Detection method and detection kit for osteogenic differentiation potential of mesenchymal stem cells

Abstract

The invention provides a detection method and a detection kit for osteogenic differentiation potential of mesenchymal stem cells, and belongs to the technical field of stem cells. The mesenchymal stem cell osteogenic differentiation potential detection kit comprises a forward primer with a nucleotide sequence as shown in SEQ ID NO: 1 and a qPCR (quantitative polymerase chain reaction) detection primer of a Runx2 gene of a reverse primer with a nucleotide sequence as shown in SEQ ID NO: 2. According to the present invention, the relative expression quantity of mRNA of the Runx2 gene of the cultured mesenchymal stem cell is directly detected by using the qPCR method so as to accurately evaluate the osteogenic differentiation potential of the to-be-detected MSC, such that the rapid, accurate and quantitative detection of the osteogenic potential of the mesenchymal stem cell is provided, the good application value is provided, the operation steps can be substantially simplified, and the cell culture cost is reduced.

Description

Technical Field

[0001] The invention belongs to the technical field of stem cells, and in particular relates to a method and a detection kit for the osteogenic differentiation potential of mesenchymal stem cells. Background Art

[0002] Mesenchymal stem cells (MSCs) are adult stem cells with high self-renewal ability and multidirectional differentiation potential. Under specific conditions, they can be induced to differentiate into various tissues such as fat, bone and cartilage. In the induced culture of mesenchymal stem cells for osteogenic differentiation, the culture cycle is usually 14 to 28 days. Since the osteogenic differentiation culture of stem cells is usually carried out in vitro, the culture medium required for in vitro directional differentiation culture is much more expensive than traditional ordinary cell culture medium in view of the complexity of stem cell induced differentiation. Therefore, early evaluation of the osteogenic differentiation potential of mesenchymal stem cells is an important measure to reduce industrial production costs.

[0003] The current method for evaluating the osteogenic differentiation potential of mesenchymal stem cells is qualitative analysis through staining identification. This method is easily affected by different operators and different batches of dyes, resulting in huge differences in the conclusions. Summary of the invention

[0004] In view of this, the purpose of the present invention is to provide a method and a detection kit for the osteogenic differentiation potential of mesenchymal stem cells, which can realize rapid and quantitative detection of the osteogenic differentiation potential of mesenchymal stem cells, thereby greatly reducing the cost of industrial cultivation of stem cells.

[0005] The present invention provides a mesenchymal stem cell osteogenic differentiation potential detection kit, comprising qPCR detection primers for Runx2 gene;

[0006] The qPCR detection primers for the Runx2 gene include a forward primer whose nucleotide sequence is shown in SEQ ID NO: 1 and a reverse primer whose nucleotide sequence is shown in SEQ ID NO: 2.

[0007] Preferably, it also includes internal reference gene amplification primers and qPCR detection premix.

[0008] Preferably, the internal reference gene amplification primers include GAPDH gene amplification primers.

[0009] The GAPDH gene amplification primers include a forward primer with a nucleotide sequence as shown in SEQ ID NO:3 and a reverse primer with a nucleotide sequence as shown in SEQ ID NO:4.

[0010] The present invention provides a method for detecting the osteogenic differentiation potential of mesenchymal stem cells, comprising the following steps:

[0011] The mesenchymal stem cells were cultured for osteogenic differentiation. Total RNA of the differentiated cells was extracted at 7-14 days of culture and reverse transcribed to obtain cDNA of the differentiation group.

[0012] Total RNA was directly extracted from the same batch of mesenchymal stem cells as the differentiation group, and cDNA of the control group was obtained by reverse transcription;

[0013] The two groups of cDNAs are used as templates, and the kits described in any one of claims 1 to 4 are used to perform qPCR reactions respectively, and the relative expression of the Runx2 gene is calculated according to formula I, and the osteogenic differentiation potential of mesenchymal stem cells is determined:

[0014] When the relative expression of Runx2 gene is ≥2, it indicates that the osteogenic differentiation potential of mesenchymal stem cells is strong, and the relative expression of Runx2 gene is positively proportional to the osteogenic differentiation potential;

[0015] When the relative expression of the Runx2 gene is less than 2, the osteogenic differentiation potential of mesenchymal stem cells is weak; Formula I.

[0016] Preferably, the osteogenic differentiation culture medium comprises an osteogenic differentiation basal medium containing 8% to 12% by mass of osteogenic differentiation factor additives.

[0017] Preferably, the reaction system of the qPCR reaction is 10 μl, including 5 μl of 2×TsingKe*Master qPCR Mix-SYBR (+UDG), 0.5 μl of 10 μM forward primer, 0.5 μl of 10 μM reverse primer, and 4.0 μl of template.

[0018] Preferably, the reaction procedure of the qPCR reaction is 50°C for 2 min; 95°C for 2 min; 95°C for 15 sec, 55°C for 30 sec, 72°C for 30 sec, and 35 cycles; the single-point fluorescence detection temperature is 72°C.

[0019] Preferably, the mesenchymal stem cells include at least one of the following: amniotic mesenchymal stem cells, umbilical cord mesenchymal stem cells and chorionic mesenchymal stem cells.

[0020] Preferably, the mesenchymal stem cells include umbilical cord mesenchymal stem cells.

[0021] The present invention provides a mesenchymal stem cell osteogenic differentiation potential detection kit, comprising qPCR detection primers for Runx2 gene; the qPCR detection primers for Runx2 gene include a forward primer with a nucleotide sequence as shown in SEQ ID NO:1 and a reverse primer with a nucleotide sequence as shown in SEQ ID NO:2. The present invention can accurately reflect the osteogenic differentiation potential of cells by detecting the relative expression level of the Runx2 gene of mesenchymal stem cells after differentiation culture. The detection kit provided by the present invention has the characteristics of convenient, rapid and accurate detection, and can quantitatively determine the osteogenic differentiation potential of mesenchymal stem cells. BRIEF DESCRIPTION OF THE DRAWINGS

[0022] Figure 1 The results of the detection of osteogenic differentiation ability of SA1 mesenchymal stem cells using the staining identification method;

[0023] Figure 2 This is the result of detecting the osteogenic differentiation potential of PA1 mesenchymal stem cells using the staining identification method. DETAILED DESCRIPTION

[0024] The present invention provides a mesenchymal stem cell osteogenic differentiation potential detection kit, comprising qPCR detection primers for Runx2 gene; the qPCR detection primers for Runx2 gene include a forward primer with a nucleotide sequence as shown in SEQ ID NO:1 (CTCTACTATGGCACTTCGTCA) and a reverse primer with a nucleotide sequence as shown in SEQ ID NO:2 (CTTCCATCAGCGTCAACAC).

[0025] In the present invention, the qPCR detection primers of the Runx2 gene are designed with the Runx2 gene as the target gene. Compared with the Runx2 gene primers in other documents, the qPCR detection primers protected by the present invention have higher amplification efficiency. In the present invention, the detection kit preferably also includes an internal reference gene amplification primer and a qPCR detection premix. The internal reference gene amplification primer preferably includes a GAPDH gene amplification primer. The GAPDH gene amplification primer preferably includes a forward primer with a nucleotide sequence as shown in SEQ ID NO:3 and a reverse primer with a nucleotide sequence as shown in SEQ ID NO:4. The present invention does not specifically limit the source of the primers in the detection kit, and can be prepared by a gene synthesis method well known in the art. In the embodiment of the present invention, the primers are all commissioned to Beijing Qingke Biotechnology Co., Ltd. for synthesis. The qPCR detection premix is ​​preferably 2×TsingKe*Master qPCR Mix-SYBR (+UDG) purchased from Beijing Qingke Biotechnology Co., Ltd.

[0026] The present invention provides a method for detecting the osteogenic differentiation potential of mesenchymal stem cells, comprising the following steps:

[0027] The mesenchymal stem cells were cultured for osteogenic differentiation. Total RNA of the differentiated cells was extracted at 7-14 days of culture and reverse transcribed to obtain cDNA of the differentiation group.

[0028] Total RNA was directly extracted from the same batch of mesenchymal stem cells as the differentiation group, and cDNA of the control group was obtained by reverse transcription;

[0029] The two groups of cDNAs are used as templates, and the kits described in any one of claims 1 to 4 are used to perform qPCR reactions respectively, and the relative expression of the Runx2 gene is calculated according to formula I, and the osteogenic differentiation potential of mesenchymal stem cells is determined:

[0030] When the relative expression of Runx2 gene is ≥2, it indicates that the osteogenic differentiation potential of mesenchymal stem cells is strong, and the relative expression of Runx2 gene is positively proportional to the osteogenic differentiation potential;

[0031] When the relative expression of the Runx2 gene is less than 2, the osteogenic differentiation potential of mesenchymal stem cells is weak;

[0032]

[0033] The present invention carries out osteogenic differentiation culture on mesenchymal stem cells, extracts total RNA of differentiated cells during 7-14 days of culture, and obtains cDNA through reverse transcription.

[0034] In the present invention, the mesenchymal stem cells preferably include at least one of the following: amniotic mesenchymal stem cells, umbilical cord mesenchymal stem cells and chorionic mesenchymal stem cells. The osteogenic induction differentiation culture medium preferably includes an osteogenic differentiation basal medium containing 8% to 12% by weight of an osteogenic differentiation factor additive, and the mass percentage of the osteogenic differentiation factor additive is preferably 10%. The osteogenic differentiation factor additive and the osteogenic differentiation basal medium are purchased from Gibco, with the item number A1007201.

[0035] In the present invention, the temperature of the osteogenic induction differentiation culture is preferably 36-38°C, more preferably 37°C. The environment of the osteogenic induction differentiation culture is preferably 5% CO2. The osteogenic induction differentiation culture is preferably replaced with fresh culture medium every 3 days. During the osteogenic induction differentiation culture, the mesenchymal stem cells are inoculated when the confluence reaches 60% to 70%. The present invention does not impose any special restrictions on the method of extracting total RNA of differentiated cells, and the method for extracting total cell RNA known in the art can be used. The reverse transcription is preferably performed using a reverse transcription kit.

[0036] The present invention directly extracts total RNA from the same batch of mesenchymal stem cells and obtains cDNA of the control group by reverse transcription. The method of total RNA extraction and reverse transcription is the same as that of the differentiation group, which will not be described in detail here.

[0037] After obtaining cDNA, the present invention uses the cDNA as a template and adopts the kit to perform qPCR reaction, and judges the osteogenic differentiation potential of mesenchymal stem cells according to the relative expression level of Runx2 gene:

[0038] When the relative expression of Runx2 gene is greater than 2, it indicates that the osteogenic differentiation potential of mesenchymal stem cells is strong, and the higher the relative expression of Runx2 gene, the stronger its osteogenic differentiation potential;

[0039] When the relative expression of the Runx2 gene is less than 2, the osteogenic differentiation potential of mesenchymal stem cells is weak. In the present invention, the reaction system of the qPCR reaction is preferably 10 μl, specifically including 2×TsingKe*Master qPCR Mix-SYBR(+UDG)5μl, 10μM forward primer 0.5μl, 10μM reverse primer 0.5μl, and template 4.0μl. The reaction procedure of the qPCR reaction is preferably 50℃2min; 95℃2min; 95℃15sec, 55℃30sec, 72℃30sec, 35 cycles; single-point fluorescence detection temperature 72℃. The relative expression of the Runx2 gene is calculated according to Formula I.

[0040]

[0041] in, It represents the mean CT value obtained by Runx2 gene detection of mesenchymal stem cells without induced differentiation treatment; It indicates the mean CT value obtained by the internal reference gene detection of mesenchymal stem cells without induced differentiation treatment; It represents the mean CT value obtained by Runx2 gene detection in mesenchymal stem cells cultured after induced osteogenic differentiation; It indicates the CT mean value obtained by detecting the internal reference gene of mesenchymal stem cells cultured during osteogenic differentiation induction.

[0042] In the embodiment of the present invention, the osteogenic differentiation potential of amniotic mesenchymal stem cells, umbilical cord mesenchymal stem cells and chorionic mesenchymal stem cells was evaluated by the method provided by the present invention. The results showed that the osteogenic differentiation potential of MSCs from different sources (amniotic membrane, umbilical cord and chorionic membrane) was significantly different, among which the osteogenic differentiation potential of umbilical cord mesenchymal stem cells was stronger, followed by chorionic mesenchymal stem cells, and the worst was amniotic mesenchymal stem cells. In addition, the osteogenic differentiation potential of mesenchymal stem cells from the same source but different batches was different, and the osteogenic differentiation potential of mesenchymal stem cells from the same source and different generations was also different.

[0043] The conventional method for evaluating the osteogenic differentiation potential of mesenchymal stem cells is that after 14-28 days of osteogenic induction, the calcium ions in the mesenchymal stem cells will precipitate in the form of calcium salts to form normal calcium nodules, which appear dark red under a microscope after being stained with alizarin red, while undifferentiated cells have no obvious staining. The strength of the osteogenic differentiation potential is qualitatively analyzed by observing the number of dark red calcium nodules in each sample, and the staining identification results are greatly affected by dyes of different brands and batches. The present invention directly detects the expression of MSC osteogenic differentiation-related transcriptional genes in the early and middle stages of induced differentiation (after 7 days and 14 days) by fluorescent quantitative PCR (qPCR), which can quickly and quantitatively evaluate the osteogenic differentiation potential of MSC.

[0044] The following is a detailed description of a method and a detection kit for the osteogenic differentiation potential of mesenchymal stem cells provided by the present invention in conjunction with the examples, but they should not be construed as limiting the scope of protection of the present invention.

[0045] Example 1

[0046] A kit for detecting the osteogenic differentiation potential of mesenchymal stem cells, comprising the following components:

[0047] 1. Detection Primers

[0048] Runx2 was used as the target gene, and primers for qPCR detection were designed using primer design software. The designed primer sequences were as follows: F: 5'-CTCTACTATGGCACTTCGTCA-3' (SEQ ID NO: 1);

[0049] R: 5'-CTTCCATCAGCGTCAACAC-3' (SEQ ID NO: 2);

[0050] Internal reference gene amplification primers:

[0051] Internal reference GAPDH primers:

[0052] F: 5'-GCACCGTCAAGGCTGAGAAC-3' (SEQ ID NO: 3);

[0053] R: 5'-TGGTGAAGACCGCCAGTGGA-3' (SEQ ID NO: 4);

[0054] The above detection primers were commissioned to be synthesized by Beijing Qingke Biotechnology Co., Ltd.

[0055] 2.qPCR detection reagents

[0056] 2×TsingKe*Master qPCR Mix-SYBR(+UDG).

[0057] Example 2

[0058] A method for detecting osteogenic differentiation potential of mesenchymal stem cells

[0059] 1. Pre-culture of Mesenchymal Stem Cells

[0060] Prepare a 15 ml centrifuge tube, mark it, and take 3.0 × 10 5 10 mesenchymal stem cells were placed in a centrifuge tube, and complete culture medium was pipetted to 6 ml, and mixed by blowing 10 times; after counting, 2 ml cell suspension of mesenchymal stem cells was pipetted respectively with a pipette, and 1.0×10 5 Inoculate a certain number of cells into each identification well (including experimental wells and control wells); use a pipette to draw an appropriate amount of D-PBS washing solution into the wells around the identification wells to prevent the evaporation of the culture medium in the identification wells; shake the cells well and transfer them to a 37°C, 5% CO2 incubator.

[0061] 2. Osteogenic differentiation culture of mesenchymal stem cells

[0062] Prepare osteogenic differentiation medium (purchased from Gibco) in advance according to 90% osteogenic differentiation basal medium + 10% osteogenic differentiation factor additive, mix well, and store at 4°C.

[0063] When the confluence of the above-cultured mesenchymal cells reaches 60% to 70%, start osteogenic differentiation. Use a pipette to aspirate the supernatant in each experimental well into a waste bottle; use a pipette to aspirate 1 ml of differentiation induction medium and carefully transfer it to each experimental well; digest and collect the cells in the control well, extract total RNA and freeze for later use; transfer the cells to a 37°C, 5% CO2 incubator. Replace the differentiation induction medium with fresh medium every 3 days. Collect cell pellets on Day 7 and Day 14 of osteogenic differentiation.

[0064] 3. RNA Extraction from Differentiated Cells

[0065] Add 350μl lysis buffer RLA and 10μl proteinase K to the differentiated cells, vortex and centrifuge at 12,000rpm for 4min, and take the supernatant. Add the obtained supernatant to the genomic DNA removal column, centrifuge at 12,000rpm for 30sec, and retain the filtrate. Slowly add 70% ethanol of 1 times the volume of the supernatant to the above filtrate, mix and transfer to the RNase-Free adsorption column CR4 (the adsorption column is placed in the collection tube), centrifuge at 12,000rpm for 30sec, discard the waste liquid in the collection tube, and put the adsorption column back into the collection tube. Add 700μl deproteinization solution RW3 to the RNase-Free adsorption column CR4, centrifuge at 12,000rpm for 30sec, and discard the waste liquid. Add 500μl rinsing solution RW with ethanol to the RNase-Free adsorption column CR4, let stand at room temperature for 2min, centrifuge at 12,000rpm for 50sec, and discard the waste liquid. Add 500μl of rinsing solution RW with ethanol to the RNase-Free adsorption column CR4, let stand at room temperature for 2min, centrifuge at 12,000rpm for 50sec, and discard the waste liquid. Centrifuge at 12,000rpm (~13,400×g) for 2min, and discard the waste liquid. Let the RNase-Free adsorption column CR4 stand at room temperature for 2min. Transfer the RNase-Free adsorption column CR4 to a new RNase-Free centrifuge tube, add 180μl RNase-Free ddH2O to the middle part of the adsorption membrane, let stand at room temperature for 2min, centrifuge at 12,000rpm for 2min, and obtain RNA solution. Use a micro-spectrophotometer to measure the RNA concentration of the sample to be tested, and take 1μg RNA for subsequent detection.

[0066] 4. Reverse Transcription Reaction

[0067] According to the number of reaction tubes, 1 μl of gDNA remover, 1 μl of 10×gDNA remover Buffer, RNase-free water (replenished to 10 μl) and 1 μg RNA in the reverse transcription kit were gently mixed for a few seconds, and then centrifuged for a short time for use; incubated at 42°C for 2 min, then incubated at 60°C for 5 min, the mixture was quickly cooled on ice, and after a short centrifugation, 1 μl of dNTP Mix, Goldenstar TM Randomer 1μl, 5×Goldenstar TM Buffer 4μl, DTT 1μl, Goldenstar TMRT6 1μl, RNase-free water 2μl, mix gently for a few seconds, centrifuge instantly, and perform reverse transcription reaction according to the preset program. Dilute the reverse transcription product 4 times, and perform Runx2 and GAPDH genome treatment respectively. According to the number of reaction tubes, take 2×TsingKe*MasterqPCR Mix-SYBR(+UDG) 5μl, 10μM forward primer 0.5μl, 10μM reverse primer 0.5μl, and template 4.0μl, mix gently for a few seconds, remove bubbles and cover the tube, centrifuge instantly, and follow the program 50℃×2min; 95℃×2min; then 95℃×15sec→55℃×30sec→72℃×30sec, cycle 35 times; perform PCR amplification reaction, and single-point fluorescence detection at 72℃.

[0068] Substitute the CT values ​​of the GAPDH and Runx2 groups into the formula: The relative expression level of Runx2 mRNA was obtained.

[0069] When the relative expression of Runx2 gene is ≥2, it indicates that the osteogenic differentiation potential of mesenchymal stem cells is strong, and the relative expression of Runx2 gene is positively proportional to the osteogenic differentiation potential;

[0070] When the relative expression of Runx2 gene is less than 2, the osteogenic differentiation potential of mesenchymal stem cells is weak.

[0071] Example 3

[0072] Detection of osteogenic differentiation ability of mesenchymal stem cells from different sources

[0073] Mesenchymal stem cells from different production batches of DB1, DB2, DB3, DA1, and DD1 were induced to differentiate according to the method of Example 2. After 7 and 14 days, the cell pellets were collected and the relative expression levels of Runx2 mRNA were determined using GAPDH as an internal reference.

[0074] The test results are shown in Table 1.

[0075] Table 1 Detection results of relative expression of Runx2 gene

[0076]

[0077] Test results: From the data in Table 1 above, we can see that the osteogenic differentiation potential of MSCs from different sources (amnion, umbilical cord and chorion) is significantly different, among which umbilical cord MSCs have the strongest osteogenic differentiation potential, followed by chorion MSCs, and amnion MSCs are the worst. In addition, MSCs from the same source but different batches, such as three different batches of umbilical cord MSCs, also have different osteogenic differentiation abilities.

[0078] Example 4

[0079] Amniotic membrane mesenchymal stem cells with production batch numbers SA1 and PA1 were induced to differentiate according to the method of Example 3. After 7 and 14 days, the cell pellets were collected and the relative expression levels of Runx2 mRNA were determined using GAPDH as an internal reference.

[0080] The test results are shown in Table 2.

[0081] Table 2 Detection results of relative expression of Runx2 gene

[0082]

[0083] Experimental results: From the data in Table 2 above, it can be seen that the osteogenic differentiation potential of MSCs from the same source but different generations is also different. From the comparative data on day 14, it can be seen that the differentiation potential of SA1 is better than that of PA1 (because the relative expression level 460>254).

[0084] Comparative Example 1

[0085] The culture method of Example 4 was used to culture the amniotic mesenchymal stem cells with production batch numbers SA1 and PA1, and the cells were stained and identified after 21-28 days of induction and culture. The specific experimental operation is as follows: use a pipette to aspirate the supernatant in the identification well to a waste liquid bottle; use a pipette to aspirate 0.5 ml of 4% PFA to the identification well, fix for 20 minutes; use a pipette to aspirate the fixative in the identification well to a waste liquid bottle; use a pipette to aspirate 0.5 ml of ultrapure water to the identification well, wash once; use a pipette to aspirate 0.5 ml of alizarin red dye to the identification well, stain for 30 minutes; use a pipette to aspirate the dye in the identification well to a waste liquid bottle; use a pipette to aspirate 0.5 ml of ultrapure water to the identification well, observe under a microscope and take pictures.

[0086] Some of the results of the observations can be found in Figure 1 and Figure 2 The red calcium nodules observed in the SA1 group were larger and more obvious than those observed in the PA1 group, which was consistent with the results of Example 4.

[0087] Comparative Example 2

[0088] In order to compare the effects of different primers on the relative expression of Runx2, the Runx2 gene detection primers designed by the present invention (SEQ ID NO: 1 and SEQ ID NO: 2) and the Runx2 gene control primers (upstream primer: 5'-CAGACCAGCAGCACTCCATA, SEQ ID NO: 5; downstream primer: 5'-CAGCGTCAACACCATCATTC, SEQ ID NO: 6, reference: Zhang Xian, Cai Jianping, Zhang Yanhong, Tan Xiangling. Expression of osteogenic and adipogenic related transcription factors in osteogenic differentiation of rat mesenchymal stem cells induced by Eucommia ulmoides [J]. Chinese Journal of Tissue Engineering Research and Clinical Rehabilitation, 2010, 14 (19), 3523-3526.) were used to perform qPCR detection on the same batch of MSC samples (batch number: SA2) to analyze the effects of different primers on the relative expression of Runx2 gene. The primers designed by the present invention were used to detect the relative expression of Runx2 gene according to the reaction system and reaction procedure described in Example 1. Runx2 gene control primers were used to detect the relative expression of Runx2 gene according to the reaction procedure in Table 3.

[0089] Table 3 Control primer reaction program

[0090]

[0091] The results are shown in Table 4. From the results in Table 4, it can be seen that the primer pair designed by the present invention has a higher amplification efficiency for the relative expression level of the Runx2 gene.

[0092] Table 4 Relative expression of Runx2 gene detected by two sets of primers

[0093]

[0094] The above is only a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principle of the present invention. These improvements and modifications should also be regarded as the scope of protection of the present invention.

Claims

1. A kit for detecting osteogenic differentiation potential of mesenchymal stem cells, characterized in that: Includes qPCR detection primers for Runx2 gene; The qPCR detection primers for the Runx2 gene include a forward primer whose nucleotide sequence is shown in SEQ ID NO: 1 and a reverse primer whose nucleotide sequence is shown in SEQ ID NO:

2.

2. The mesenchymal stem cell osteogenic differentiation potential detection kit according to claim 1, characterized in that: It also includes internal reference gene amplification primers and qPCR detection premix.

3. The mesenchymal stem cell osteogenic differentiation potential detection kit according to claim 1, characterized in that: The internal reference gene amplification primers include GAPDH gene amplification primers.

4. The mesenchymal stem cell osteogenic differentiation potential detection kit according to claim 3, characterized in that: The GAPDH gene amplification primers include a forward primer with a nucleotide sequence as shown in SEQ ID NO:3 and a reverse primer with a nucleotide sequence as shown in SEQ ID NO:

4.

5. A method for detecting the osteogenic differentiation potential of mesenchymal stem cells, characterized in that: The following steps are involved: The mesenchymal stem cells were cultured for osteogenic differentiation. Total RNA of the differentiated cells was extracted at 7-14 days of culture and reverse transcribed to obtain cDNA of the differentiation group. Total RNA was directly extracted from the same batch of mesenchymal stem cells as the differentiation group, and cDNA of the control group was obtained by reverse transcription; The two groups of cDNAs are used as templates, and the kits described in any one of claims 1 to 4 are used to perform qPCR reactions respectively, and the relative expression level of the Runx2 gene is calculated according to formula I, and the osteogenic differentiation potential of mesenchymal stem cells is determined: When the relative expression of Runx2 gene is ≥2, it indicates that the osteogenic differentiation potential of mesenchymal stem cells is strong, and the relative expression of Runx2 gene is positively proportional to the osteogenic differentiation potential; When the relative expression of the Runx2 gene is less than 2, the osteogenic differentiation potential of mesenchymal stem cells is weak; mRNA relative expression = 2 - {( 分化组 Runx2CT 均值-分化组内参基因 CT 均值 )-( 对照组 Runx2CT 均值-对照组内参基因 CT 均值) Formula I.

6. The detection method according to claim 5, characterized in that: The culture medium for osteogenic induction differentiation culture comprises an osteogenic differentiation basal culture medium containing 8% to 12% by mass of osteogenic differentiation factor additives.

7. The detection method according to claim 5, characterized in that: The reaction system of the qPCR reaction is 10 μl, including 5 μl of 2×TsingKe*Master qPCR Mix-SYBR (+UDG), 0.5 μl of 10 μM forward primer, 0.5 μl of 10 μM reverse primer, and 4.0 μl of template.

8. The detection method according to claim 5, characterized in that: The reaction procedure of the qPCR reaction is 50°C for 2 min; 95°C for 2 min; 95°C for 15 sec, 55°C for 30 sec, 72°C for 30 sec, and 35 cycles; the single-point fluorescence detection temperature is 72°C.

9. The detection method according to any one of claims 5 to 8, characterized in that: The mesenchymal stem cells include at least one of the following: amniotic mesenchymal stem cells, umbilical cord mesenchymal stem cells and chorionic mesenchymal stem cells.

10. The detection method according to claim 9, characterized in that: The mesenchymal stem cells include umbilical cord mesenchymal stem cells.

Images