A Beauveria bassiana Bbzy2407 strain and its application

Abstract

The invention discloses a Beauveria bassiana Bbzy2407 strain and application thereof. The strain is Beauveria bassiana, and is classified and named as Beauveria bassiana Beauveria bassiana ; Deposited in the General Microbiological Center of China Microbiological Culture Collection Committee, the deposit address is No. 3, No. 1 Beichen West Road, Chaoyang District, Beijing; deposit date: December 2, 2024; deposit number: CGMCC No.41648. The Beauveria bassiana Bbzy2407 provided by the present invention is a kind of fungus that can be used to prevent and control the major pest of agricultural and forestry plants, the thick narrow-costed gill beetle Holotrichia scrobiculata The biocontrol fungus for larvae has the characteristics of strong pathogenicity to the larvae of the rough-ribbed gill beetle, being safe to the environment, and not easily causing pests to develop resistance. It can be used for biological control of the larvae of the rough-ribbed gill beetle.

Description

Technical Field

[0001] This invention relates to the field of microbial technology, and in particular to a Beauveria bassiana strain Bbzy2407 and its applications. Background Technology

[0002] Thick-ribbed gill beetle Holotrichia scrobiculata Brenske, belonging to the family Scarabaeidae in the order Coleoptera, is a significant pest in agricultural and forestry production. The Brenske larvae of the narrow-walled scarab beetle undergo four life stages: adult, egg, larva, and pupa. The adult stage is winged, capable of mating and reproduction, and able to fly. The larvae, however, live burrowing in the soil and are unable to fly freely. Adults feed on and damage the leaves of crops and plants, while larvae feed on and damage the underground root systems of agricultural and forestry plants, causing the roots to wilt due to the inability to absorb water and nutrients from the soil, ultimately leading to the death of the entire plant. Because the larvae of the narrow-walled scarab beetle live underground for extended periods, their occurrence and damage are relatively concealed. Control measures must be applied underground to achieve an effective result. Furthermore, pesticides effective against adults may be ineffective against larvae, and vice versa. Therefore, the damage caused by the larvae of the narrow-walled scarab beetle to crops and plants is far greater than that caused by the adults, and pesticides effective against adults are unsuitable for controlling its larvae. In recent years, the narrow-ribbed scabies beetle has occurred in blueberry orchards in Yunnan and Guizhou provinces. The larvae feed on and damage blueberry roots, becoming a significant factor affecting the development of the blueberry industry, with the total number of infestations and the extent of damage showing an increasing trend year by year. Currently, the control of this beetle larvae mainly relies on the application of chemical pesticides. However, the disadvantages of chemical control, such as increased pesticide resistance, pesticide residues, and re-outbreaks, are becoming increasingly prominent, attracting considerable attention both domestically and internationally, and raising concerns about food safety.

[0003] Insecticidal fungi are a class of microorganisms that can cause disease and death in pests under natural conditions and can spread naturally within pest populations, leading to pest epidemics. They are an important source for the development of biological control products for pests. Insecticidal fungi such as *Beauveria bassiana* were among the earliest discovered protozoan fungi for insect diseases both domestically and internationally. Currently, they are gradually becoming a class of biocontrol fungi with widespread development and application, mature large-scale production technology, and good ecological and environmental benefits worldwide, possessing significant application value and development prospects. Therefore, researching biocontrol fungi of *S. cristatus* larvae provides a basis for the biological control of *S. cristatus* larvae and also provides a safeguard against pesticide resistance and environmental pollution caused by chemical control.

[0004] Beauveria bassiana ( Beauveria bassianaBeauveria bassiana is a fungus belonging to the genus Beauveria of the family Cordyceps, order Ascomycota, phylum Discycota, subphylum Coccidioidomycetes, order Hypocreales, and family Cordyceps. Due to its strong pathogenicity against pests, wide host range, low production cost, and lack of environmental pollution, Beauveria bassiana is widely used both domestically and internationally for the control of pests in agricultural and forestry production, including Lepidoptera, Coleoptera, and Homoptera. However, Beauveria bassiana, which has a strong infectivity and pathogenicity against adult scarab beetles, has no infectivity or pathogenicity against scarab beetle larvae. Therefore, it is not appropriate to simply and mechanically use Beauveria bassiana, which controls adult scarab beetles, to control scarab beetle larvae. Our team previously discovered Beauveria bassiana strain Bbzy230628, which can naturally infect adult S. coccidioidomyces, but the original host (primary host) of this strain is the adult S. coccidioidomyces, not its larvae. However, there are currently no reports of natural infection of *Beauveria bassiana* larvae, nor are there any original strains of *Beauveria bassiana* isolated from naturally infected larvae. Furthermore, given the rich genetic diversity and certain host specificity of *Beauveria bassiana*, screening for highly toxic and effective strains against the target organism is crucial for developing biocontrol agents based on *Beauveria bassiana* for *Beauveria bassiana* larvae and ensuring their material availability. Summary of the Invention

[0005] The purpose of this invention is to provide a Beauveria bassiana strain Bbzy2407 and its application, aiming to overcome the limitations of existing Beauveria bassiana strains that have not been found to infect and kill the narrow-ribbed scarab beetle under natural conditions. Holotrichia scrobiculata The lack of larvae can be addressed by using biotechnology to control armyworms and avoid or reduce pesticide resistance problems caused by the irrational use of chemical pesticides.

[0006] To address the problems of existing technologies, the present invention provides the following technical solution: a Beauveria bassiana strain Bbzy2407, classified and named Beauveria bassiana. Beauveria bassiana It is deposited at the China General Microbiological Culture Collection Center (CGMCC), located at No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing; deposit date: December 2, 2024; accession number: CGMCC No. 41648.

[0007] Furthermore, the ITS gene sequence of the Beauveria bassiana strain Bbzy2407 is the nucleotide sequence shown in SEQ ID No. 1.

[0008] Furthermore, the present invention provides a Beauveria bassiana Bbzy2407 inoculum prepared from the aforementioned Beauveria bassiana Bbzy2407 strain.

[0009] Furthermore, the active ingredient of the bacterial agent is a suspension of conidia of the Beauveria bassiana strain Bbzy2407.

[0010] Furthermore, the present invention provides a method for preparing the microbial agent, comprising the following steps:

[0011] (1) Culture Beauveria bassiana strain Bbzy2407 on SDAY medium;

[0012] (2) Take the conidia of Beauveria bassiana Bbzy2407 and put them into sterile water containing 0.05% Tween-80 to prepare a solution with a concentration of 1.0×10⁻⁶. 8 A suspension of Beauveria bassiana Bbzy2407 spores per mL was prepared to obtain a Beauveria bassiana Bbzy2407 inoculum.

[0013] Furthermore, the present invention provides an insecticide containing any of the Beauveria bassiana Bbzy2407 bacterial agents described above.

[0014] Furthermore, the present invention provides the application of the aforementioned Beauveria bassiana strain Bbzy2407 or any of the aforementioned Beauveria bassiana Bbzy2407 inoculum, or the aforementioned insecticide, in the control of larvae of the narrow-ribbed scarab beetle.

[0015] Furthermore, the present invention provides the application of the aforementioned Beauveria bassiana strain Bbzy2407 or any of the aforementioned Beauveria bassiana Bbzy2407 inoculum in the preparation of a control agent for the larval stage of the narrow-ribbed gill beetle.

[0016] Furthermore, the present invention provides a method for controlling the larval stage of the narrow-ribbed scarab beetle by applying any of the aforementioned Beauveria bassiana Bbzy2407 fungal agents or the aforementioned insecticides during the larval stage of the narrow-ribbed scarab beetle.

[0017] Beneficial effects: The Beauveria bassiana Bbzy2407 provided by this invention is a fungicide that can be used to control the major crop pest, the narrow-ribbed scarab beetle. Holotrichia scrobiculata The biocontrol fungi for larvae are characterized by strong pathogenicity to the larvae of the narrow-ribbed scarab beetle, environmental safety, and low likelihood of inducing pesticide resistance in pests. They can be used for the biological control of the larvae of the narrow-ribbed scarab beetle.

[0018] Compared with the prior art, the present invention has the following advantages:

[0019] (1) This invention is the first strain isolated from diseased larvae of the coarse-ribbed gill beetle. It is relatively simple to culture, grows faster, and produces a large amount of spores.

[0020] (2) The *Beauveria bassiana* strain Bbzy2407, isolated from the diseased larvae of the *Sinapis albopictus*, exhibits rapid and strong lethality against the larvae of the *Sinapis albopictus*. Using 1×10⁻⁶ strains of Bbzy2407... 8After inoculation at a concentration of [number] cells / mL, the larvae of *S. coccinea* began to die on day 2 post-inoculation. The cumulative mortality rates of *S. coccinea* larvae on days 1, 3, 5, 7, 9, 11, 13, and 15 were 0%, 3.33%, 35.00%, 71.67%, 88.33%, 98.33%, 100%, and 100%, respectively. At a concentration of 1×10 [units / mL], [the following treatment was performed]. 8 At a concentration of 1 spore / mL, the LT of 3rd instar larvae of the narrow-ribbed scarab beetle 50 It takes 5.75 days.

[0021] (3) This invention was discovered by the inventors in July 2024 during a survey of ginkgo forests in Zhanyi County, Qujing City, Yunnan Province, where Beauveria bassiana was found to be prevalent in large numbers among the larvae of the Narrow-ribbed worm, causing a large number of larvae to become infected and die. Therefore, this strain is the first entomopathogenic fungus to be discovered in China that parasitizes the larvae of the Narrow-ribbed worm and has a high degree of development and application potential in the prevention and control of the larvae of the Narrow-ribbed worm. Attached Figure Description

[0022] Figure 1 Morphological diagrams of conidia and sporangiophores of Beauveria bassiana Bbzy2407, as presented in this invention.

[0023] Figure 2 This is a colony morphology diagram of Beauveria bassiana Bbzy2407, which is the present invention.

[0024] Figure 3 The dorsal and ventral views are of a coarse-striped gill beetle larva that died naturally from infection with Beauveria bassiana Bbzy2407 according to the present invention. Figure 3 Image A shows the infected larvae of the coccidioidomyces beauveria bassiana (Bbzy2407) three days after natural infection and death. Figure 3 B is a diagram of an infected larva of the coccidioidomyces beetle (Bbzy2407) that died 7 days after natural infection. Detailed Implementation

[0025] To make the objectives, technical solutions, and advantages of this invention clearer, the invention will be further described in detail below with reference to embodiments. It should be understood that the specific embodiments described herein are merely illustrative and not intended to limit the invention. Example 1

[0026] This invention discloses a strain of Beauveria bassiana Bbzy2407, which is classified as Beauveria bassiana. Beauveria bassianaThe specimen was deposited at the China General Microbiological Culture Collection Center (CGMCC), located at No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing. The deposit date was December 2, 2024; the accession number is CGMCC No. 41648. The viability of the biological material was tested by the collection center on December 2, 2024, and the result was positive. Example 2

[0027] Isolation and identification of pathogens

[0028] 1.1 Materials and Methods

[0029] 1.1.1 Materials

[0030] On July 12, 2024, a *Cyprinus coarse-ribbed* beetle, which died from a fungal infection, was collected in Zhanyi County, Qujing City, Yunnan Province. Holotrichia scrobiculata )larva.

[0031] SAY medium: 1% peptone + 1% yeast extract + 4% glucose + 1.5-2% agar powder + 1000 ml water.

[0032] Aseptic operating conditions: All instruments and utensils are sterilized in a high-temperature sterilizer (121℃, 30 min), and inoculation and other operations are performed in a laminar flow hood.

[0033] Culture conditions: Incubate in a 25℃ light (12L:12D) incubator until colonies form, then transfer to test tubes and SDAY slant. Incubate for 2-3 days, then transfer to a 4℃ refrigerator for storage.

[0034] 1.1.2 Isolation and purification of pathogens

[0035] Separation: from the corpses of diseased coarse-ribbed gill beetle larvae ( Figure 3 Pathogens were isolated from the larvae of the diseased *Beauveria bassiana*. Infected larvae were brought back to the laboratory and sequentially immersed in 70% alcohol for 20 seconds, followed by 0.1% mercuric chloride solution for 3 minutes (for thorough disinfection), and finally rinsed three times with sterile water. Conidia or hyphae growing on the larvae were then collected using an inoculation needle and placed on SDAY medium. After incubation at 25°C, a large number of hyphae grew. Single spore isolation and culture were performed using standard methods to obtain a pure strain of *Beauveria bassiana* with strong sporulation capacity. Beauveria bassiana Bbzy2407 was transferred to SDAY slant and grown for 3-5 days. After growth, it was stored in a refrigerator at 4℃.

[0036] Rejuvenation: After culturing the isolated strain on SDAY culture medium for 2-3 days, a large number of conidia are produced. These conidia are then picked into sterile water containing 1% Tween-80 and stirred thoroughly with a glass rod to obtain an appropriate concentration (10). 8 A spore suspension of (spores / mL) was evenly sprayed onto the surface of the larvae of the narrow-ribbed scarab beetle using a small sprayer (until the surface of the larvae was moistened), maintaining a relative humidity of over 80%. The dead larvae of the narrow-ribbed scarab beetle were collected and kept moist. The dead larvae were then separated using the above method to obtain a more pathogenic strain.

[0037] Purification: Pick conidial powder from the culture medium and inoculate it again onto a fresh culture medium. Culture in this manner for 2-3 generations to purify the strain.

[0038] 1.1.3 Identification of Pathogens

[0039] Morphological identification: Identification was performed based on the culture characteristics, hyphae, and conidia morphology of the pathogen. Using a 40×10x optical microscope, the morphology of colony hyphae, conidia, and conidiophores was examined and photographed. The strains were then classified and identified based on their morphology.

[0040] Analysis of strain rDNA-ITS sequence. Strain DNA was obtained using a fungal genomic DNA extraction kit (provided by Guangzhou Dingguo Biotechnology Co., Ltd.). PCR amplification of the strain's rDNA-ITS sequence was performed using universal fungal primers ITS1 (5′-TCCGTAGGTCCGTAGGTGAACCTGCGG-3′) / ITS4 (5′-TCCTCCGCTTATTGATATGC-3′). The PCR reaction mixture consisted of 50 μL: 25 μL of I-5TM2×High-Fieldlity Master Mix, 1 μL of DNA template, 2 μL each of forward and reverse primers (10 μmol / L), and 20 μL of ddH2O. The amplification program was: 94℃ pre-denaturation for 5 min; 35 cycles of 94℃ for 30 s, 56℃ for 30 s, and 72℃ for 90 s; extension at 72℃ for 10 min. The PCR products were detected by 1% agarose gel electrophoresis and then sent to Guangzhou Ruijie Biotechnology Co., Ltd. for sequencing. The obtained DNA fragment sequence was compared with the NCBI database to determine the species relationship of the strain.

[0041] 1.2 Results

[0042] 1.2.1 Morphological identification results

[0043] Wild-type strains were isolated from the larvae of the coarse-striped gill beetle, which were naturally infected by entomopathogenic fungi. The strains were cultured on SDAY (Sassler's agar medium) and then re-inoculated into armyworm larvae to rejuvenate them. A purified strain, namely Beauveria bassiana Bbzy2407, was obtained by isolating single hyphae from this strain.

[0044] like Figure 1 and Figure 2 As shown, on SDAY medium, the Beauveria bassiana strain Bbzy2407 colonies were milky white on the front side during the early growth stage, with a slightly raised center. The color of the back side of the colonies changed from light to dark from the edge to the center, from yellowish-brown to blackish-brown in the middle half. The mycelium was smooth, septate, and 2-3 μm in diameter. The conidiophores were erect and grape-like. The conidia were elliptical, smooth, pointed at one end and blunt at the other, and 4.55 μm × 2.10 μm in size.

[0045] 1.2.2 Molecular identification results

[0046] The PCR amplification product sequence of the rDNA-ITS sequence of strain Bbzy2407 was determined. The ITS gene sequence of Beauveria bassiana strain Bbzy2407 is the nucleotide sequence shown in SEQ ID No. 1. The results are as follows:

[0047] GATTCGAGGTCACGTTCAGAAGTTGGGTGTTTTACGGCGTGGCCGCGTCGGGGTTCCGGTGCGAGCTGTATTACTACGCAGAGGTCGCCGCGGACGGGCCGCCACTCCATTTCAGGGCCGGCGGTGGTGC TGCCGGTCCCCAACGCCGACCTCCCCAAGGGGAGGTCGAGGGTTGAAATGACGCTCGAACAGGCATGCCCGCCAGAATGCTGGCGGGCGCAATGTGCGTTCAAAGATTCGATGATTCACTGGATTCTGCA ATTCACATTACTTATCGCATTTCGCTGCGTTCTTCATCGATGCCAGAGCCAAGAGATCCGTTGTTGAAAGTTTTGATTCATTTGTTTTGCCTTGCGGCGTATTCAGAAGATGCTGGAATACAAGAGTTTG AGGTCCCCGGCGGGCCGCTGGTCCAGTCCGCGTCCGGGCTGGGGCGAGTCCGCCGAAGCAACGATAGGTAGGTTCACAGAAGGGTTAGGGGAGTTGAAAACTCGGTAATGATCCCTCCGCAGGTTCACCTA

[0048] The sequence was submitted to the GenBank database for BLAST alignment. Relevant sequences were selected, and a phylogenetic tree was constructed using the Neighbor-joining method. The alignment results showed that strain Bbzy2407 is Beauveria bassiana.

[0049] Based on field infection symptoms, indoor isolation and observation of infected insects, and identification according to the infection symptoms, conidial and hyphal morphology characteristics of Beauveria bassiana as described in "Entomological Mycology," as well as rDNA-ITS sequence analysis results, the strain was confirmed as Beauveria bassiana. Beauveria bassiana It has been deposited at the China General Microbiological Culture Collection Center, accession number: CGMCC No. 41648. Example 3

[0050] Biological characteristics of purified strain of Beauveria bassiana Bbzy2407

[0051] 2.1 Materials and Methods

[0052] 2.1.1 Test strains

[0053] Select one plate of purified, vigorous, and uniformly growing strain as the test strain. Take the mycelium and inoculate it again onto SDAY, and incubate it in a constant temperature and light (12L:12D) incubator at 25℃.

[0054] 2.1.2 Determination of colony growth rate and sporulation rate

[0055] The mycelial cake method was used for inoculation. Sterilized punches were used to evenly punch holes in areas of dense conidia in the colony. Before each punching, the punch was sterilized with an alcohol lamp to prevent contamination. Using sterilized tweezers, the culture medium blocks containing conidia were inoculated onto SDAY medium, ensuring the mycelial and conidial side was facing down on each medium. The inoculated petri dishes were placed in a constant temperature incubator at 25°C and 70% relative humidity, alternating between light and dark for 12 hours each. During the incubation period, the growth and sporulation of the strain were observed daily, and the sporulation time, colony morphology, and colony size were recorded. Starting from the third day after observation, the transverse and longitudinal diameters of the colonies were measured every 3 days using calipers, and the measurements were recorded until the strain ceased sporulation. After the strain finished sporulation, five bacterial blocks were randomly punched from the colonies grown under different conditions using a sterilized punch. The obtained bacterial blocks were placed in an Erlenmeyer flask containing 10 ml of 0.05% Tween-80 sterile water. After a period of time, the spore suspension was obtained and placed on a hemocytometer. The spore morphology was observed and counted under a microscope. The sporulation yield per unit area of ​​each treatment group was calculated. Each treatment was repeated three times.

[0056] 2.2 Results

[0057] From the perspective of colony growth, strain Bbzy2407 can grow on SDAY medium. The mycelium of the strain inoculated on SDAY medium grows rapidly, starting from day 3 of culture. From day 3 to day 6, the average colony diameter growth rate is 2.69 mm / day; from day 6 to day 9, the average colony diameter growth rate is 3.11 mm / day. At days 3, 6, 9, and 11, the colony diameters are 13.43, 21.50, 30.84, and 37.12 mm, respectively; at day 15, the colony diameter reaches 45.22 mm. The colony diameter measurement results are shown in Table 1.

[0058] Table 1. Colony diameter (cm)

[0059] In terms of sporulation, the Beauveria bassiana strain Bbzy2407 began sporulation on SDAY medium on day 5, with a sporulation rate of 1.68 × 10⁻⁶ on day 5. 7 spores / mm 2Colonies. Sporulation rate and sporulation volume increased with increasing culture time, reaching 6.18 × 10⁻⁶ on day 15. 8 pcs / mm 2 Colony formation indicates that the strain has good biological characteristics and good growth. Sporulation results are shown in Table 2.

[0060] Table 2 Sporulation rate (spores / mm) 2 (mushroom)

[0061] Example 3

[0062] Indoor toxicity test of Beauveria bassiana Bbzy2407 against larvae of the narrow-sided scarab beetle.

[0063] 3.1 Materials and Methods

[0064] 3.1.1 Test insect source

[0065] Larvae of the narrow-ribbed scarab beetle were reared in our laboratory using ginkgo leaves at a temperature of (25±1)℃, humidity of (70±5)%, and a photoperiod of 12L:12D. Healthy, uniformly sized third-instar larvae were obtained as test insects.

[0066] 3.1.2 Preparation of spore suspension

[0067] Take a well-grown purified Beauveria bassiana Bbzy2407, wash off the conidia with sterile water, filter, and prepare a 10 8 The spores / ml conidial suspension was used to collect a drop of the filtrate using a sterile capillary dropper and apply it to a hemocytometer. The spores were counted and the data were recorded under a microscope. Sterile water containing 0.5% Tween 80 was used as a blank control for virulence determination.

[0068] 3.1.3 Impregnation method

[0069] The third instar larvae of the coarse-ribbed gill beetle were treated by immersion at a concentration of 1×10⁻⁶. 8After soaking in a bacterial suspension of 10 s / mL for 10 seconds, the larvae were removed and dried with sterile filter paper. A control group was prepared using 0.05% Tween-80 sterile water. The treated larvae were then reared in an artificial climate chamber with a temperature of (25±1)℃, relative humidity of (80±5)%, and a photoperiod of L / / D = 12 h / / 12 h. After inoculation, the larvae were observed daily at regular intervals, and the number of deaths was recorded. Single-headed larvae were cultured in a moist environment. Death was confirmed by the appearance of white hyphae or conidia on the surface of the dead larvae. Each treatment consisted of 20 larvae, repeated three times. The number of dead larvae and the number of stunted larvae with white Beauveria bassiana spores on their surface were recorded daily. The average mortality rate and stunted larvae rate were calculated. Data were analyzed using linear regression statistical analysis with DPS 14.0 software.

[0070] 3.2 Results

[0071] The virulence assay results showed that the Beauveria bassiana strain Bbzy2407 was virulence-resistant at 1×10⁻⁶. 8 At a concentration of spores / mL, it exhibits high pathogenicity against the larvae of the narrow-ribbed scarab beetle, and the mortality rate increases with increasing spore concentration and treatment duration. Using strain Bbzy2407 at 1×10⁻⁶... 8 After inoculation at a concentration of [number] cells / mL, the larvae of the narrow-walled scarab beetle began to die on the second day after inoculation. The cumulative mortality rates of the larvae on days 1, 3, 5, 7, 9, 11, 13, and 15 were 0%, 3.33%, 35.00%, 71.67%, 88.33%, 98.33%, 100%, and 100%, respectively. The main results are shown in Table 3.

[0072] Table 3

[0073] From the perspective of lethal time effect, at 1×10 8 At a concentration of 1 spore / mL, the LT of 3rd instar larvae of the narrow-ribbed scarab beetle 50 The LT (time to death) was 5.75 days. This indicates that the strain is highly virulent against the larvae of the narrow-ribbed scarab beetle, with rapid infection and pathogenicity, and a median lethal time (LT). 50 The value is small. The main results are shown in Table 4.

[0074] Table 4. Time Effect of Infection and Pathogenesis

[0075] This strain, identified as *Beauveria bassiana* Bbzy2407 (CGMCC No. 41648), is a wild-type strain isolated and purified from naturally infected and dead *S. chinensis* larvae in Ginkgo biloba fields. It exhibits rapid growth, high sporulation, and high spore germination rate on SDAY medium at (25±1)℃, (75±5)% relative humidity, and L / / D = 12 h / / 12 h. Its spore suspension demonstrates strong pathogenicity against *S. chinensis* larvae and can be used for their control. Furthermore, the strain has widely available and inexpensive raw materials, a simple cultivation method, and is easily mass-produced, demonstrating significant development and application potential. Using this *Beauveria bassiana* Bbzy2407 strain to control *S. chinensis* larvae represents a typical biological control method, avoiding the problems of pesticide resistance and environmental pollution associated with chemical pesticides, and providing a basis for the green control of *S. chinensis* larvae.

[0076] The foregoing has shown and described the basic principles, main features, and advantages of the present invention. Those skilled in the art should understand that the present invention is not limited to the above embodiments. The embodiments and descriptions in the specification are merely illustrative of the principles of the invention. Various changes and modifications can be made to the invention without departing from its spirit and scope. The scope of protection of the present invention is defined by the appended claims, specification, and their equivalents.

Claims

1. An application of Beauveria bassiana Bbzy2407 strain in preventing and controlling the larvae of Holotrichia coli in soil, characterized in that: The strain is classified and named Beauveria bassiana ( Beauveria bassiana ), Deposit Number: CGMCC No.41648.

2. Use of the bacterial agent prepared from the Beauveria bassiana Bbzy2407 strain described in claim 1 in preventing and controlling the larvae of Holothuria serrata in the soil.

3. The use according to claim 2, characterized in that: The active ingredient of the bacterial agent is the conidia suspension of the Beauveria bassiana Bbzy2407 strain described in claim 1.

4. Use of an insecticide in preventing and controlling larvae of Holothuria serrata in soil, characterized in that: The insecticide contains Beauveria bassiana Bbzy2407, which is classified as Beauveria bassiana ( Beauveria bassiana ), Deposit Number: CGMCC No.41648.

5. A method for controlling Holotrichia paniculata in the larval stage, characterized in that: During the larval stage of the scarab beetle, the fungus Beauveria bassiana Bbzy2407 was applied to the soil. The fungus Bbzy2407 was classified and named Beauveria bassiana ( Beauveria bassiana ); Deposit number: CGMCC No.41648.

Images