenced. The second strand was set to 50 bp.

[0373] Data Analysis

[0374] 1. The 25bp single-stranded sequence obtained from cDNA sequencing is matched with the fq of the localization sequence on the capture chip (the sequencing result obtained in step 3 of Example 1). The matching results are as follows: Figure 4 As shown, the bright area represents the 25bp region of cDNA sequencing that perfectly matches the capture chip; this region represents the area on the capture chip used for tissue capture. This illustrates that the capture chip can use spatial positioning regions to precisely locate the tissue capture area.

[0375] 2. Further analysis was performed on the DNBs whose cDNA sequencing matched the capture chip. The two-strand sequencing results of these DNB reads (reflecting mRNA expression in tissues) were compared with the mouse genome. The mouse mRNA information from the DNBs that aligned with the mouse genome was then mapped onto the capture chip using 25bp sequencing results. Figure 5 As shown, the left side displays the overall expression profile of mRNA in the analyzed tissue section, demonstrating that this capture chip can analyze the differential expression of mRNA in the tissue. The right side of the image shows the expression level of a gene expressed in a randomly selected mouse cerebellum, indicating that this chip can analyze the differential expression of a gene in a tissue sample throughout the entire tissue.

[0376] Example 4. Fabrication of the capture chip - 2

[0377] 1. Design and synthesize the following DNA library sequences. The sequence synthesis was commissioned to BGI Genomics.

[0378] 5' Phosphorylation -GAACGACATGGCTTTTTCCCGTAGCCATGTCGTTCTGCGCCTTC CCGATG (Fixed sequence 1, SEQ ID NO: 12) NNNNNNNNNNNNNNNNNNNN (Location sequence template sequence, N represents any base, such as C, G, A or T) IIIIIIIIII (UMI template sequence, I is Inosine) TTTTTTTTTTTTTTTTTTTTTT (Capture sequence, SEQ ID NO: 13) CCTCAG C (Clearing site, SEQ ID NO: 14) CCTTGGCTCACA (Fixed sequence 2, SEQ ID NO: 15). Wherein, fixed sequence 1 contains a portion of the complementary sequence of the first fixed sequence and a circularization site, and fixed sequence 2 contains a portion of the complementary sequence of the first fixed sequence and a circularization site.

[0379] 2. In situ amplification of the library

[0380] DNA nanospheres (DNB) preparation: 40 μL of the reaction system was prepared and 80 fmol of the above DNA library was added. The primer sequence for DNB is GACATGGCTACGTGTGAGCCAAGG (SEQ ID NO:16), which was synthesized by BGI Genomics.

[0381] Element Volume (ul) Final concentration DNA library sequence 80 fmol (×) 10×phi29 buffer (BGI in-house manufactured) 4 1× DNB primer sequence 10uM 4 1uM Molecular water 32-x

[0382] The above reaction volume was placed in a PCR instrument for reaction under the following conditions: 95℃ for 3 min, 40℃ for 3 min. After the reaction, the mixture was placed on ice, and 40 μL of mixed enzyme I, 2 μL of mixed enzyme II, 1 μL of ATP (100 mM stock solution, Thermo Fisher), and 0.1 μL of T4 ligase (BGI's own product) were added to the DNB sequencing kit. After mixing, the reaction system was placed in a PCR instrument at 30℃ for 20 min to form DNB. The DNB was then loaded onto a BGISEQ500 sequencing chip according to the method described in the BGISEQ500 SE50 kit.

[0383] 3. Spatial Information Decoding

[0384] (1) Chip surface modification:

[0385] Surface-mount the BGISEQ-500 platform chip described above 8-NHS ester, with the following structure:

[0386]

[0387] The chip surface was modified according to the following method: NHS-PEG8-Azido (564.58 g / mol) concentration was 45 μM, prepared in 100 ml solution as follows:

[0388] reagents Dosage unit NHS-PEG8-Azido 2.54 mg 1×PBS (pH 7.4) 100 ml

[0389] Store at -20℃ and avoid repeated freeze-thaw cycles.

[0390] DBCO-primer concentration was 1 μM, diluted with PBS.

[0391] (2) Primer-probe coupling:

[0392] BGI Genomics has custom-synthesized the following primer and probe sequences:

[0393] DBCO (linker group)-UUU (USER restriction site)TTTTTCCCGTAGCCATGTCGTTCTGCGCCTTCCCGATG (SEQ ID NO:17, this sequence contains the first fixed sequence complementary sequence, PCR amplification site sequence, and intermediate sequence). Dilute 1 μM of the above primer and probe sequence with PBS and pass it onto an Azido-modified chip, reacting at room temperature for 1 h or overnight.

[0394] (3) Spatial information decoding. Following the instructions of the BGISEQ500 SE50 sequencing kit, the spatial information sequence was decoded and sequenced, with a sequencing length of 30 bp (the first 20 bp being the spatial information sequence and the last 10 bp being the probe tag sequence). The resulting fq file was stored for later use.

[0395] (4) Capture zone synthesis:

[0396] Prepare a mixture of dTTP and Hifi polymerase, using DNB as a template, a probe sequence containing a spatial localization region as a primer, and dTTP as a substrate to extend the oligo dT sequence.

[0397] 4. Release of probes containing spatial information

[0398] Prepare 1 μM Spatial RNA BbvCI primers (diluted with 5×SSC). The primer sequence CCTCAGCCAACTCCT (SEQ ID NO:18) was synthesized by BGI Genomics. Hybridize at room temperature for 30 min. Prepare the BbvCI excision system (1.5 ml): 15 μL RE + 150 μL 10×CS Buffer + 1335 μL ddH2O. Pass this solution into the chip after decoding the spatial localization region and incubate at 37°C for 1 h or overnight. Wash twice with WB2 from the sequencing kit (BGI Genomics), then incubate with formamide at 55°C for 15 min. Finally, wash twice with WB2. The resulting probe schematic diagram is shown below. Figure 7 As shown, the probe sequence is as follows:

[0399] UUU (Excision region) TTTTTCCCGTAGCCATGTCGTTCTGCGCCTTCCCGATG (First fixed sequence complementary sequence, SEQ ID NO:19) NNNNNNNNNNNNNNNNNNNN (Location sequence complementary sequence, which is the same as the location sequence template sequence in the DNA library sequence in step one) NNNNNNNNNN (UMI sequence, which is the complementary sequence of the random base sequence obtained using the UMI template sequence in step one as a template) TTTTTTTTTTTTTTTTTTTTTT (Capture sequence, SEQ ID NO:20).

[0400] 5. Chip dicing

[0401] The prepared capture chip was cut into several small pieces, and the size of the pieces was adjusted according to the experimental needs. The chip was then immersed in 50mM pH8.0 Tris buffer and kept at 4℃ for later use.

[0402] Example 5. Tissue mRNA capture and cDNA synthesis

[0403] 1. Frozen tissue sections. Prepare mouse cerebellar tissue sections according to the standard frozen section procedure.

[0404] 2. mRNA Capture. Based on the size of the tissue section, take an appropriate size of the chip prepared in Example 4 and place it at room temperature until the liquid on the chip evaporates. Then, using the temperature difference between the tissue section and the chip, attach the tissue section to the capture chip in a microtome. Place the attached tissue section at room temperature, add 5×SSC reaction solution to the chip (fully covering the area where the tissue is attached), and react at 30°C for 30 minutes to allow the mRNA in the tissue to fully hybridize with the capture area on the chip.

[0405] 3. cDNA Synthesis. The chip was washed twice with 5×SSC at room temperature. A 200 μL reverse transcriptase reaction mixture was prepared and added to the chip, ensuring complete coverage. The reaction was incubated at 42°C for 90-180 min. The mRNA was used as a polyT primer for cDNA synthesis. The 3' end of the mRNA was tagged with a TSO tag (CGTAGCCATGTCGTTCTGCG / rG / / rG / / iXNA_G / ) (SEQ ID NO:21) for the synthesis of the cDNA complementary strand. A schematic diagram of the above process is shown below. Figure 8 As shown.

[0406]

[0407] 4. cDNA Release. After the first-stranded cDNA is synthesized on the chip, the USER enzyme reaction system is prepared, and the reaction is carried out according to the USER enzyme's instructions. The released molecules have the following properties: Figure 9 The structure is shown. The reaction solution released from the chip was collected, and the first strand of cDNA was purified using 2×XP magnetic beads. Finally, the product was recovered using 45 μL TE buffer (Thermo Fisher).

[0408] 5. cDNA amplification. Prepare a 100 μL reaction mixture as follows:

[0409]

[0410] The above reaction system was placed in a PCR instrument, and the following reaction program was set: 95℃ for 3 min, 11 cycles (98℃ for 20 s, 58℃ for 20 s, 72℃ for 3 min), 72℃ for 5 min, 4℃ to infinity. After the reaction, the DNA was purified and recovered using XP beads. The dsDNA concentration was quantified using a qubit kit, and the cDNA fragment distribution was detected using a 2100 nm detector. The 2100 nm detection results are shown below. Figure 10 As shown, the cDNA length is normal.

[0411] Example 6. cDNA library construction and sequencing

[0412] 1. Tn5 fragmentation. Based on the cDNA concentration, take 20 ng of cDNA, add 0.5 uM Tn5 fragmentation enzyme and the corresponding buffer (the Tn5 fragmentation enzyme coating method is performed according to the stLFR library construction kit), mix well to prepare a 20 μL reaction system, react at 55℃ for 10 min, then add 5 μL of 0.1% SDS, mix well, and let stand at room temperature for 5 min to complete the Tn5 fragmentation step.

[0413] 2. PCR amplification. Prepare the following reaction mixture in 100 μL:

[0414]

[0415]

[0416] After mixing, the mixture was placed in a PCR instrument and programmed as follows: 95℃ for 3 min, 11 cycles (98℃ for 20 s, 58℃ for 20 s, 72℃ for 3 min), 72℃ for 5 min, 4℃ at infinity. After the reaction, the DNA was purified and recovered using XP beads. The dsDNA concentration was quantified using the qubit kit.

[0417] 3. Sequencing. Take 80 fmol of the fragmented amplification product and prepare DNB. Prepare a 40 μL reaction system as follows:

[0418]

[0419] The above reaction volume was placed in a PCR instrument for reaction under the following conditions: 95℃ for 3 min, 40℃ for 3 min. After the reaction, the mixture was placed on ice, and 40 μL of mixed enzyme I, 2 μL of mixed enzyme II, 1 μL of ATP (100 mM stock solution, Thermo Fisher), and 0.1 μL of T4 ligase (BGI self-produced) were added to the DNB preparation kit. After mixing, the reaction system was placed in the PCR instrument at 30℃ for 20 min to form DNB. The DNB was then loaded onto the MGISEQ2000 sequencing chip according to the method described in the PE50 kit on the MGISEQ2000, and sequencing was performed according to the relevant instructions. The customer sequencing mode was selected, in which the first strand was divided into two 20 bp segments for sequencing followed by 10 bp probe tag sequencing, and the second strand was set to 50 bp.

[0420] Data Analysis

[0421] 1. The 20bp single-stranded sequence obtained from cDNA sequencing is matched with the fq of the spatial information sequence on the chip (the sequencing result obtained in step 3 of Example 4). The matching result is as follows: Figure 11 As shown, the bright area represents the 20bp region of cDNA sequencing that perfectly matches the capture chip; this region represents the area on the capture chip used for tissue capture. This illustrates that the capture chip can use spatial positioning regions to precisely locate the tissue capture area.

[0422] 2. Further analysis was performed on the DNBs whose cDNA sequencing matched the capture chip. The two-strand sequencing results of these DNB reads (reflecting mRNA expression in tissues) were compared with the mouse genome. The mouse mRNA information from the DNBs that aligned with the mouse genome was then mapped onto the capture chip using 20bp sequencing results. Figure 12As shown, the left side displays the overall expression profile of mRNA in the analyzed tissue section, demonstrating that this capture chip can analyze the differential expression of mRNA in the tissue. The right side of the image shows the expression level of a gene expressed in a randomly selected mouse cerebellum, indicating that this chip can analyze the differential expression of a gene in a tissue sample throughout the entire tissue.

[0423] Although specific embodiments of the invention have been described in detail, those skilled in the art will understand that various modifications and variations can be made to the details based on all the published teachings, and all such changes are within the scope of protection of the invention. The entire scope of the invention is given by the appended claims and any equivalents thereof.

Claims

1. A method for analyzing the spatial information of nucleic acids in a biological sample, wherein: The method comprises: (1) providing a nucleic acid array, contacting a biological sample with the nucleic acid array, imaging the biological sample, and obtaining an image of the biological sample; (2) spatially labeling the nucleic acid in the biological sample to obtain nucleic acid molecules labeled with spatial information, wherein the nucleic acid molecules labeled with spatial information include a spatial position sequence (e.g., a positioning sequence or its complementary sequence) and a nucleic acid molecule sequence to be detected or its complementary sequence; the nucleic acid molecule sequence to be detected or its complementary sequence is derived from the biological sample, and the spatial position sequence corresponds to the position of the nucleic acid molecule to be detected in the nucleic acid array; (3) sequencing the nucleic acid molecule labeled with the spatial information to obtain sequencing data; the sequencing data includes sequence data of the nucleic acid molecule to be tested and spatial position sequence data; (4) analyzing the sequencing data obtained in step (3) to obtain sequence analysis information; (5) Associating the sequence analysis information obtained in step (4) with the image obtained in step (1) to obtain spatial information of nucleic acid molecules in the biological sample.

2. The method of claim 1, wherein: The nucleic acid molecule labeled with spatial information includes a first fixed sequence or a complementary sequence thereof, a positioning sequence or a complementary sequence thereof, a capture sequence or a complementary sequence thereof, and a nucleic acid molecule sequence to be detected or a complementary sequence thereof.

3. The method according to claim 1 or 2, wherein The imaging is to take pictures of the biological sample using light, bright field, dark field, phase difference, fluorescence, mirror image, interference or confocal microscope or a combination thereof.

4. The method according to any one of claims 1 to 3, wherein: In step (2), the nucleic acid array comprises a solid support (e.g., a chip), and a plurality of capture probes are fixed (e.g., connected) to the surface of the solid support, wherein the capture probes comprise: a positioning sequence and a capture sequence; Each capture probe contains multiple copies of capture probes, and each capture probe occupies a different position in the array. The positioning sequence has a unique nucleotide sequence corresponding to the position of the capture probe on the array, and the capture sequence can capture nucleic acid molecules in biological samples.

5. The method according to any one of claims 1 to 4, wherein The spatial information labeled nucleic acid molecule further includes a unique molecular identifier (UMI) sequence or a complementary sequence thereof, and / or a TSO sequence or a complementary sequence thereof (e.g., a TSO tag); Preferably, the UMI complementary sequence is a probe tag, which is complementary to the UMI sequence; Preferably, the UMI sequence is a nucleotide sequence consisting of at least 1 (e.g., at least 2, at least 3, at least 4, or at least 5; e.g., 5-100, 5-50, 5-20, e.g., 10) N, and each N is independently any one of A, C, G and T.

6. The method of claim 5, wherein: The sequence analysis information includes quantitative copy number information of the nucleic acid molecule to be tested, wherein the copy number quantification is to distinguish and quantify different UMI sequences carried by nucleic acid molecules marked with different spatial information.

7. The method according to any one of claims 1 to 6, wherein The method has one or more characteristics selected from the following: (1) The sample is a tissue sample; (2) The sample is a sample containing cells (e.g., a tissue sample containing cells); (3) The sample is a tissue section; (4) The sample is a formalin-fixed paraffin-embedded (FFPE) tissue sample, a deep-frozen tissue sample and / or a fresh tissue sample; (5) The method is used to distinguish specific cell types in different tissue regions at the same time; (6) The method is used to detect changes in specific cell types in different regions during the course of a disease (eg, a neurodegenerative disease; eg, Alzheimer's disease).

8. The method according to any one of claims 1 to 7, wherein The spatial information of the nucleic acid includes the location, distribution and / or expression of the nucleic acid.

9. The method according to any one of claims 1 to 8, wherein The nucleic acid molecule labeled with spatial information includes: a first fixed sequence, a positioning sequence, a second fixed sequence, a UMI sequence, a capture sequence, and a nucleic acid molecule sequence to be detected or its complementary sequence; wherein, The first fixed sequence allows a nucleotide sequence complementary thereto (e.g., a sequencing primer) to anneal and initiate an extension reaction; The positioning sequence has a unique nucleotide sequence corresponding to a position on the array; The UMI sequence is a unique molecular identifier sequence; preferably, the UMI sequence is a nucleotide sequence consisting of at least 1 (e.g., at least 2, at least 3, at least 4, or at least 5; e.g., 5-100, 5-50, 5-20, e.g., 10) N, and each N is independently any one of A, C, G and T.

10. The method according to any one of claims 2 to 9, wherein: The capture sequence includes: (a) an oligonucleotide sequence capable of capturing mRNA; and / or, (b) a random or degenerate oligonucleotide sequence; and / or, (c) a specific sequence for a specific target nucleic acid.

11. The method according to any one of claims 1 to 10, wherein Step (4) comprises: (4-1) comparing the sequencing data with a reference genome to obtain sequence information of the nucleic acid molecule to be tested compared with the reference genome, and a spatial position sequence associated with the nucleic acid molecule to be tested; (4-2) Based on the associated spatial position sequence, the sequence information of the nucleic acid molecule to be tested is restored to the position in the corresponding nucleic acid array.

12. The method of claim 11, wherein: Step (5) includes: associating the sequence information of the nucleic acid molecules to be tested at each position in the nucleic acid array with the image obtained in step (1) to obtain the spatial distribution and / or spatial expression of the nucleic acid molecules in the biological sample.

13. The method according to any one of claims 1 to 12, wherein: The diameter of the area occupied by the capture probes comprising the same positioning sequence on the surface of the solid support is less than 1 micron; Preferably, the area occupied by each carrier sequence (i.e., carrier sequences containing the same positioning sequence) or each capture probe (i.e., capture probes containing the same positioning sequence / positioning sequence complementary sequence) on the surface of the solid support (i.e., active area) is less than 1 micron in diameter.

Images