Repair gene editing system aiming at HbE hematopoietic stem progenitor cell mutation site point mutation as well as construction method and application thereof

Abstract

The invention discloses a repair gene editing system aiming at HbE hematopoietic stem progenitor cell mutation site point mutation as well as a construction method and application thereof. The system comprises a nick RNA (Ribonucleic Acid) expression vector, an mRFP1 part, a peg expression vector plasmid and PEmax mRNA, wherein the nick RNA expression vector is formed by carrying out T4 connection on a vector skeleton obtained by carrying out enzyme digestion on pGL3-U6 plasmids and an oligo double-stranded DNA (Deoxyribose Nucleic Acid) sequence formed after annealing; the mRFP1 part is used for cutting off pU6-tevopreq1-GG-acceptor plasmids; the peg expression vector plasmid is used for inserting a redundant part into a designed peg-RNA sequence; the construction method comprises the following steps: firstly, determining a beta-thalassemia mutation site (beta CD26), then constructing a plasmid expression vector (a nick RNA expression vector is subjected to enzyme digestion, purification, connection design and other steps, and a peg expression vector is subjected to excision and sequence insertion), then transfecting a cell screening system by using lipo3000, determining the transfection efficiency, screening out sgRNA2 with high transfection rate, and using the sgRNA2 to prepare a kit. The method is used for accurately repairing Yunnan high-incidence beta-thalassemia mutation sites caused by point mutation of HbE hematopoietic stem / progenitor cell mutation sites.

Description

Technical Field

[0001] The present invention belongs to the field of biotechnology, and specifically relates to a repair gene editing system for point mutations in HbE hematopoietic stem and progenitor cells, and a construction method and application thereof. Background Art

[0002] Thalassemia is abbreviated as thalassemia. It was first discovered in the Mediterranean region, so it is named thalassemia. It is also called sea anemia. It is the most common single gene recessive genetic disease in the world. According to statistics, about 1.5% of the world's population carries a mutation in the β-globin gene (β-globin, HBB) and 5% of the population carries a mutation in the α-globin gene (α-globin, HBA). Thalassemia mainly occurs in the Mediterranean region, sub-Saharan Africa, the Middle East, the Indian subcontinent, East Asia and Southeast Asia, and most areas south of the Yangtze River in my country are high-incidence areas of the disease, especially Guangdong, Guangxi, Hainan and Yunnan.

[0003] In Yunnan Province, the carrier rate of β-thalassemia mutation gene is about 7.31%, among which HbE, β CD17 To occupy the top two positions, their carrying rates are 1.61% and 1.22% respectively. CD26 Also known as HbE, it is a point mutation in codon 26 of the human HBB gene. This mutation is caused by abnormal splicing of exons and belongs to the β + , usually with other β 0 or β + The alleles exist in a compound heterozygous manner. In Southeast Asia, HbE / β - The number of cases of thalassemia is 15 times that of other β-thalassemias. CD17 The phenotypes of the homozygous and compound heterozygous genotypes of the two point mutations are severe or intermediate, covering the mutant genotypes of approximately 38.7% of β-thalassemia patients in my country.

[0004] Therefore, this application uses the HbE mutation site as the research object, and uses PE technology to conduct research on gene editing and repair, hoping to edit and repair the mutation at this site through PE technology, and explore PE technology to improve the efficiency and accuracy of gene editing. It is used to study the repair efficiency of human CD34+ cells and the in vitro hematopoietic differentiation function through the PE gene editing system, which provides a valuable experimental and technical research basis for the application of PE technology to gene edit β-thalassemia mutations, and the future clinical application of gene therapy to cure thalassemia patients. Therefore, this application uses PE editing technology in human HbE hematopoietic stem and progenitor cells to achieve precise repair of β-thalassemia mutations associated with thalassemia, and provides reliable reagents and methods for the clinical treatment of β-thalassemia mutations caused by corresponding mutations. Summary of the invention

[0005] To achieve the above objectives, the present invention provides a repair gene editing system for point mutations in HbE hematopoietic stem / progenitor cell mutation sites, and its construction method and application. The PE editing system with the highest transfection efficiency is obtained through construction and screening, and is applied to the preparation of repairing Yunnan β-thalassemia hotspot mutations caused by point mutations in HbE hematopoietic stem / progenitor cell mutation sites. The specific technical scheme is as follows: A precise gene editing system for repairing point mutations at the mutation site of HbE hematopoietic stem and progenitor cells, the system comprising nick RNA, peg RNA and PEmax mRNA; The peg RNA includes the nucleic acid sequences represented by SEQ 1 to 3, which are as follows: SEQ 1-hCD26-W-pegRNA1:159NT GGTGGATGAAGTTGGTGGTAGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCGGCCTcACCACCAACTTCAATAAATGCGCGGTTCTATCTAGTTACGCGTTAAAACCAACTAGAA; SEQ 2-hCD26-W-pegRNA2: 160NT GGTGGATGAAGTTGGTGGTAGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCGGCCTcACCACCAACTTCAAGAATATGCGCGGTTCTATCTAGTTACGCGTTAAAACCAACTAGAA; SEQ 3-hCD26-W-pegRNA3:161NT GGTGGATGAAGTTGGTGGTAGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCGGCCTcACCACCAACTTCATAATAAATGCGCGGTTCTATCTAGTTACGCGTTAAAACCAACTAGAA; The nick RNA comprises the nucleic acid sequences represented by SEQ 4 to 6, which are as follows: SEQ 4-NickRNA1: TCAGGAGTCAGGTGCACCAGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTTTT; SEQ 5-NickRNA2: AAGGAGACCAATAGAAACTGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTTTT; SEQ 6-NickRNA3: CTGTGGGGCAAGGTGAACGGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTTTT.

[0006] A method for constructing a repair gene editing system for point mutations in HbE hematopoietic stem and progenitor cells, characterized in that it comprises the following steps: S 1, determining the β-thalassemia mutation site, wherein the mutation site is HbE; S 2, construction of plasmid expression vector: S 2.1, Construction of nick RNA expression vector: (1) Enzyme digestion: use BsaⅠ endonuclease to cut pGL3-U6-sgRNA-PGK-puromycin; (2) Purification: purify the digestion product with phenol chloroform to obtain a pure linear PGLE-U6 plasmid; (3) Design sgRNA sequence and oligo; anneal and synthesize double-stranded gRNA; (4) T4 ligation: The purified linear pGL3-U6-sgRNA plasmid is ligated with the oligo double-stranded DNA sequence formed after annealing by T4 ligation. The ligated product is transformed into Escherichia coli and spread on LB solid medium. After overnight culture, a single colony is picked for sequencing to find the colony that is guaranteed to be connected to the target sequence and purify it for later use; S 2.2, Construction of peg expression vector plasmid: (1) Remove the mRFP1 portion and redundant portion of the pU6-tevopreq1-GG-acceptor plasmid; (2) inserting the epeg-RNA sequence, wherein the peg-RNA is composed of Spacer, Scaffold, RTT, PBS and 3' structural motif tevopreQ1 from the 5' end to the 3' end; S 3, Lipofectamine transfection cell screening system S 3.1, using lipo3000 to prepare the transfection system, the expression vector plasmid was transfected into HEK293T cells or K562 cells by liposome transfection; S 3.2, Sanger sequencing was used to determine the transfection efficiency, and the transfection efficiency was compared to screen out the efficient combination of pegRNA, nickRNA1 and PEmax mRNA.

[0007] Furthermore, the above-mentioned repair gene editing system comprising nick RNA, peg RNA and PEmax mRNA is used in the preparation of a reagent for correcting point mutations at mutation sites of HbE hematopoietic stem / progenitor cells.

[0008] Furthermore, the reagent is a kit for correcting HbE.

[0009] Furthermore, the kit includes primers and probes for accurately correcting gene editing preparations and detecting editing results.

[0010] Furthermore, the precise correction gene editing agent includes PEmax mRNA, pegRNA, and nickRNA; The pegRNA includes the nucleic acid sequences represented by SEQ 1 to 3; The nickRNA comprises the nucleic acid sequences represented by SEQ 4 to 6: PEmax mRNA, pegRNA and nickRNA are all in the form of RNA dry powder, equipped with TE buffer for dilution and positive and negative control cells / DNA samples for editing efficiency detection.

[0011] Furthermore, the detection primers for the editing results include first-generation, second-generation and digital PCR primers and digital PCR probes required for detection of target sites after gene editing, and the primers include: Sanger sequencing primer: HBB17 / 26 Fp-554bp: AGGCCATCACTAAAGGCACC HBB17 / 26 Rp-554bp:CCAGAAGAGCCAAGGACAGG Digital PCR detection primer: CD26-FP:AGTCTGCCGTTACTGCCCT CD26-RP:TGGTTCCCTTAAAACCTGTCTTGT Probe: CD26-P-MU:FAM-CAGGGCCTTACCA-MGB CD26-P-WT:VIC-CAGGGCCTCACCA-MGB NGS sequencing primer: CD26NGS-PF-133nt: AGAAGTCTGCCGTTACTGCC CD26NGS-PR-133nt:CTGTCTCCACATGCCCAGTT.

[0012] Furthermore, the precisely corrected guide editing preparations of the kit include: PEmax mRNA, pegRNA1, nickRNA1.

[0013] Compared with the prior art, the present invention has the following beneficial effects: (1) Through the efficient PE technology, we achieved precise repair of HbE, a common mutation site of β-thalassemia in Yunnan Province.

[0014] (2) The candidate PE system screened had a reversion mutation efficiency of 35.7% in HEK293T / K562 cells after transfection editing of HbE. The efficiency and safety of the gene editing system were further verified in HSPCs derived from β-thalassemia patients. Five potential off-target sites were detected, and no off-target phenomenon was found. The edited HSPCs maintained the ideal hematopoietic differentiation ability, and the transcription and protein expression of HBB in the differentiated cells were significantly improved.

[0015] (3) It provides a basis and technical foundation for the clinical application of PE technology in the field of gene therapy for point mutation β-thalassemia. BRIEF DESCRIPTION OF THE DRAWINGS

[0016] Figure 1 To build and verify the main technical route process of the editing system.

[0017] Figure 2 The figure shows the restriction site.

[0018] Figure 3 This is the restriction enzyme test of pGL3-U6 plasmid.

[0019] Figure 4 is the PAM sequence of the mutation site.

[0020] Figure 5 Figure 1. Construction results of nick expression vector.

[0021] Figure 6 The structural composition of epeg-RNA.

[0022] Figure 7 Structure and flow chart for the construction of peg expression vector.

[0023] Figure 8 Design strategy for epeg-RNA.

[0024] Fig. 9 This is a fluorescence image of HEK293T cell transfection.

[0025] Fig.10 This is a fluorescence image of K562 cells transfected.

[0026] Fig.11 Figure 1. Validation of HDR efficiency for TA clones.

[0027] Fig.12 These are the sequencing results of the normal genotype and mutant genotype of the CD26 locus.

[0028] Fig.13 are the electrophoresis bands of each plasmid and expression vector; A is the mRNA electrophoresis band of PEmax and MLH1dn; B is the DNA template and mRNA electrophoresis band of PEmax; C is the electrophoresis diagram of nick-RNA.

[0029] Fig.14 Comparison of sgRNA screening results.

[0030] Fig.15 This is a peak graph of electroporated non-β-thalassemia CD34+ cells.

[0031] Fig.16 This is a graph showing the editing efficiency screening results of electroporated non-β-thalassemia CD34+ cells.

[0032] Fig.17 This is a peak diagram of electroporated β-thalassemia CD34+ cells.

[0033] Fig.18 This is a graph showing the editing efficiency screening results for electroporated β-thalassemia CD34+ cells.

[0034] Fig.19 This is the result of off-target site detection.

[0035] Fig. 20 The results of flow cytometry analysis; Note: (A) is an unstained negative cell. No CD71 or CD235a antibody was added to the cell during the treatment process. The function of flow cytometry detection is to circle the erythroid cell population and set the gate valve according to the single-stained sample. (B) is a cell obtained by erythroid differentiation of mutant CD34+ cells edited by PE. The expression of CD71 is 84.1% and the expression of CD235a is 84.1%. (C) is a cell obtained by erythroid differentiation of mutant CD34+ cells. The expression of CD71 is 81.9% and the expression of CD235a is 81.0%.

[0036] Fig.21 Western blot band diagram and expression result statistics.

[0037] Fig. 22 RT-qPCR expression analysis.

[0038] Fig.23 Protein concentration was determined by standard curve.

[0039] Fig.24 This is the Sanger sequencing peak diagram of NickRNA1, 2, and 3 (PEmax+pegRNA2).

[0040] Fig.25 Example of screening sequencing for pegRNA2,3,1 (2X system, PEmax+nickRNA1). DETAILED DESCRIPTION

[0041] In order to make the purpose, technical solutions and advantages of the present invention more clear, the present invention is further described in detail below in combination with specific implementation methods and with reference to the accompanying drawings.

[0042] Sources of cell lines, plasmids and mRNA: (1) HEK293T cells and K562 cells used in this study were purchased from Chengdu Fei'er Biotechnology Co., Ltd. (2) CD34+ cells used in this study were sorted from peripheral blood or umbilical cord blood. Peripheral blood and umbilical cord blood were recruited by the Department of Medical Genetics of Yunnan Provincial First People's Hospital. All donors have signed written informed consent. (3) The original plasmids used in this study were purchased from Addgene. Most of the subsequent expression vectors were reconstructed and recombined by the authors for cell line liposome transfection experiments. Including: A. Editor plasmids: ① PEmax (pCMV-PEmax, Addgene ID: 174820). ② pCMV-PE2, Addgene ID: 132775. ③ pCMV-PE2-P2A-GFP, Addgene ID: 132776. B. Empty plasmid for constructing epeg vector plasmid: pU6-tevopreq1-GG-acceptor, Addgene ID: 174038. C. Empty plasmid for constructing nick vector plasmid: pGL3-U6-sgRNA-PGK-puromycin, kindly provided by Professor Shi Hong's group. D. Codon-optimized human MLH1dn expression vector: pEF1a-hMLH1dn, Addgene ID: 174824. E. Template plasmid for PEmax in vitro transcription: pT7-PEmax for IVT, Addgene ID: 178113. F. Template plasmid for in vitro transcription of human MLH1dn: pT7-hMLH1dn for IVT, Addgene ID: 178114. The above materials were used to construct cell lines containing HbE mutations in 293T cell lines and K562 cell lines for screening editing systems with higher editing efficiency.

[0043] Example 1: Construction of expression vectors to construct HbE mutant cell lines in 293T cell lines and K562 cell lines

[0044] (1) Preparation of carrier skeleton In this application, the pGL3-U6 plasmid is used to construct the nick expression vector. When constructing the expression vector, the plasmid needs to be digested with a specific endonuclease to form sticky ends for subsequent connection. Figure 2 As shown, the present application selects BsaI endonuclease to perform enzyme digestion on the BsaI site.

[0045] The results of enzyme electrophoresis are as follows Figure 3As shown in the figure, the rightmost is the Marker, and the left of the Marker is the uncut pGL3-U6 plasmid and four cut plasmids. According to DNA Marker=, the molecular weight of the electrophoresis band after cut is determined. If the corresponding band is consistent with the reference band in size, it is determined that the cut is successful and the required vector backbone is obtained for subsequent vector connection.

[0046] (2) Design of sgRNA sequence and oligo This application downloads the HBB gene sequence from NCBI. Based on the CD26 information, the mutation site of the HBB gene sequence is located, and SnapGene software is used to design sgRNA. First, the PAM site is found near the mutation site of HBB. The sgRNA sequence is the sequence of about 20bp before the PAM site. This experiment designs multiple sgRNAs (SEQ ID NO. 11-SEQ ID NO. 16) as shown in Table 4 to construct multiple expression vectors. Figure 4 Shown is our designed site information and one of our sgRNA and PAM sites.

[0047] After the sgRNA is designed, the sequence of the restriction site BsaI corresponding to the vector plasmid is added, and the CACCG linker is added to the upstream of the 5' end of the designed sgRNA sequence, and the AAACC linker is added to the downstream of the 3' end of the sgRNA sequence, that is, one of the sequences is: F-caccgCTGTGGGGCAAGGTGAACG, R-aaacCGTTCACCTTGCCCCACAGc, and the oligo sequence is designed and sent to Qingke Company to synthesize oligo (SEQ ID NO. 17-SEQ ID NO. 28). The synthesized oligo single strands are annealed, and the two oligo single strands are annealed to form double-stranded DNA, and the two ends are provided with restriction site linkers. The plasmid after enzyme digestion can be connected to the sticky end to synthesize the expression vector. Table 1 below is the oligo designed according to the above method.

[0048] Table 1 Oligos for gene editing

[0049] Primer name Primer sequences CD17 / 26-nick-1-FW caccgTCAGGAGTCAGATGCACCA CD17 / 26-nick-1-RV aaacTGGTGCATCTGACTCCTGAc CD17 / 26-nick-2-FV caccgAAGGAGACCAATAGAAACT CD17 / 26-nick-2-RV aaacAGTTTCTATTGGTCTCCTTc CD17 / 26-nick-3-FW caccgCTGTGGGGCAAGGTGAACG CD17 / 26-nick-3-RW aaacCGTTCACCTTGCCCCACAGc

[0050] (3) T4 ligation and construction of expression vector The vector backbone after enzyme digestion and the oligo double-stranded DNA sequence formed after annealing were connected by T4. The connected product was transformed into E. coli and spread on LB solid medium. After overnight culture, single colonies were picked for sequencing. The colonies that were sure to be connected to the target sequence were found and purified for later use. The sequencing results are shown in Figure 2. Figure 5 As shown, the results showed that the sgRNA sequence had been successfully connected to the vector plasmid, indicating that the construction of the nick RNA expression vector was successful.

[0051] 2. Construction of peg expression vector plasmid First, according to the design method of peg-RNA, the length of PBS and RTT sequences was adjusted, and multiple peg-RNAs were designed for the subsequent screening system. The peg expression vector plasmid was synthesized by Qingke Company.

[0052] The structure and design method of peg-RNA are as follows: (1) The structure of epeg-RNA. Figure 6 , from the 5' end to the 3' end, peg-RNAs are composed of Spacer, Scaffold, RTT, PBS and 3' structural motif (tevopreQ1). The protein of PE is shown in the background, the light gray protein is Cas9, and the purple protein is reverse transcriptase. The target genomic DNA is shown in gray, the editing strand is shown in dark gray, and the complementary strand is shown in light gray.

[0053] (2) Design method of peg-RNA. When designing peg RNA, modified peg-RNA should be used as much as possible because they are more efficient. Standard peg-RNA has five components: spacer, scaffold, RTT, PBS and tevopreQ1 structural motif. The scaffold and tevopreQ1 parts are unchanged, but PBS and RTT should be optimized for each new edit. The results are shown in Figure 8. For most editing sites, the optimal PBS sequence length is 10nt, 13nt and 15nt. Unlike PBS sequences, the design of RTT sequences is determined by the type of editing. For edits with small changes, such as single nucleotide polymorphisms (SNPs), the RTT sequence length can be 7nt or even smaller to promote hybridization with complementary genomic chains. For edits with large changes, such as the insertion of epitope tags, the RTT sequence is preferably at least 20nt.

[0054] According to the process shown in Figure 7, the peg expression vector plasmid was constructed. The pU6-tevopreq1-GG-acceptor plasmid was used to remove the mRFP1 part and other redundant parts of the backbone plasmid, and then the designed peg-RNA sequence was inserted to complete the construction of the peg expression vector.

[0055] Example 2: Liposome transfection cell screening After mycoplasma detection confirmed that the cells were free of mycoplasma contamination, liposome transfection was performed, taking HEK293T cells and K562 (purchased from Dufei O'er Biotechnology Co., Ltd.) as examples.

[0056] 1. Lipofectamine transfection of WT-HEK293T cells (1) Screening system After mycoplasma detection confirmed that the cells were not contaminated with mycoplasma, the cells were plated in 24-well plates. After the plates were plated overnight, when the cell density reached about 70% the next day, lipo3000 was used to prepare the transfection system, and the expression vector plasmid was transfected into HEK293T cells by liposome transfection. There are three types of expression vectors transfected, the main editors are: pCMV-PEmax, pCMV-PE2, pCMV-PE2-GFP; nick expression vector; peg expression vector. The three expression vectors were randomly combined, and the liposome transfection system was screened multiple times, and the experiment was repeated multiple times to reduce the error.

[0057] 24 hours after transfection, observe the cell growth status under a fluorescence microscope, and use green fluorescence to observe whether the cells express green fluorescence. Because the pCMV-PE2-P2A-GFP plasmid has the GFP gene, it can express green fluorescent protein. If the plasmid is successfully transfected into the cell, it will emit bright green fluorescence. This can determine whether the plasmid is successfully transfected and roughly estimate the transfection efficiency. The results of cell fluorescence expression identification are as follows: Fig. 9 As shown, Figure A is the bright field field of fluorescence microscopy of HEK293T cells after transfection, Figure B is the fluorescence field of fluorescence microscopy of HEK295T cells after transfection, and Figure C is a composite image of the bright field field and the fluorescence field field.

[0058] (2) Transfection efficiency 48 hours after liposome transfection of HEK293T cells, the genomic DNA of the transfected cells was extracted, and the PCR products of the targeted sites were prepared. The transfection efficiency was determined by Sanger sequencing. The remaining cells were cultured and Puro antibiotics at appropriate concentrations were added to further screen the successfully transfected cells. The sequencing results were analyzed using SnapGene software. After multiple screening systems and comparisons of the results, the following results were obtained.

[0059] The HBB gene HbE was edited to obtain the candidate system with the best efficiency: 800ng of pCMV-PEmax plasmid, 400ng of peg-2 plasmid, 200ng of CD17 / 26-nick-2 plasmid, 1μL of Lipo3000 reagent and 1μL of P3000 reagent were required for transfection in a 24-well plate, and the culture volume was 500μL of culture medium. The screening results showed that the MLH1dn plasmid, which can increase the editing efficiency, did not play a big role in transfection. On the contrary, in most cases, the editing efficiency was reduced due to the addition of MLH1dn plasmid, so the MLH1dn plasmid was no longer used in subsequent experiments.

[0060] 2. Lipofectamine transfection of K562 cells Subsequently, in order to rule out whether this transfection system with the best transfection efficiency works normally in hematopoietic cells, because hematopoietic stem cells are relatively precious, we used K562 cells for further verification to reduce the waste of hematopoietic stem cells. K562 cells are semi-suspended cells, which are closer to the state of hematopoietic stem cells. This application continues to use K562 cells for the same liposome transfection and system screening. Because HEK293T cells are very easy to transfect successfully, and K562 has a lower transfection efficiency than HEK293T cells. The screening results of K562 cells transfected with the PE system are basically consistent with the results of HEK293T cell screening. Fig.10 Figure 1 is the fluorescence expression identification result of K562 cells, where Figure A is the bright field field of fluorescence microscope of K562 cells after transfection, Figure B is the fluorescence field of fluorescence microscope of K562 cells after transfection, and Figure C is the composite image of the bright field field and the fluorescence field field.

[0061] The same treatment method as HEK293T cells, 48h after liposome transfection, DNA was extracted from transfected cells, PCR system was prepared, and sent to Qingke Company to detect transfection efficiency. The remaining cells continued to be cultured, and the appropriate concentration of Puro antibiotics was added to further screen the cells. After 3 days, the sequencing results were sent again for comparison. The sequencing results were returned and analyzed by SnapGene software. After multiple system screenings to reduce accidental errors, the following best transfection system was obtained by comparison of sequencing results. In K562 cells, the system with the best transfection efficiency was also transfected in a 24-well plate, requiring 800ng of pCMV-PEmax plasmid, 400ng of peg2 plasmid (SEQ ID NO. 2), 200ng of CD17 / 26-nick-2 plasmid (SEQ ID NO. 5), and 1μL of Lipo3000 reagent and 1μL of P3000 reagent, cultured in 500μL of culture medium. Consistent with the best transfection system for HEK293T cells.

[0062] Subsequently, the Sanger sequencing spectra were analyzed using the TIDE online website, and the homologous recombination repair (HDR) efficiency of the sequencing results of K562 cell transfection was evaluated. The editing efficiency reached 30.3%, and the expected editing HDR was 30.1%, indicating that this transfection system has a good editing efficiency.

[0063] 3. Transfection of HbE site After the initial success of the screening of CD17 loci, we also screened the liposome transfection system for CD26 loci. The transfection of CD26 loci was further confirmed, and the transfection effect was similar to that of CD17 loci. The system with the highest editing efficiency was also obtained using CD17 / 26-nick-2 plasmid.

[0064] 4. TA cloning The repair efficiency of HDR (homologous recombination repair) was further verified by TA cloning. The gene-edited HEK293T cells were lysed and DNA was extracted. The PCR system was prepared and sequenced. The sequencing results showed that the editing efficiency of the cells was about 30%. It was prepared into PCR, and then the PCR product was transformed into competent Escherichia coli using a TA cloning kit. After overnight culture, 50 single colonies were selected and sent to Qingke for sequencing. The sequencing results were analyzed using SnapGene and TIDE software ( Fig.11 ).

[0065] The successfully edited cells were subjected to monoclonal screening and sequencing. Fig.12 As shown in the figure, the cells in which GAG at the HbE site is completely replaced by AAG. For cells with homozygous mutations, continue to expand the culture and gradually transfer the cells cultured in the 48-well plate to 24-well plates, 12-well plates, 6-well plates and large culture dishes. After obtaining enough cells, freeze them in a liquid nitrogen tank for later use.

[0066] This application subsequently designed a reverse mutation system, and the homozygous mutant cells obtained by the monoclonal screening method were further transfected with liposomes using the reverse mutation system. The results were basically similar to those of the mutation system. This result shows that the PE system we established can achieve gene editing and repair of HEK293T. Example 3: Repairing gene mutations using different guide editing

[0067] For the obtained HbE cell line, the guide editing system was used to achieve correction and repair.

[0068] In this example, PegRNA (SEQ ID NO. 1- SEQ ID NO. 3) and NickRNA (SEQ ID NO. 4- SEQ ID NO. 6) are used in combination with PEmax to repair the mutation site.

[0069] 1. Obtain mRNA by in vitro transcription (1) Obtain PEmax by in vitro transcription. According to the in vitro transcription method of PEmax and MLH1dn mRNA, first design the purchased IVT system backbone plasmid into the mRNA transcription template DNA. Design the primers shown in Table 2 below to include important elements such as the cleavage enzyme and reverse transcriptase of the main editor in the transcription template. Then amplify the template by PCR and fully purify the DNA template using the purification column method.

[0070] Table 2 Primers for linearized plasmid template Primer name sequence Primer F CGAGCTCGGTACCTAATACGACTCACTATAAGG Primer R TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTCCTACTCAGGCTTTATTCAAAGACCA .

[0071] After obtaining the pure template DNA, this application uses the T7 promoter in vitro transcription kit for in vitro transcription. The experimental consumables, reagents and environment must be sterile and free of nuclease throughout the process, because mRNA is easily oxidized. This application uses the Nanodrop 2000C quantifier to quantify, and then divides into 3μg per tube and freezes in a -80℃ refrigerator. We performed agarose gel verification on the successfully transcribed mRNA, such as Fig.13A. The length of PEmax mRNA preset in this application is 6.5kb, and the length of MLH1dn mRNA should be 2.4kb. However, the actual length of PEmax mRNA is only more than 1000 bp, and the length of MLH1dn mRNA is only 800bp. The template DNA was used to verify that the template DNA of PEmax is indeed 6.5kb as we preset, while the length of PEmax mRNA is only more than 1000 bp ( Fig.13 B.) However, since the in vitro synthesized mRNA sequence is too large and has a folded structure, the mRNA is folded. In addition, the denaturation before agarose gel electrophoresis will also cause a certain degree of degradation of the mRNA. This conclusion can be verified by the partial diffusion on the band, but it will not have much impact on the subsequent transfection.

[0072] (2) Obtaining nick-RNA by in vitro transcription. First, based on the previous plasmid transfection, this application selected three sgRNAs with relatively high editing efficiency, as shown in Table 3 below. Based on these sgRNAs, this application designed the corresponding primers for in vitro transcription synthesis, as shown in Table 4 below. Then, we obtained nicke-RNA by in vitro transcription in a sterile and nuclease-free environment. After quantification, it was divided into 1 μg per tube and frozen in a -80°C refrigerator. The nick-RNA (SEQ ID NO. 4-SEQ ID NO. 10) successfully obtained by in vitro transcription was verified by agarose gel, as shown in Fig.13 C. The size of the nick-RNA pre-designed in this application is about 100 bp. Because the sequence length of these nicke-RNAs is relatively small, they do not produce a folded structure like the mRNA of PEmax.

[0073] Table 3 In vitro transcribed sgRNA sequences sgRNA name sequence sgRNA sequence 1 TCAGGAGTCAGATGCACCA sgRNA sequence 2 AAGGAGACCAATAGAAACT sgRNA sequence 3 CTGTGGGGCAAGGTGAACG .

[0074] Table 4 Primers for synthesizing nick-RNA Primer name Primer sequences nickRNA1-primer-F TAATACGACTCACTATAGTCAGGAGTCAGGTGC nickRNA1-primer-R TTCTAGCTCTAAAACTGGTGCACCTGACTCCT nickRNA2-primer-F TAATACGACTCACTATAGAAGGAGACCAATAGA nickRNA2-primer-R TTCTAGCTCTAAAACAGTTTCTATTGGTCTCC nickRNA3-primer-F TAATACGACTCACTATAGCTGTGGGGCAAGGTG nickRNA3-primer-R TTCTAGCTCTAAAACCGTTCACCTTGCCCCAC .

[0075] (3) Synthesize peg-RNA. Similar to the design principle of constructing peg expression vector plasmid, peg-RNA is composed of 5 parts, namely spacer, scaffold, RTT, PBS and tevopreQ1 structural motifs. The scaffold and tevopreQ1 parts are unchanged, but PBS and RTT need to be designed according to different situations. After the previous screening of liposome transfected HEK293T cells, this application obtained the best PBS sequence length of 13bp and RTT sequence length of 18bp. Unlike the construction of peg expression vector plasmid, the synthesis of peg-RNA does not require a plasmid vector backbone. The sequence information is drafted and handed over to the company for synthesis. In addition, chemical modifications need to be added, that is, methyl is added to the 2'O of the three nucleotides before and after each designed peg-RNA, and thiophosphate replaces the phosphodiester bond.

[0076] According to research needs, the synthesized peg-RNA (SEQ ID NO.1-SEQ ID NO.3) not only has a mutation system that guides normal cells to mutation, but also a reversion mutation system that can restore the patient's mutated cells to normal.

[0077] Table 5 Efficiency of repairing gene mutations by different guide editing systems

[0078] The results in the above 5 tables show that the editing efficiency of the guide editing system containing PEmax mRNA, pegRNA1, and nickRNA1 is the best, so this editing system can be used to prepare a kit and use it for the precise repair of the CD26 site mutation in HbE hematopoietic stem and progenitor cells.

[0079] Example 4: In order to avoid differential expression between cells, two sequences (SEQ ID NO. 1 and SEQ ID NO. 4) with good editing efficiency in the liposome transfection screening system were selected for synthesis and subsequently electroporated into CD34 + Cells to verify whether they are consistent with the previous screening results, as follows: (1) Screening of pegRNA and sgRNA targeting HbE CD34 + The efficiency in cells is very low, so a more efficient electro-transfection method is used to transfect CD34 + Cells (LONZA 4D). Due to the scarcity of umbilical cord blood resources, CD34 + Cells account for less than one ten-thousandth of blood cells, and CD34 +The conditions for in vitro cell expansion and culture are not mature, and it is impossible to achieve unlimited proliferation in an in vitro environment. Usually, cells lose their stemness within two weeks. However, the cell resources from β-thalassemia patients are limited. Therefore, this application first uses HSPC cells from HbE homozygous patients to test the components and system performance in PE.

[0080] To effectively utilize CD34 + The Cas9 enzyme and sgRNA system of the classic CRISPR / Cas9 technology were used to electroporate CD34 + The results of sequencing are as follows Fig.14 As shown in Figure 2, sequencing results showed that the editing efficiency of the aforementioned sgRNA1 was still the highest. This system is a classic CRISPR / Cas9 technology, and the resulting DNA double-strand breaks lead to high-frequency indel mutations in HBB.

[0081] (2) PE editing CD34 + cell After determining the sgRNA with the best transfection efficiency, this application used the PE mutation system to first transfect CD34+ cells of non-β-thalassemia patients to clarify the editing efficiency of the PE system on primary therapeutic target cells. The best editing system was obtained after screening: the LONZA electroporator was used, the program was set to DS-130, the electroporation kit used the P3 transfection kit, and the number of cells was 2×10 5 2μg of PEmax mRNA, 1μg of peg-RNA1, and 1μg of nick-RNA1 were added to each cell. The electroporated cells were cultured in a 48-well plate and 200μL of stem cell complete culture medium was added. DNA was extracted two days later and PCR was prepared for sequencing. Fig.15 and Fig.16 As shown, the candidate PE system was electroporated with CD34 cells from non-β-thalassemia patients. + cells, with an editing efficiency of 33.2%.

[0082] (3) Electroporation of mutant CD34+ cells Because the hematopoietic stem cell resources of β-thalassemia patients are limited, the CD34 + After the editing was successful in the cells, we used the reverse mutation system we screened to electroporate the HbE homozygous mutation CD34 + cells to verify whether it can repair CD34 in patients with thalassemia + The final transfection results were similar to the previous screening results. The PE system successfully restored and edited the CD34+ Cells, editing peaks and editing efficiency are shown in Fig.17 and Fig.18 As shown, the editing efficiency reached a maximum of 55.5%.

[0083] Example 5: Functional expression analysis 1. Off-target analysis The CRISPOR online website was used to predict potential off-target sites based on sgRNA, and the five most likely off-target sites were selected, as shown in Table 6 below. Sequencing primers were designed based on the gene sequences of these off-target sites, as shown in Table 7 below. Then, DNA was extracted from HEK293T cells and CD34+ cells that had been successfully gene-edited, and PCR amplification was performed using the corresponding sequencing primers. Agarose gel electrophoresis was used to detect whether the amplification was successful, and finally the PCR product was sent to Qingke Company for sequencing.

[0084] Table 6 Prediction of off-target sites Gene name Potential off-target sequences Chromosome location DPP10 ATTTCACCACGTTCACCT Chr2 PTPRN2 ACTTCTCCGCGTTCACCT Chr7 ZFPM2 AGGGATGTGGATGAAGC Chr8 DLGAP2 AGGGACGTGGATGAAGC Chr8 XKR9 AGGAACATGGATGAAAT Chr8 Table 7 Off-target detection site amplification primer sequences .

[0085] The sequencing results were returned and analyzed using SnapGene software to align the sequences, e.g. Fig.19 As shown, the yellow part is the predicted off-target site, which confirms that no obvious off-target is found in the potential off-target sites. This experiment proves that PE technology not only has high editing efficiency but also has very reliable accuracy. It can avoid the occurrence of negative off-target effects while ensuring editing efficiency.

[0086] 2. Erythroid differentiation Mutant CD34 + After the cell gene editing was successful, this application conducted an 18-day erythroid differentiation to detect the hematopoietic differentiation ability of the gene-edited cells; after the erythroid differentiation was completed, this application used flow cytometry combined with CD71 and CD235a antibodies to detect the cells. CD71, also known as transferrin receptor, is a surface marker molecule closely related to cell growth, which is mainly expressed in the erythroid and myeloid cell lines. When erythrocytes are formed, the expression of CD71 already exists in the early stage of erythroid differentiation, the expression level increases in the primitive erythrocyte period, and the expression level reaches the maximum value in the early and immature erythrocyte periods, and then gradually decreases until it is lost in mature erythrocytes. CD235a is a sialic acid glycoprotein on the surface of erythrocytes, expressed in erythroid precursor cells and erythrocytes.

[0087] The successfully edited mutant CD34+ cells were differentiated into erythroid cells from thalassemia patients and then their hematopoietic differentiation was compared and analyzed by flow cytometry as follows: Fig. 20 As shown, mutant CD34 + The number of cell erythroid markers increased, and both CD71 and CD235a markers were upregulated, indicating that the cells after PE gene editing not only still have the ability of hematopoietic differentiation, but also have increased hematopoietic differentiation ability.

[0088] 3. RT-qPCR To verify the edited CD34 + To investigate the changes in HBB in cells, the present invention extracted RNA from erythroid differentiated cells, further transcribed it into cDNA, and performed RT-qPCR using the primers in Table 8 to detect the expression of β-globin in cells. We set up three groups of cells, namely, mutant CD34 + Cells derived from erythroid differentiation, normal CD34 cells without gene editing + Cells derived from erythroid differentiation and mutant CD34 edited by PE + The cells obtained by erythroid differentiation. The expression data of β-globin mRNA in each group are shown in Table 9.

[0089] Table 8 RT-qPCR primer sequences for HBB and β-actin genes Primer name Primer sequences -qP-F GCACGTGGATCCTGAGAACT -qP-R ATTGGACAGCAAGAAAGCGA β-actin-F CCTGGCACCCAGCACAAT β-actin-R GGGCCGGACTCGTCATAC .

[0090] Table 9 β-globin mRNA expression data

[0092] After analyzing the results, Fig. 22 As shown in the figure, it was found that the expression of β-globin in the cells obtained by erythroid differentiation of mutant CD34+ cells edited by PE was significantly upregulated, and the expression increased to 1.66±0.26 times, and the result was significant (p<0.001). This shows that at the mRNA level, cells edited by PE can increase the expression of β-globin.

[0093] 4. WB In order to verify the expression of β-globin in edited CD34+ cells, this experiment also performed immunoblotting experiments on the above three cells from the protein expression level. Proteins were extracted from the three cells and the protein concentration was determined using the BCA kit. The standard curve is shown in Fig.23As shown in Figure 2, the standard curve equation is: y = 1665.2x - 188.84, R2 = 0.9964. After measuring the protein concentration, WB experiment was performed, β-actin was selected as the internal reference, β-globin was selected as the primary antibody, and the protein loading amount was 20μg. The immunoblot bands were detected as follows Fig.21 As shown in (A), the cells derived from erythroid differentiation of normal CD34+ cells that have not been gene-edited have the highest expression. Compared with the cells derived from erythroid differentiation of mutant CD34+ cells, the cells derived from erythroid differentiation of mutant CD34+ cells edited with PE have higher protein expression. The grayscale value of the immunoblot bands was further analyzed using ImageJ software, and the expression of cells derived from erythroid differentiation of mutant CD34+ cells at the CD26 site was set to 1. The expression of cells edited with PE was analyzed. The analysis results are shown in Figure 2. Fig.21 As shown in (B), the expression of β-globin in cells edited with PE was upregulated to 1.34±0.12 times, and the result was significant (P<0.001).

[0094] In summary, this application uses PE technology to design peg RNA and nick RNA sequences of target sites, construct expression vectors, and first use liposomes to transfect HEK293T / K562 cells for efficient and safe system screening; the candidate PE mRNA system is electroporated into hematopoietic stem / progenitor cells (HSPCs) derived from β-thalassemia patients, and PCR product Sanger sequencing, flow cytometry, real-time quantitative polymerase chain reaction (realtime quantitative PCR, RT-qPCR) and protein blotting (western blotting, WB) and other technologies are used to verify the editing efficiency, off-target situation, in vitro erythroid differentiation ability, and the transcription and protein expression level of the β-globin gene (hemoglobinsubunit beta, HBB) after recovery. The editing efficiencies of the candidate PE system in HEK293T / K562 cells transfected with βCD17 sites were 45.6% and 30.3%, respectively. The efficiency and safety of the gene editing system were further verified in HSPCs from patients with β-thalassemia. The HbE reverse mutation efficiency was 35.7%, and 5 potential off-target sites were detected, with no off-target phenomenon. The edited HSPCs maintained the ideal hematopoietic differentiation ability, and the transcription and protein expression of HBB in the differentiated cells were significantly improved.

[0095] Therefore, it can be proved that PE technology can achieve the high incidence of β-thalassemia mutation site HbE in Yunnan Province. This study provides a basis and technical foundation for the clinical application of PE technology in the field of gene therapy for point mutation β-thalassemia.

[0096] It should be understood that the above specific embodiments of the present invention are only used for illustrative inventions or to explain the principles of the present invention, and do not constitute limitations on the present invention. Therefore, any modifications, equivalent substitutions, improvements, etc. made without departing from the spirit and scope of the present invention should be included in the protection scope of the present invention. In addition, the appended claims of the present invention are intended to cover all changes and modifications that fall within the scope and boundaries of the appended claims, or the equivalent forms of such scope and boundaries.

Claims

1. A repair gene editing system for point mutations in HbE hematopoietic stem and progenitor cells, characterized in that: The system includes nick RNA, peg RNA and PEmax mRNA; The peg RNA includes the nucleic acid sequences represented by SEQ1 to 3; The nick RNA includes the nucleic acid sequences represented by SEQ 4 to 6.

2. A method for constructing a repair gene editing system for point mutations in HbE hematopoietic stem and progenitor cells, characterized in that: The following steps are involved: S 1, determining the β-thalassemia mutation site, wherein the mutation site is HbE; S 2, construction of plasmid expression vector: S 2.1, Construction of nick RNA expression vector: (1) Enzyme digestion: use BsaⅠ endonuclease to cut pGL3-U6-sgRNA-PGK-puromycin; (2) Purification: purify the digestion product with phenol chloroform to obtain a pure linear PGLE-U6 plasmid; (3) Design sgRNA sequence and oligo; anneal and synthesize double-stranded gRNA; (4) T4 ligation: The purified linear pGL3-U6-sgRNA plasmid is ligated with the oligo double-stranded DNA sequence formed after annealing by T4 ligation. The ligated product is transformed into Escherichia coli and spread on LB solid medium. After overnight culture, a single colony is picked for sequencing to find the colony that is guaranteed to be connected to the target sequence and purify it for later use; S 2.2, Construction of peg expression vector plasmid: (1) Remove the mRFP1 portion and redundant portion of the pU6-tevopreq1-GG-acceptor plasmid; (2) inserting the epeg-RNA sequence, wherein the peg-RNA is composed of Spacer, Scaffold, RTT, PBS and 3' structural motif tevopreQ1 from the 5' end to the 3' end; S 3, Lipofectamine transfection cell screening system S 3.1, using lipo3000 to prepare the transfection system, the expression vector plasmid was transfected into HEK293T cells or K562 cells by liposome transfection; S 3.2, Sanger sequencing was used to determine the transfection efficiency, and the transfection efficiency was compared to screen out the efficient combination of pegRNA, nickRNA1 and PEmax mRNA.

3. Use of a repair gene editing system for point mutations at HbE hematopoietic stem / progenitor cell mutation sites according to claim 1 in the preparation of a reagent for correcting point mutations at HbE hematopoietic stem / progenitor cell mutation sites.

4. The use according to claim 3, characterized in that: The reagent is a kit for correcting HbE.

5. The use according to claim 4, characterized in that: The kit includes a precise correction gene editing preparation, and primers and probes for detecting the editing results.

6. The kit according to claim 5, characterized in that The precise correction gene editing agent includes PEmaxmRNA, pegRNA, and nickRNA; The pegRNA includes the nucleic acid sequences represented by SEQ1 to 3; The nickRNA includes the nucleic acid sequences represented by SEQ 4 to 6; PEmax mRNA, pegRNA and nickRNA are all in the form of RNA dry powder, equipped with TE buffer for dilution and positive and negative control cells / DNA samples for editing efficiency detection.

7. The kit according to claim 5, characterized in that The detection primers for the editing results include first-generation, second-generation and digital PCR primers and digital PCR probes required for detecting the target site after gene editing; the primers include: Sanger sequencing primer: HBB17 / 26 Fp-554bp: AGGCCATCACTAAAGGCACC HBB17 / 26 Rp-554bp:CCAGAAGAGCCAAGGACAGG Digital PCR detection primer: CD26-FP:AGTCTGCCGTTACTGCCCT CD26-RP:TGGTTCCCTTAAAACCTGTCTTGT Probe: CD26-P-MU:FAM-CAGGGCCTTACCA-MGB CD26-P-WT:VIC-CAGGGCCTCACCA-MGB NGS sequencing primer: CD26NGS-PF-133nt: AGAAGTCTGCCGTTACTGCC CD26NGS-PR-133nt:CTGTCTCCACATGCCCAGTT.

8. The kit according to claim 5, characterized in that The precise correction gene editing agents of this kit include: PEmax mRNA, pegRNA1, and nickRNA1.

Images