A primer and probe combination and kit for detecting urinary tract Klebsiella pneumoniae and drug resistance genes by nested PCR

Abstract

A primer and probe combination and a kit for nested PCR detection of urinary tract Klebsiella pneumoniae and drug-resistant genes. The primer and probe sequences designed by the invention do not cause cross-amplification of other urinary tract pathogens and can meet the specificity requirements. In addition, exogenous antibiotic interferors gentamicin, tobramycin, ceftazidime, levofloxacin, piperacillin, and nitrofurantoin have no effect on the experimental results, meeting the anti-interference requirements. The prepared kit can simultaneously detect urinary tract Klebsiella pneumoniae and drug-resistant genes, and the detection is convenient, simple, and reliable. Compared with common bacterial species identification, drug-resistant gene detection can more accurately guide clinical medication and avoid ineffective treatment.

Description

Technical Field

[0001] The invention relates to the technical field of biotechnology, and in particular to a primer and probe combination and a kit thereof for detecting urinary tract Klebsiella pneumoniae and drug-resistant genes by nested PCR. Background Art

[0002] Urinary tract infection is a disease caused by pathogenic microorganisms invading the human body. At present, the diagnosis standard for urinary tract infection in hospitals is urine culture, specifically, a colony count greater than 10 after 1-3 days of microbial culture. 5 / mL is the positive judgment standard. However, urine culture and urinary tract infection treatment mainly rely on antibiotics. In recent years, due to the widespread use of antibiotics and immunosuppressants, Gram-positive bacteria and fungal urinary tract infections have increased, and drug resistance and even multidrug resistance have shown an increasing trend. Therefore, scientific drug selection requires not only identification of bacterial species, but also testing of antibiotic sensitivity. However, urine culture has many limitations, such as easy contamination of urine samples, long culture process, and low positive rate. In addition, other diagnostic techniques, such as urine routine or urine sediment microscopy, can obtain very limited bacterial information. Therefore, in clinical practice, doctors must first use broad-spectrum antibiotics empirically. Once the wrong drug is selected, it will not only delay treatment and destroy the balance of the body's flora, but also increase the infection rate of drug-resistant strains and increase the difficulty of treatment.

[0003] PCR technology can shorten the diagnosis time from several days to several hours, but there are still false negative / positive situations, and the sensitivity needs to be improved. Based on reasonable pre-amplification and fully nested molecular design, nested PCR technology can effectively reduce the detection limit to more than a dozen bacteria while ensuring good specific detection; when analyzing low-abundance samples, it can significantly improve the signal-to-noise ratio, thereby ensuring better accuracy and reliability, and greatly reducing missed detection. The prior patent application "A nested PCR primer and probe combination, kit and application for detecting urinary tract infection pathogens" discloses primers and probe sequences for six urinary tract infection pathogens, and the detection range includes Escherichia coli, Klebsiella pneumoniae, Enterococcus faecalis, Enterococcus faecium, Enterobacter aerogenes and Proteus mirabilis. However, the Klebsiella pneumoniae primer design of the patent is based on the recA gene fragment, but the gene fragment also exists in Escherichia coli, and the primer will cause cross-amplification of the two bacteria. Therefore, the primer and probe sequence design of the Klebsiella pneumoniae in the prior patent cannot meet the specificity requirements. In addition, the prior patents have not yet addressed the need to detect drug-resistant genes, and the sensitivity or resistance to antibiotics is not clear enough, making it impossible to more accurately guide clinical drug use. Summary of the invention

[0004] In order to solve the defects and shortcomings of the prior art, the present invention provides a primer and probe combination and a kit thereof for detecting urinary tract Klebsiella pneumoniae and drug-resistant genes by nested PCR.

[0005] The technical solution adopted by the present invention is: a primer and probe combination for detecting urinary tract Klebsiella pneumoniae by nested PCR, wherein the primer and probe combination comprises a first outer primer OF for detecting Klebsiella pneumoniae, a first outer primer OR, a first inner primer IF, a first inner primer IR and a first TaqMan probe.

[0006] The nucleotide sequence of the first outer primer OF is shown in SEQ ID NO.1; the nucleotide sequence of the first outer primer OR is shown in SEQ ID NO.2; the nucleotide sequence of the first inner primer IF is shown in SEQ ID NO.3; the nucleotide sequence of the first inner primer IR is shown in SEQ ID NO.4; the nucleotide sequence of the first TaqMan probe is shown in SEQ ID NO.5.

[0007] A primer and probe combination for nested PCR detection of drug-resistant genes of urinary tract pathogens, wherein the drug-resistant genes include carbapenem resistance gene KPC and methicillin resistance gene meCA, and the primer and probe combination includes a second outer primer OF, a second outer primer OR, a second inner primer IF, a second inner primer IR and a second TaqMan probe for detection; and a third outer primer OF, a third outer primer OR, a third inner primer IF, a third inner primer IR and a third TaqMan probe for detection of methicillin resistance gene meCA.

[0008] The nucleotide sequence of the second outer primer OF is shown in SEQ ID NO.6; the nucleotide sequence of the second outer primer OR is shown in SEQ ID NO.7; the nucleotide sequence of the second inner primer IF is shown in SEQ ID NO.8; the nucleotide sequence of the second inner primer IR is shown in SEQ ID NO.9; the nucleotide sequence of the second TaqMan probe is shown in SEQ ID NO.10.

[0009] The nucleotide sequence of the third outer primer OF is shown in SEQ ID NO.11; the nucleotide sequence of the third outer primer OR is shown in SEQ ID NO.12; the nucleotide sequence of the third inner primer IF is shown in SEQ ID NO.13; the nucleotide sequence of the third inner primer IR is shown in SEQ ID NO.14; the nucleotide sequence of the third TaqMan probe is shown in SEQ ID NO.15.

[0010] A kit for detecting urinary tract Klebsiella pneumoniae by nested PCR, the kit comprising the primer and probe combination and a reagent for nested PCR amplification.

[0011] A kit for simultaneously detecting urinary tract Klebsiella pneumoniae and drug-resistant genes, the kit comprising a primer and probe combination for simultaneously detecting Klebsiella pneumoniae and methicillin-resistant gene meCA or a primer and probe combination for simultaneously detecting Klebsiella pneumoniae and carbapenem-resistant gene KPC.

[0012] The primer and probe combination is obtained by mixing the primer and probe combination for detecting urinary tract Klebsiella pneumoniae and the primer and probe combination for detecting drug-resistant genes in pairs.

[0013] The beneficial effects of the present invention are as follows: the present invention provides a primer and probe combination and a kit for detecting urinary tract Klebsiella pneumoniae and drug-resistant genes by nested PCR; the primers designed by the present invention do not cause cross-amplification of other urinary tract pathogens and can meet the specificity requirements; exogenous interference substances such as gentamicin, tobramycin, ceftazidime, levofloxacin, piperacillin and nitrofurantoin have no effect on the experimental results; the prepared kit can detect urinary tract pathogens and drug-resistant genes at the same time; the detection is convenient, simple and reliable; compared with common bacterial species identification, drug-resistant gene detection can more accurately guide clinical medication and avoid ineffective treatment. BRIEF DESCRIPTION OF THE DRAWINGS

[0014] Figure 1 The amplification of E. coli by the recA gene primers in the previous patent

[0015] Figure 2 Klebsiella pneumoniae primer specific

[0016] Figure 3 The specificity of the primers for carbapenem resistance gene KPC and methicillin resistance gene meCA

[0017] Figure 4 Anti-interference property of primers for Klebsiella pneumoniae

[0018] Figure 5 Anti-interference of drug resistance gene primers DETAILED DESCRIPTION

[0019] The present invention is further described below in conjunction with the accompanying drawings and the following embodiments. It should be understood that the accompanying drawings and the following embodiments are only used to illustrate the present invention rather than to limit the present invention.

[0020] The present invention provides a primer and probe combination and a kit thereof for nested PCR detection of urinary tract Klebsiella pneumoniae and drug-resistant genes, wherein the pathogen detection range includes Klebsiella pneumoniae, and the drug-resistant gene detection range includes one or more of methicillin resistance gene meCA and carbapenem resistance gene KPC.

[0021] The present invention provides a primer and probe combination for detecting urinary tract Klebsiella pneumoniae by nested PCR, comprising a first primer and probe combination; each primer and probe combination comprises an outer primer pair, an inner primer pair and a TaqMan probe;

[0022] The present invention provides a nested PCR primer and probe combination for detecting drug-resistant genes of urinary tract pathogens, including one or two of a second primer and probe combination and a third primer and probe combination; each primer and probe combination includes an outer primer pair, an inner primer pair and a TaqMan probe.

[0023] In the present invention, the TaqMan probe is preferably designed according to one or more of the following schemes:

[0024] The 5' end is modified with a FAM fluorescent group and the 3' end is modified with a BHQ1 group; the 5' end is modified with a Cy5 fluorescent group and the 3' end is modified with a BHQ3 group; the 5' end is modified with a HEX fluorescent group and the 3' end is modified with a BHQ1 group; the 5' end is modified with a Cy3 fluorescent group and the 3' end is modified with a BHQ2 group. When the present invention is for multiple gene screening, single-color or multi-color fluorescent labeling can be selected.

[0025] In the present invention, the first primer and probe combination comprises a first outer primer pair, a first inner primer pair and a first TaqMan probe. In the present invention, the first primer and probe combination is used to detect Klebsiella pneumoniae. In the present invention, the first outer primer pair is designed in the conserved fragment of the lpxC gene; the first outer primer pair includes a first outer primer OF with a nucleotide sequence as shown in SEQID NO: 1 (CCTTCGGTTTTATGCGCGAT) and a first outer primer OR with a nucleotide sequence as shown in SEQ ID NO: 2 (CCGATTTGTACGCCGTGAAT); the first inner primer pair includes a first inner primer IF with a nucleotide sequence as shown in SEQID NO: 3 (GATTGTGCCATCGTTGTTGAC) and a first inner primer IR with a nucleotide sequence as shown in SEQ ID NO: 4 (TAAACAGGTCACCGATCGCA); the nucleotide sequence of the first TaqMan probe is shown in SEQID NO: 5 (ACGGTCTGCGCTTTGAAGAC); the fragment size of the product amplified by the first outer primer pair is 219 bp; the fragment size of the product amplified by the first inner primer pair is 109 bp.

[0026] In the present invention, the second primer and probe combination includes a second outer primer pair, a second inner primer pair and a second TaqMan probe. In the present invention, the second primer and probe combination is used to detect the carbapenem resistance gene KPC. In the present invention, the second outer primer pair is designed in the conserved fragment of the KPC gene; the second outer primer pair includes a second outer primer OF with a nucleotide sequence as shown in SEQ ID NO: 6 (CGCCAATTTGTTGCTGAAGG) and a second outer primer OR with a nucleotide sequence as shown in SEQ ID NO: 7 (GCCAATCAACAAACTGCTGC); the second inner primer pair includes a second inner primer IF with a nucleotide sequence as shown in SEQ ID NO: 8 (CTTCATGCGCTCTATCGGC) and a first inner primer IR with a nucleotide sequence as shown in SEQ ID NO: 9 (CAGAGCCCAGTGTCAGTTTT); the nucleotide sequence of the first TaqMan probe is shown in SEQ ID NO: 10 (AGCTGAACTCCGCCATCCCAG); the fragment size of the product amplified by the second outer primer pair is 230 bp; the fragment size of the product amplified by the second inner primer pair is 143 bp.

[0027] In the present invention, the third primer and probe combination comprises a third outer primer pair, a third inner primer pair and a third TaqMan probe. In the present invention, the third primer and probe combination is used for the methicillin resistance gene meCA. In the present invention, the third outer primer pair is designed in the conserved fragment of the meCA gene; the third outer primer pair includes a third outer primer OF with a nucleotide sequence as shown in SEQ ID NO: 17 (TTGATCGCAACGTTCAATTT) and a third outer primer OR with a nucleotide sequence as shown in SEQ ID NO: 12 (GGCCAATTCCACATTGTTTC); the third inner primer pair includes a third inner primer IF with a nucleotide sequence as shown in SEQ ID NO: 13 (TTTTGTTAAAGAAGATGGTATGTGGA) and a third inner primer IR with a nucleotide sequence as shown in SEQ ID NO: 14 (TGCTTTGGTCTTTCTGCATTC); the nucleotide sequence of the third TaqMan probe is shown in SEQ ID NO: 15 (AGATTGGGATCATAGCGTCATTATTCCAG); the fragment size of the product amplified by the third outer primer pair is 167bp; the fragment size of the product amplified by the third inner primer pair is 80bp.

[0028] In the present invention, the outer primer pair and the inner primer pair in each primer and probe combination are packaged independently.

[0029] In the present invention, the screening amplification schemes of bacterial species and drug-resistant genes can be operated in parallel in parallel test tubes. Primers can also be mixed in pairs, including one bacterial species and one drug-resistant gene, to form two double PCR test schemes, and the TaqMan probes in each test tube select two fluorescent groups, FAM and Cy5, respectively. Primers can also be mixed in pairs to form a triple PCR test scheme, including one bacterial species and two drug-resistant genes, and the TaqMan probes in each test tube select three fluorescent groups, FAM, Cy5 and Cy3, respectively.

[0030] The present invention also provides the use of the primer and probe combination described in the above scheme in the preparation of a product for detecting urinary tract infection pathogens.

[0031] The present invention also provides a kit for detecting urinary tract Klebsiella pneumoniae and drug-resistant genes by nested PCR, comprising the primer and probe combination described in the above scheme and a reagent for nested PCR amplification.

[0032] In the present invention, the nested PCR amplification reagents are preferably purchased from ABclonal, Thermo Fisher Scientific or Novazon.

[0033] The present invention also provides a method for detecting urinary tract Klebsiella pneumoniae and drug resistance genes by nested PCR for non-diagnostic purposes, comprising the following steps:

[0034] 1) Extracting genomic DNA from the sample to be tested;

[0035] 2) using the genomic DNA as a template, and using each outer primer pair in the primer and probe combination described in the above scheme to perform pre-amplification respectively to obtain a pre-amplification product;

[0036] 3) Using the pre-amplification product as a template, fluorescent PCR amplification is performed using the inner primer pair and TaqMan probe in the primer and probe combination described in the above scheme that matches the outer primer pair in step 2), and the bacterial species contained in the sample to be tested is determined based on the positive fluorescent signal.

[0037] The present invention first extracts the genomic DNA of the sample to be tested.

[0038] The present invention has no particular limitation on the method for extracting genomic DNA from the sample to be tested, and a common bacterial genomic DNA extraction method is used, such as a physical method based on grinding beads or a chemical extraction kit.

[0039] After obtaining the genomic DNA, the present invention uses the genomic DNA as a template and employs each outer primer pair in the primer and probe combination described in the above scheme to perform pre-amplification respectively to obtain a pre-amplification product.

[0040] In the present invention, the working concentration of each outer primer in the outer primer pair is preferably 10-30 μM, more preferably 10 μM. This working concentration can prevent the outer primer pair from being excessively introduced into the second round of PCR to cause obvious byproducts or PCR deviation.

[0041] In the present invention, the total volume of the pre-amplification reaction system is preferably 10-25 μL; the pre-amplification program preferably includes: 95°C, 1 min: 95°C, 30 s, 55°C, 60 s, 68°C, 60 s, 10-25 cycles, more preferably 20 cycles; 68°C, 5 min.

[0042] In the present invention, the pre-amplification is preferably performed in a PCR reaction tube, a 96-well plate or a specially customized consumable tube;

[0043] The specially customized consumable tubes include plastic or glass capillaries that are compatible with the Biori FQD-A1600 fully automatic nucleic acid analysis system.

[0044] After obtaining the pre-amplification product, the present invention uses the pre-amplification product as a template, and adopts the inner primer pair and TaqMan probe in the primer and probe combination described in the above scheme to perform fluorescent PCR amplification on the template, and determines the bacterial species contained in the sample to be tested according to the positive reporting situation of the fluorescent signal.

[0045] In the present invention, the working concentration of each inner primer in the inner primer pair is preferably 5-20 μM, more preferably 10 μM; the working concentration of the TaqMan probe is preferably 200-1000 nM, more preferably 500 nM.

[0046] In the present invention, the program of the fluorescent PCR amplification preferably includes: 95°C, 1 min; 95°C, 30 s, 55°C, 60 s, 68°C, 60 s, 35 cycles.

[0047] In the present invention, the total volume of the reaction system for fluorescent PCR amplification is preferably 30 to 45 μL, and the volume of the pre-amplification product contained therein is preferably 10 to 25 μL. This parameter can reduce the interference of by-products such as primers and dimers in the first round of PCR reaction solution on the second round of PCR, thereby avoiding amplification errors.

[0048] In the present invention, the PCR amplification is preferably performed in a PCR reaction tube or a specially customized consumable tube; the specially customized consumable tube preferably includes a plastic capillary or a glass capillary that is matched with the Biori FQD-A1600 fully automatic nucleic acid analysis system.

[0049] Before the PCR amplification, the present invention preferably further comprises adding a thin layer of high-viscosity mineral oil (about 5-15 μL) above the PCR reaction solution to prevent inter-tube interference caused by aerosol contamination.

[0050] In the present invention, the fluorescent PCR amplification is preferably run on a fluorescent PCR instrument; the fluorescent PCR instrument is preferably purchased from Bio-Rad, Roche or Bio-Rad.

[0051] In the present invention, when the PCR amplification is fluorescent PCR amplification, the bacterial species contained are determined by the positive report of the Ct value;

[0052] The present invention also provides a gene fragment of urinary tract infection pathogenic bacteria prepared by the above method.

[0053] To further illustrate the present invention, a primer and probe combination and a kit for detecting urinary tract infection pathogens and drug-resistant genes by nested PCR provided by the present invention are described in detail below in conjunction with the accompanying drawings and examples, but they should not be construed as limiting the scope of protection of the present invention.

[0054] Example 1

[0055] This example provides a nested PCR amplification scheme to specifically identify highly conserved fragments of Klebsiella pneumoniae, as well as carbapenem resistance genes KPC and methicillin resistance genes meCA, and to verify the non-specificity of the Klebsiella pneumoniae primers in the prior patent, according to the following method:

[0056] Parallel nested PCR amplification reactions targeting three groups of specific sequences and one group of non-specific sequences were carried out: First, PCR reagents containing external primer pairs targeting different bacteria or drug resistance genes were configured in 27 parallel test tubes, among which test tubes 1-8 detected the specificity of primers for Klebsiella pneumoniae, test tubes 9-17 detected the specificity of primers for carbapenem resistance gene KPC, test tubes 18-26 detected the specificity of primers for methicillin resistance gene meCA, and test tube 27 detected the non-specificity of primers for Klebsiella pneumoniae of prior patents: the external primer pair for detecting Klebsiella pneumoniae was designed in the conservative fragment of lpxC gene, and the specific sequence was external primer OF: CCTTCGGTTTTATGCGCGAT; OR: CCGATTTGTACGCCGTGAAT. The external primer pair for detecting carbapenem resistance gene was designed in the conservative fragment of KPC gene, and the specific sequence was external primer OF: CGCCAATTTGTTGCTGAAGG; OR: GCCAATCAACAAACTGCTGC. The external primer pair for detecting methicillin resistance gene is designed in the conservative fragment of meCA gene, and the specific sequence is external primer OF: TTGATCGCAACGTTCAATTT, external primer OR: GGCCAATTCCACATTGTTTC. The external primer pair for detecting Klebsiella pneumoniae in the prior patent is designed in the conservative fragment of recA gene, and the specific sequence is external primer OF: GGGTAACCTGAAGCAGTCCA; OR: ACGCACAGAGGCGTAGAACT.

[0057] The total volume of the PCR reaction system was 10 μL, and the 10 μL reaction system was as follows: 0.2 μL of 10 μM forward primer, 0.2 μL of 10 μM reverse primer, 5 μL of PCR reaction solution, 2 μL of DNA template, and water was used to make up. The PCR reaction solution selected ABclonal products, and the thermal cycle of pre-amplification was 95°C, 1 min, (95°C, 30 s, 55°C, 60 s, 68°C, 60 s) × 20 cycles, 68°C, 5 min. Before the amplification reaction, a thin layer of 10 μL of high-viscosity mineral oil was added above the reaction solution to prevent interference between tubes caused by aerosol contamination.

[0058] After the pre-amplification reaction is completed, the pre-amplification product is used as a template and added to the second round of PCR reaction solution. The total volume of the PCR reaction system is preferably 30 μL, and the specific reaction system of the second round of PCR reaction solution is as follows: 0.6 μL of 10 μM forward primer, 0.6 μL of 10 μM reverse primer, 1.2 μL of 500nM TaqMan probe, 15 μL of PCR reaction solution, and the remaining volume is filled with water. The PCR reaction solution is preferably purchased from ABclonal. The paired internal primers and fluorescent TaqMan probes are: Klebsiella pneumoniae internal primer IF: GATTGTGCCATCGTTGTTGAC, IR: TAAACAGGTCACCGATCGCA, TaqMan: ACGGTCTGCGCTTTGAAGAC. Carbapenem resistance gene KPC internal primer IF: CTTCATGCGCTCTATCGGC, IR: CAGAGCCCAGTGTCAGTTTT, TaqMan: AGCTGAACTCCGCCATCCCAG. The internal primers of the methicillin resistance gene meCA IF: TTTTGTTAAAGAAGATGGTATGTGGA, IR: TGCTTGGTCTTTCTGCATTC, TaqMan: AGATTGGGATCATAGCGTCATTATTCCAG. The internal primers of the prior patent for detecting Klebsiella pneumoniae IF: CTGCTGATCTTTATCAACCAGA, IR: ACAGAGGCGTAGAACTTCA, TaqMan: TCGGTAACCCGGAAACCACTA. TaqMan fluorescent probes are all designed as: FAM fluorescent group (5′ end) + BHQ1 modified 3′ end. The thermal cycle of the second round of PCR reaction can be 95℃1min, (95℃30s, 55℃60s, 68℃60s)×35. Then, amplification and fluorescence signal statistics are completed in the Bio-Rad PCR instrument, and the situation of the target gene contained is determined by the positive report of the Ct value.

[0059] In the non-specific verification experiment, the nucleic acid template corresponding to the primer and probe combination is set as follows: In the prior patent, the primer and probe combination based on the reCA gene, the amplification template is the Escherichia coli nucleic acid. Through the cross-amplification reaction, the test results show that ( Figure 1 ) The primers in the prior patents all produce non-specific amplification.

[0060] In the specificity verification experiment, the nucleic acid templates corresponding to the primer pairs and probe combinations were set as follows: for the primer and probe combination based on the lpxC gene of Klebsiella pneumoniae, the amplification templates were Klebsiella pneumoniae nucleic acid, Escherichia coli nucleic acid, Enterococcus faecium nucleic acid, Staphylococcus aureus nucleic acid, Proteus mirabilis nucleic acid, Enterococcus faecalis nucleic acid, Pseudomonas aeruginosa nucleic acid, and Acinetobacter baumannii nucleic acid; for the primer and probe combination based on the carbapenem resistance gene KPC, the nucleic acid templates were Klebsiella pneumoniae nucleic acid (including KPC), Escherichia coli nucleic acid, Enterococcus faecium nucleic acid, Staphylococcus aureus nucleic acid, Proteus mirabilis nucleic acid, Enterococcus faecalis nucleic acid, Pseudomonas aeruginosa nucleic acid, and Acinetobacter baumannii nucleic acid. Acid, Staphylococcus aureus nucleic acid, Proteus mirabilis nucleic acid, Enterococcus faecalis nucleic acid, Pseudomonas aeruginosa nucleic acid, Acinetobacter baumannii nucleic acid, Klebsiella pneumoniae nucleic acid (excluding KPC); based on the primer and probe combination of the methicillin resistance gene meCA, the nucleic acid templates are Staphylococcus aureus nucleic acid (including meCA), Klebsiella pneumoniae nucleic acid, Escherichia coli nucleic acid, Enterococcus faecium nucleic acid, Proteus mirabilis nucleic acid, Enterococcus faecalis nucleic acid, Pseudomonas aeruginosa nucleic acid, Acinetobacter baumannii nucleic acid, Staphylococcus aureus nucleic acid (excluding meCA). The test results show ( Figure 2 , Figure 3 ), the primers designed by the present invention will not cause cross-amplification and meet the specificity requirements.

[0061] The PCR amplified product was subjected to second-generation sequencing, and the results showed that the Sanger sequencing results were consistent with the theoretical design, as shown below.

[0062] Klebsiella pneumoniae (1) Sanger sequencing results of Klebsiella pneumoniae pre-amplification PCR product (sequencing using forward sequence):

[0063]

[0064] Theoretical design sequence of Klebsiella pneumoniae lpxC gene (pre-amplification product 219 bp):

[0065]

[0066] (2) Sanger sequencing results of Klebsiella pneumoniae pre-amplification PCR products (sequencing using reverse primers):

[0067]

[0068] The reverse strand complementary sequence corresponding to the Klebsiella pneumoniae lpxC gene (pre-amplification product 219bp):

[0069]

[0070] (3) Sanger sequencing results of the second round of PCR products of Klebsiella pneumoniae:

[0071]

[0072] Theoretical design sequence of Klebsiella pneumoniae lpxC gene (amplified product 109 bp):

[0073]

[0074] (4) Sanger sequencing results of the second round of PCR products of Klebsiella pneumoniae (sequencing using reverse primers):

[0075]

[0076] The reverse strand complementary sequence corresponding to the Klebsiella pneumoniae lpxC gene (amplified product 109bp):

[0077]

[0078] Carbapenem resistance gene KPC (1) Sanger sequencing results of the PCR product pre-amplified for carbapenem resistance gene KPC (using forward sequence detection)

[0079] sequence):

[0080]

[0081] Theoretical design sequence of carbapenem resistance gene KPC (pre-amplification product 230bp):

[0082]

[0083] (2) Sanger sequencing results of the PCR product of the carbapenem resistance gene KPC pre-amplification (sequencing with reverse primer):

[0084]

[0085] The reverse strand complementary sequence corresponding to the carbapenem resistance gene KPC (pre-amplification product 230bp):

[0086]

[0087] (3) Sanger sequencing results of the second round of PCR products of carbapenem resistance gene KPC:

[0088]

[0089] Theoretical design sequence of carbapenem resistance gene KPC (amplification product 143bp):

[0090]

[0091] (4) Sanger sequencing results of the second round of PCR products of carbapenem resistance gene KPC (sequencing with reverse primer):

[0092]

[0093] The reverse strand complementary sequence corresponding to the carbapenem resistance gene KPC (amplification product 143bp):

[0094]

[0095] Methicillin resistance gene meCA (1) Sanger sequencing results of the pre-amplification PCR product of methicillin resistance gene meCA (sequencing using forward sequence):

[0096]

[0097] (2) Theoretical design sequence of methicillin resistance gene meCA (pre-amplification product 167 bp):

[0098]

[0099] (3) Sanger sequencing results of the pre-amplification PCR product of the methicillin resistance gene meCcA (sequencing using the reverse primer):

[0100]

[0101] The reverse strand complementary sequence corresponding to the methicillin resistance gene meCA:

[0102]

[0103] Sanger sequencing results of the second round of PCR products of methicillin resistance gene mecA:

[0104]

[0105] Theoretical design sequence of methicillin resistance gene meCA (amplification product 80bp):

[0106]

[0107] (4) Sanger sequencing results of the second round of PCR products of methicillin resistance gene meCA (sequencing with reverse primer):

[0108]

[0109] The reverse strand complementary sequence corresponding to the methicillin resistance gene meCA (amplification product 80bp):

[0110]

[0111] Example 2

[0112] This example provides a nested PCR amplification scheme to verify the anti-interference of the primer and probe combination, where the interfering substances are antibiotics commonly used in clinical practice, wherein the antibiotic combination 1 includes levofloxacin + piperacillin + nitrofurantoin, and the antibiotic combination 2 includes gentamicin + tobramycin + ceftazidime, according to the following method:

[0113] Nested PCR amplification reaction for anti-interference performance verification: First, PCR reagents containing external primer pairs for different bacteria or drug resistance genes were configured in nine parallel test tubes, of which primers for detecting Klebsiella pneumoniae were configured from one to three, primers for detecting carbapenem resistance gene KPC were configured from four to six, and primers for detecting methicillin resistance gene were configured from seven to nine. The primer sequences were as follows: The external primer pair for detecting Klebsiella pneumoniae was designed in the conservative fragment of lpxC gene, and the specific sequence was external primer OF: CCTTCGGTTTTATGCGCGAT; OR: CCGATTTGTACGCCGTGAAT. The external primer pair for detecting carbapenem resistance gene KPC was designed in the conservative fragment of KPC gene, and the specific sequence was external primer OF: CGCCAATTTGTTGCTGAAGG; OR: GCCAATCAACAAACTGCTGC. The outer primer pair for detecting methicillin resistance gene was designed in the conserved fragment of meCA gene, and the specific sequences were outer primer OF: TTGATCGCAACGTTCAATTT, outer primer OR: GGCCAATTCCACATTGTTTC.

[0114] The volume of the PCR reaction system is 10 μL, and the PCR reaction solution is a Novozymes product, wherein the primer concentration is 10 μM. The thermal cycle of the pre-amplification can be 95°C for 1 min, (95°C for 30 s, 55°C for 60 s, 68°C for 60 s)*20 cycles, and 68°C for 5 min.

[0115] After the pre-amplification reaction is completed, the product of the pre-amplification round is used as a template to configure the second round of PCR reaction reagents. The volume of each unit of PCR reaction system is 30 μL, and the PCR reaction solution of Novozyme is selected. The paired internal primers and fluorescent TaqMan probes are: Klebsiella pneumoniae internal primer IF: GATTGTGCCATCGTTGTTGAC, IR: TAAACAGGTCACCGATCGCA, TaqMan: ACGGTCTGCGCTTTGAAGAC. Carbapenem resistance gene KPC internal primer IF: CTTCATGCGCTCTATCGGC, IR: CAGAGCCCAGTGTCAGTTTT, TaqMan: CAGAGCCCAGTGTCAGTTTT. Methicillin resistance gene meCA internal primer IF: TTTTGTTAAAGAAGATGGTATGTGGA, IR: TGCTTGGTCTTTCTGCATTC, TaqMan: AGATTGGGATCATAGCGTCATTATTCCAG. TaqMan fluorescent probes are designed as: FAM fluorescent group (5' end) + BHQ1 modified 3' end. The thermal cycle of the second round of PCR reaction can be 95℃1min, (95℃30s, 55℃60s, 68℃60s)×35. Then, amplification and fluorescence signal statistics are completed in the Bio-Rad PCR instrument, and the target gene is determined by the positive Ct value.

[0116] In the anti-interference verification experiment, the nucleic acid templates were set as follows: the nucleic acid templates of test tubes 1 to 3 were pure Klebsiella pneumoniae nucleic acid, Klebsiella pneumoniae nucleic acid with antibiotic combination 1, and Klebsiella pneumoniae nucleic acid with antibiotic combination 2, respectively; the nucleic acid templates of test tubes 4 to 6 were pure Klebsiella pneumoniae containing the KPC gene, Klebsiella pneumoniae containing the KPC gene with antibiotic combination 1, and Klebsiella pneumoniae containing the KPC gene with antibiotic combination 2, respectively; the nucleic acid templates of test tubes 7 to 9 were pure Staphylococcus aureus containing the meCA gene, Staphylococcus aureus containing the meCA gene with antibiotic combination 1, and Staphylococcus aureus containing the meCA gene with antibiotic combination 2, respectively. The results show ( Figure 4 , Figure 5 ), with or without interference, Ct remains basically unchanged, with excellent anti-interference performance.

[0117] The above is only a preferred embodiment of the present invention, and the protection scope of the present invention is not limited to the above embodiments. All technical solutions under the concept of the present invention belong to the protection scope of the present invention. It should be pointed out that for ordinary technicians in this technical field, some improvements and modifications without departing from the principle of the present invention should also be regarded as the protection scope of the present invention.

Claims

1. A primer and probe combination for detecting urinary tract Klebsiella pneumoniae by nested PCR, characterized in that: The primer and probe combination includes a first outer primer OF, a first outer primer OR, a first inner primer IF, a first inner primer IR and a first TaqMan probe for detecting Klebsiella pneumoniae, the nucleotide sequence of the first outer primer OF is shown in SEQ ID NO.1; the nucleotide sequence of the first outer primer OR is shown in SEQ ID NO.2; the nucleotide sequence of the first inner primer IF is shown in SEQ ID NO.3; the nucleotide sequence of the first inner primer IR is shown in SEQ ID NO.4; and the nucleotide sequence of the first TaqMan probe is shown in SEQ ID NO.

5.

2. A kit for detecting urinary tract Klebsiella pneumoniae by nested PCR, characterized in that: The kit comprises the primer and probe combination as claimed in claim 1 and a reagent for nested PCR amplification.

Images